Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018786 Chryseobacterium indologenes strain AA5 chromosome, complete genome 4 crisprs cas3,PD-DExK,WYL,DEDDh,csa3 0 1 5 0

Results visualization

1. NZ_CP018786
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018786_1 279112-279187 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018786_2 980347-980569 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018786_3 1803396-1803616 Unclear NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018786_4 2560326-2560428 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018786_1 1.1|279137|26|NZ_CP018786|CRISPRCasFinder 279137-279162 26 KX017520 Salmonella phage 64795_sal3, complete genome 38515-38540 4 0.846
NZ_CP018786_1 1.1|279137|26|NZ_CP018786|CRISPRCasFinder 279137-279162 26 HG796800 Uncultured bacterium plasmid pRGF00059 2037-2062 5 0.808

1. spacer 1.1|279137|26|NZ_CP018786|CRISPRCasFinder matches to KX017520 (Salmonella phage 64795_sal3, complete genome) position: , mismatch: 4, identity: 0.846

agcatcgttaatgggagaaaatatat	CRISPR spacer
tgcatggttaatgggaaaaaatatag	Protospacer
 **** **********.******** 

2. spacer 1.1|279137|26|NZ_CP018786|CRISPRCasFinder matches to HG796800 (Uncultured bacterium plasmid pRGF00059) position: , mismatch: 5, identity: 0.808

agcatcgttaatgggagaaaatatat	CRISPR spacer
taaatctttaatgggaaaaaatatat	Protospacer
 . *** *********.*********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1823608 : 1834806 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 3180703 : 3260591 58 uncultured_phage(22.22%) tail,protease,plate NA
DBSCAN-SWA_3 3620663 : 3634183 20 Riemerella_phage(75.0%) capsid NA
DBSCAN-SWA_4 3887485 : 3895852 9 Pelagibacter_phage(16.67%) NA NA
DBSCAN-SWA_5 5110249 : 5115890 8 Cellulophaga_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage