Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020058 Escherichia coli strain AR_0061 chromosome, complete genome 10 crisprs DEDDh,DinG,c2c9_V-U4,cas3,WYL,csa3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 0 16 5 0
NZ_CP020059 Escherichia coli strain AR_0061 plasmid unitig_1, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 1 crisprs NA 0 1 7 0

Results visualization

1. NZ_CP020058
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020058_1 148360-148493 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020058_2 522695-522818 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020058_3 1161268-1161359 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020058_4 1302865-1303070 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020058_5 1422954-1423098 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020058_6 1660665-1660759 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020058_7 2182657-2182789 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020058_8 3984299-3984510 TypeI-E I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020058_9 4006051-4006445 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020058_10 4518270-4518387 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020058_3 3.1|1161294|40|NZ_CP020058|CRISPRCasFinder 1161294-1161333 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP020058_7 7.1|2182674|42|NZ_CP020058|PILER-CR 2182674-2182715 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11833-11866 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36518-36551 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9504-9537 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65532-65565 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64163-64196 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119282-119315 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85097-85130 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42114-42147 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87235-87268 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70498-70531 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62995-63028 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 MH422554 Escherichia phage P1, complete genome 87192-87225 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NC_050152 Enterobacteria phage P7, complete genome 93993-94026 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58643-58676 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 MH445381 Escherichia virus P1, complete genome 56868-56901 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42180 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1590 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94789 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61949 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20319 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46721 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81886 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47894 1 0.971
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NC_031129 Salmonella phage SJ46, complete genome 77363-77396 1 0.971
NZ_CP020058_2 2.1|522738|38|NZ_CP020058|CRISPRCasFinder 522738-522775 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP020058_9 9.3|4006202|32|NZ_CP020058|CRISPRCasFinder,CRT 4006202-4006233 32 AP012539 Stx2-converting phage Stx2a_WGPS6 proviral DNA, complete genome 19681-19712 2 0.938
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 NZ_CP023851 Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence 71166-71197 2 0.938
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 NZ_CP048306 Escherichia coli strain 9 plasmid p009_B, complete sequence 71579-71610 2 0.938
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 NZ_CP041423 Escherichia coli strain STEC409 plasmid pSTEC409_1, complete sequence 57771-57802 2 0.938
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 NZ_CP019013 Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence 49237-49268 2 0.938
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 NZ_CP022167 Escherichia coli strain M160133 plasmid pM160133_p3, complete sequence 80644-80675 2 0.938
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 NZ_CP019027 Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence 43940-43971 2 0.938
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 NZ_CP031136 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence 30387-30418 2 0.938
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 NZ_MH257954 Escherichia coli strain 104 plasmid pHXH-2, complete sequence 71853-71884 2 0.938
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 CP053388 Escherichia phage CMS-2020a, complete sequence 69160-69191 2 0.938
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
NZ_CP020058_9 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT 4006385-4006416 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
NZ_CP020058_9 9.11|4006324|34|NZ_CP020058|PILER-CR 4006324-4006357 34 NZ_CP041423 Escherichia coli strain STEC409 plasmid pSTEC409_1, complete sequence 57769-57802 3 0.912
NZ_CP020058_9 9.11|4006324|34|NZ_CP020058|PILER-CR 4006324-4006357 34 NZ_CP019013 Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence 49235-49268 3 0.912
NZ_CP020058_9 9.11|4006324|34|NZ_CP020058|PILER-CR 4006324-4006357 34 NZ_CP031136 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence 30385-30418 3 0.912
NZ_CP020058_9 9.11|4006324|34|NZ_CP020058|PILER-CR 4006324-4006357 34 NZ_CP023851 Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence 71166-71199 3 0.912
NZ_CP020058_9 9.11|4006324|34|NZ_CP020058|PILER-CR 4006324-4006357 34 NZ_CP048306 Escherichia coli strain 9 plasmid p009_B, complete sequence 71579-71612 3 0.912
NZ_CP020058_9 9.11|4006324|34|NZ_CP020058|PILER-CR 4006324-4006357 34 NZ_CP022167 Escherichia coli strain M160133 plasmid pM160133_p3, complete sequence 80644-80677 3 0.912
NZ_CP020058_9 9.11|4006324|34|NZ_CP020058|PILER-CR 4006324-4006357 34 NZ_CP019027 Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence 43940-43973 3 0.912
NZ_CP020058_9 9.11|4006324|34|NZ_CP020058|PILER-CR 4006324-4006357 34 NZ_MH257954 Escherichia coli strain 104 plasmid pHXH-2, complete sequence 71853-71886 3 0.912
NZ_CP020058_9 9.11|4006324|34|NZ_CP020058|PILER-CR 4006324-4006357 34 CP053388 Escherichia phage CMS-2020a, complete sequence 69160-69193 3 0.912
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17438-17471 3 0.912
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122308-122341 3 0.912
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6027-6060 3 0.912
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131400-131433 3 0.912
NZ_CP020058_9 9.12|4006385|34|NZ_CP020058|PILER-CR 4006385-4006418 34 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15154 3 0.912
NZ_CP020058_9 9.9|4006202|34|NZ_CP020058|PILER-CR 4006202-4006235 34 AP012539 Stx2-converting phage Stx2a_WGPS6 proviral DNA, complete genome 19679-19712 4 0.882
NZ_CP020058_1 1.1|148398|58|NZ_CP020058|CRISPRCasFinder 148398-148455 58 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 104-161 5 0.914
NZ_CP020058_9 9.2|4006141|32|NZ_CP020058|CRISPRCasFinder,CRT 4006141-4006172 32 MN340231 Escherichia phage phiv205-1, complete genome 27201-27232 5 0.844
NZ_CP020058_9 9.2|4006141|32|NZ_CP020058|CRISPRCasFinder,CRT 4006141-4006172 32 NC_049952 Escherichia virus Lambda_2B8 genome assembly, chromosome: 1 47909-47940 5 0.844
NZ_CP020058_9 9.8|4006141|34|NZ_CP020058|PILER-CR 4006141-4006174 34 MN340231 Escherichia phage phiv205-1, complete genome 27199-27232 6 0.824
NZ_CP020058_9 9.8|4006141|34|NZ_CP020058|PILER-CR 4006141-4006174 34 NC_049952 Escherichia virus Lambda_2B8 genome assembly, chromosome: 1 47909-47942 6 0.824
NZ_CP020058_9 9.3|4006202|32|NZ_CP020058|CRISPRCasFinder,CRT 4006202-4006233 32 NZ_CP044489 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-6, complete sequence 4987-5018 7 0.781
NZ_CP020058_9 9.3|4006202|32|NZ_CP020058|CRISPRCasFinder,CRT 4006202-4006233 32 NZ_CP033122 Acinetobacter wuhouensis strain WCHAW010062 plasmid p2_010062, complete sequence 1726-1757 7 0.781
NZ_CP020058_8 8.3|3984450|32|NZ_CP020058|CRISPRCasFinder,CRT 3984450-3984481 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
NZ_CP020058_9 9.1|4006080|32|NZ_CP020058|CRISPRCasFinder,CRT 4006080-4006111 32 NZ_CP011869 Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence 176963-176994 8 0.75
NZ_CP020058_9 9.3|4006202|32|NZ_CP020058|CRISPRCasFinder,CRT 4006202-4006233 32 LC467982 Enterobacter cloacae complex sp. Keio CL MIC 0002 plasmid pKeio-CL-MIC-0002-3 DNA, complete sequence 63093-63124 8 0.75
NZ_CP020058_4 4.3|1303009|33|NZ_CP020058|CRISPRCasFinder,CRT 1303009-1303041 33 MN855903 Myoviridae sp. isolate 490, partial genome 4171-4203 9 0.727
NZ_CP020058_4 4.5|1303010|32|NZ_CP020058|PILER-CR 1303010-1303041 32 MN855903 Myoviridae sp. isolate 490, partial genome 4171-4202 9 0.719
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 NZ_CP011009 Bacillus simplex strain SH-B26 plasmid pSHB26, complete sequence 147371-147402 9 0.719
NZ_CP020058_9 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT 4006324-4006355 32 MN693961 Marine virus AFVG_250M531, complete genome 39943-39974 9 0.719
NZ_CP020058_1 1.1|148398|58|NZ_CP020058|CRISPRCasFinder 148398-148455 58 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7432-7489 11 0.81
NZ_CP020058_1 1.1|148398|58|NZ_CP020058|CRISPRCasFinder 148398-148455 58 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84256-84313 11 0.81

1. spacer 3.1|1161294|40|NZ_CP020058|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 7.1|2182674|42|NZ_CP020058|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

3. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

4. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

5. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

6. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

7. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

8. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

9. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

10. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

11. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

12. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

13. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

14. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

15. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

16. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

17. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

18. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

19. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

20. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

21. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

22. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

23. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

24. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

25. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

26. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

27. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

28. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

29. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

30. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

31. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

32. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

33. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

34. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

35. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

36. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

37. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

38. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

39. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

40. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

41. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

42. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

43. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

44. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

45. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

46. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

47. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

48. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

49. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

50. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 1, identity: 0.971 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgttt	Protospacer
******************************** *

51. spacer 2.1|522738|38|NZ_CP020058|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

52. spacer 9.3|4006202|32|NZ_CP020058|CRISPRCasFinder,CRT matches to AP012539 (Stx2-converting phage Stx2a_WGPS6 proviral DNA, complete genome) position: , mismatch: 2, identity: 0.938 

tgttttcctgcaataaaacgacgctcgttacg	CRISPR spacer
tgttttcctgcaataaaacgacattcgttacg	Protospacer
**********************..********

53. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP023851 (Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence) position: , mismatch: 2, identity: 0.938 

atttctttaattatttagctgatgcttttaaa	CRISPR spacer
atttctacaattatttagctgatgcttttaaa	Protospacer
****** .************************

54. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP048306 (Escherichia coli strain 9 plasmid p009_B, complete sequence) position: , mismatch: 2, identity: 0.938 

atttctttaattatttagctgatgcttttaaa	CRISPR spacer
atttctacaattatttagctgatgcttttaaa	Protospacer
****** .************************

55. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP041423 (Escherichia coli strain STEC409 plasmid pSTEC409_1, complete sequence) position: , mismatch: 2, identity: 0.938 

atttctttaattatttagctgatgcttttaaa	CRISPR spacer
atttctacaattatttagctgatgcttttaaa	Protospacer
****** .************************

56. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP019013 (Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence) position: , mismatch: 2, identity: 0.938 

atttctttaattatttagctgatgcttttaaa	CRISPR spacer
atttctacaattatttagctgatgcttttaaa	Protospacer
****** .************************

57. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP022167 (Escherichia coli strain M160133 plasmid pM160133_p3, complete sequence) position: , mismatch: 2, identity: 0.938 

atttctttaattatttagctgatgcttttaaa	CRISPR spacer
atttctacaattatttagctgatgcttttaaa	Protospacer
****** .************************

58. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP019027 (Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence) position: , mismatch: 2, identity: 0.938 

atttctttaattatttagctgatgcttttaaa	CRISPR spacer
atttctacaattatttagctgatgcttttaaa	Protospacer
****** .************************

59. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP031136 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence) position: , mismatch: 2, identity: 0.938 

atttctttaattatttagctgatgcttttaaa	CRISPR spacer
atttctacaattatttagctgatgcttttaaa	Protospacer
****** .************************

60. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_MH257954 (Escherichia coli strain 104 plasmid pHXH-2, complete sequence) position: , mismatch: 2, identity: 0.938 

atttctttaattatttagctgatgcttttaaa	CRISPR spacer
atttctacaattatttagctgatgcttttaaa	Protospacer
****** .************************

61. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to CP053388 (Escherichia phage CMS-2020a, complete sequence) position: , mismatch: 2, identity: 0.938 

atttctttaattatttagctgatgcttttaaa	CRISPR spacer
atttctacaattatttagctgatgcttttaaa	Protospacer
****** .************************

62. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

63. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

64. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

65. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

66. spacer 9.6|4006385|32|NZ_CP020058|CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938 

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgt	Protospacer
************ * *****************

67. spacer 9.11|4006324|34|NZ_CP020058|PILER-CR matches to NZ_CP041423 (Escherichia coli strain STEC409 plasmid pSTEC409_1, complete sequence) position: , mismatch: 3, identity: 0.912 

atttctttaattatttagctgatgcttttaaagt	CRISPR spacer
atttctacaattatttagctgatgcttttaaagc	Protospacer
****** .*************************.

68. spacer 9.11|4006324|34|NZ_CP020058|PILER-CR matches to NZ_CP019013 (Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence) position: , mismatch: 3, identity: 0.912 

atttctttaattatttagctgatgcttttaaagt	CRISPR spacer
atttctacaattatttagctgatgcttttaaagc	Protospacer
****** .*************************.

69. spacer 9.11|4006324|34|NZ_CP020058|PILER-CR matches to NZ_CP031136 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence) position: , mismatch: 3, identity: 0.912 

atttctttaattatttagctgatgcttttaaagt	CRISPR spacer
atttctacaattatttagctgatgcttttaaagc	Protospacer
****** .*************************.

70. spacer 9.11|4006324|34|NZ_CP020058|PILER-CR matches to NZ_CP023851 (Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence) position: , mismatch: 3, identity: 0.912 

atttctttaattatttagctgatgcttttaaagt	CRISPR spacer
atttctacaattatttagctgatgcttttaaagc	Protospacer
****** .*************************.

71. spacer 9.11|4006324|34|NZ_CP020058|PILER-CR matches to NZ_CP048306 (Escherichia coli strain 9 plasmid p009_B, complete sequence) position: , mismatch: 3, identity: 0.912 

atttctttaattatttagctgatgcttttaaagt	CRISPR spacer
atttctacaattatttagctgatgcttttaaagc	Protospacer
****** .*************************.

72. spacer 9.11|4006324|34|NZ_CP020058|PILER-CR matches to NZ_CP022167 (Escherichia coli strain M160133 plasmid pM160133_p3, complete sequence) position: , mismatch: 3, identity: 0.912 

atttctttaattatttagctgatgcttttaaagt	CRISPR spacer
atttctacaattatttagctgatgcttttaaagc	Protospacer
****** .*************************.

73. spacer 9.11|4006324|34|NZ_CP020058|PILER-CR matches to NZ_CP019027 (Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence) position: , mismatch: 3, identity: 0.912 

atttctttaattatttagctgatgcttttaaagt	CRISPR spacer
atttctacaattatttagctgatgcttttaaagc	Protospacer
****** .*************************.

74. spacer 9.11|4006324|34|NZ_CP020058|PILER-CR matches to NZ_MH257954 (Escherichia coli strain 104 plasmid pHXH-2, complete sequence) position: , mismatch: 3, identity: 0.912 

atttctttaattatttagctgatgcttttaaagt	CRISPR spacer
atttctacaattatttagctgatgcttttaaagc	Protospacer
****** .*************************.

75. spacer 9.11|4006324|34|NZ_CP020058|PILER-CR matches to CP053388 (Escherichia phage CMS-2020a, complete sequence) position: , mismatch: 3, identity: 0.912 

atttctttaattatttagctgatgcttttaaagt	CRISPR spacer
atttctacaattatttagctgatgcttttaaagc	Protospacer
****** .*************************.

76. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 3, identity: 0.912 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgttt	Protospacer
***.******** ******************* *

77. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 3, identity: 0.912 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgttt	Protospacer
***.******** ******************* *

78. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 3, identity: 0.912 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgttt	Protospacer
****************.***** ********* *

79. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 3, identity: 0.912 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgttt	Protospacer
************ * ***************** *

80. spacer 9.12|4006385|34|NZ_CP020058|PILER-CR matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 3, identity: 0.912 

ggtaaaaacacggtctgaaccgacattcatgtgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgttt	Protospacer
****************.***** ********* *

81. spacer 9.9|4006202|34|NZ_CP020058|PILER-CR matches to AP012539 (Stx2-converting phage Stx2a_WGPS6 proviral DNA, complete genome) position: , mismatch: 4, identity: 0.882 

tgttttcctgcaataaaacgacgctcgttacgga	CRISPR spacer
tgttttcctgcaataaaacgacattcgttacgtt	Protospacer
**********************..********

82. spacer 1.1|148398|58|NZ_CP020058|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 5, identity: 0.914 

ttgaatgccggatgcggcgtgaacgccttatccggcctacggttctgtgctcgggtct	CRISPR spacer
acgatcgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggtct	Protospacer
 .** .**************************** ***********************

83. spacer 9.2|4006141|32|NZ_CP020058|CRISPRCasFinder,CRT matches to MN340231 (Escherichia phage phiv205-1, complete genome) position: , mismatch: 5, identity: 0.844 

tggctgagtacttcggcaaacgacacggcgat	CRISPR spacer
ttgccaagtacttcggcaagcgacacggtgat	Protospacer
* **..*************.********.***

84. spacer 9.2|4006141|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NC_049952 (Escherichia virus Lambda_2B8 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.844 

tggctgagtacttcggcaaacgacacggcgat	CRISPR spacer
ttgccaagtacttcggcaagcgacacggtgat	Protospacer
* **..*************.********.***

85. spacer 9.8|4006141|34|NZ_CP020058|PILER-CR matches to MN340231 (Escherichia phage phiv205-1, complete genome) position: , mismatch: 6, identity: 0.824 

tggctgagtacttcggcaaacgacacggcgatga	CRISPR spacer
ttgccaagtacttcggcaagcgacacggtgatgt	Protospacer
* **..*************.********.****

86. spacer 9.8|4006141|34|NZ_CP020058|PILER-CR matches to NC_049952 (Escherichia virus Lambda_2B8 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.824 

tggctgagtacttcggcaaacgacacggcgatga	CRISPR spacer
ttgccaagtacttcggcaagcgacacggtgatgt	Protospacer
* **..*************.********.****

87. spacer 9.3|4006202|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP044489 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-6, complete sequence) position: , mismatch: 7, identity: 0.781 

tgttttcctgcaataaaacgacgct-cgttacg	CRISPR spacer
tatttttctgcaataaaacgacactatattat-	Protospacer
*.****.***************.** ..***.

88. spacer 9.3|4006202|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP033122 (Acinetobacter wuhouensis strain WCHAW010062 plasmid p2_010062, complete sequence) position: , mismatch: 7, identity: 0.781 

tgttttcctgcaataaaacgacgct-cgttacg	CRISPR spacer
tatttttctgcaataaaacgacactatattat-	Protospacer
*.****.***************.** ..***.

89. spacer 8.3|3984450|32|NZ_CP020058|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75 

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **

90. spacer 9.1|4006080|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.75 

aatggccgggtggtgatgggttcccgttcact	CRISPR spacer
gacggccgggtggtgatggagtcccgcgccca	Protospacer
.*.****************. *****. * *

91. spacer 9.3|4006202|32|NZ_CP020058|CRISPRCasFinder,CRT matches to LC467982 (Enterobacter cloacae complex sp. Keio CL MIC 0002 plasmid pKeio-CL-MIC-0002-3 DNA, complete sequence) position: , mismatch: 8, identity: 0.75 

tgttttcctgcaataaaacgacgctcgttacg	CRISPR spacer
cgctttccagcaataaaaagacgctcataaga	Protospacer
.*.***** ********* *******.* * .

92. spacer 4.3|1303009|33|NZ_CP020058|CRISPRCasFinder,CRT matches to MN855903 (Myoviridae sp. isolate 490, partial genome) position: , mismatch: 9, identity: 0.727 

gttcgctgcaaccgctagccaagacggtaggtt	CRISPR spacer
gttcgctgcaaccgttcgccaagaccacaaagg	Protospacer
**************.* ******** ..*..

93. spacer 4.5|1303010|32|NZ_CP020058|PILER-CR matches to MN855903 (Myoviridae sp. isolate 490, partial genome) position: , mismatch: 9, identity: 0.719 

ttcgctgcaaccgctagccaagacggtaggtt	CRISPR spacer
ttcgctgcaaccgttcgccaagaccacaaagg	Protospacer
*************.* ******** ..*..

94. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to NZ_CP011009 (Bacillus simplex strain SH-B26 plasmid pSHB26, complete sequence) position: , mismatch: 9, identity: 0.719 

atttctttaattatttagctgatgcttttaaa	CRISPR spacer
ttatctttaattattgagatgatgctccgcat	Protospacer
 * ************ ** *******..  *

95. spacer 9.5|4006324|32|NZ_CP020058|CRISPRCasFinder,CRT matches to MN693961 (Marine virus AFVG_250M531, complete genome) position: , mismatch: 9, identity: 0.719 

atttcttt-----aattatttagctgatgcttttaaa	CRISPR spacer
-----tatgaaagaattatttagctgatgcagttaag	Protospacer
     * *     *****************  ****.

96. spacer 1.1|148398|58|NZ_CP020058|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 11, identity: 0.81 

ttgaatgccggatgcggcgtgaacgccttatccggcctacggttctgtgctcgggtct--	CRISPR spacer
acaattgccggatgcggcgtgaacgccttatccggcctacggttgagtgc---agttttg	Protospacer
 ..* ***************************************  ****   .**.*

97. spacer 1.1|148398|58|NZ_CP020058|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 11, identity: 0.81 

ttgaatgccggatgcggcgtgaacgccttatccggcctacggttctgtgctcgggtct--	CRISPR spacer
acaattgccggatgcggcgtgaacgccttatccggcctacggttgagtgc---agttttg	Protospacer
 ..* ***************************************  ****   .**.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 51644 : 61085 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_2 151061 : 157368 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_3 832994 : 853940 25 Enterobacteria_phage(25.0%) lysis,tRNA,transposase,tail NA
DBSCAN-SWA_4 1872304 : 1954699 95 Enterobacteria_phage(36.51%) integrase,portal,head,tail,plate,holin,capsid,terminase,transposase,protease attL 1876678:1876692|attR 1951091:1951105
DBSCAN-SWA_5 4013870 : 4027053 12 Escherichia_phage(50.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP020059
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9134 : 49273 37 Salmonella_phage(25.0%) integrase,transposase attL 6803:6862|attR 52323:52468
DBSCAN-SWA_2 66870 : 75408 8 Burkholderia_phage(42.86%) integrase,transposase attL 66137:66154|attR 73321:73338

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP020060
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020060_1 30529-30648 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 63874-63907 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 64169-64202 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 38215-38248 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 37006-37039 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP010164 Escherichia coli strain H2 plasmid A, complete sequence 20751-20784 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 239581-239614 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP022964 Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence 30266-30299 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP024467 Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence 17630-17663 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 16611-16644 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 53074-53107 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 32601-32634 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP047093 Salmonella sp. S13 plasmid pS13-4, complete sequence 1762-1795 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 23725-23758 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP046002 Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence 35337-35370 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 26770-26803 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 41390-41423 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 60962-60995 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP032386 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence 39391-39424 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP032389 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence 9889-9922 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_LT904873 Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2 5696-5729 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_KT754163 Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence 12265-12298 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP033383 Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence 7366-7399 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP020836 Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence 20407-20440 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 93494-93527 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP043216 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence 32193-32226 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 25537-25570 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP031361 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence 27033-27066 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 25749-25782 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP040929 Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence 2187-2220 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP033386 Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence 34721-34754 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 4942-4975 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 47580-47613 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 14631-14664 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP047339 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence 28949-28982 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_010860 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence 32623-32656 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP022453 Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence 5893-5926 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 53536-53569 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP030208 Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence 39815-39848 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP005994 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence 30028-30061 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP032450 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence 29110-29143 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP010155 Escherichia coli strain D9 plasmid C, complete genome 14497-14530 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 58667-58700 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP029061 Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence 10786-10819 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 29459-29492 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 79278-79311 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 54169-54202 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 29459-29492 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 61147-61180 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 99797-99830 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 88012-88045 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP050724 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence 41949-41982 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 53619-53652 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_019106 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence 32551-32584 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP010127 Escherichia coli strain C8 plasmid B, complete genome 33248-33281 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 85971-86004 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP022072 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence 18650-18683 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 20398-20431 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 147056-147089 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP045998 Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence 35339-35372 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP032394 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence 32800-32833 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 2112-2145 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 16816-16849 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 68260-68293 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MH229869 Escherichia coli plasmid pKANJ7, complete sequence 90-123 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP050713 Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence 33434-33467 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 96892-96925 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 63333-63366 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 238663-238696 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 37880-37913 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MK731977 Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence 22155-22188 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MK673546 Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence 28203-28236 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 18380-18413 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 118004-118037 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 151970-152003 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 243053-243086 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 241163-241196 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP025558 Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence 11939-11972 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 90443-90476 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 43726-43759 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 48918-48951 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MG197491 Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence 33352-33385 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 58347-58380 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 61256-61289 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 61256-61289 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 27964-27997 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 61256-61289 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 43736-43769 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 80789-80822 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MT219822 Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence 38970-39003 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 73817-73850 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 18865-18898 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 14942-14975 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP016575 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence 296-329 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 30572-30605 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP032994 Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence 10049-10082 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MN783746 Escherichia coli plasmid pIncX1_p1, complete sequence 5290-5323 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 40397-40430 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_KU254580 Escherichia coli strain YD786 plasmid pYD786-3, complete sequence 25507-25540 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 38916-38949 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP032392 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence 67739-67772 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 35028-35061 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 69102-69135 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP037995 Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281 7255-7288 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP053740 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence 9971-10004 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP016580 Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence 23703-23736 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 49989-50022 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 56470-56503 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP029182 Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence 2302-2335 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MN086778 Escherichia coli plasmid p16EC-IncN, complete sequence 90173-90206 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP053047 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence 9874-9907 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP014974 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence 295-328 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 220331-220364 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP035774 Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence 12757-12790 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP044182 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence 25543-25576 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP042608 Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence 7171-7204 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 45261-45294 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_019046 Escherichia coli plasmid pNMEC31_31, complete sequence 31361-31394 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 89191-89224 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 30748-30781 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP035315 Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence 28493-28526 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP050748 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence 5878-5911 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_024961 Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence 905-938 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_021842 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence 4017-4050 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_LT985261 Escherichia coli strain 657 plasmid RCS50_p, complete sequence 42585-42618 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_AP019678 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence 49115-49148 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP009074 Escherichia coli ATCC 25922 plasmid unnamed, complete sequence 21137-21170 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP010168 Escherichia coli strain H3 plasmid A, complete genome 25682-25715 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_010378 Escherichia coli plasmid pOLA52, complete sequence 34562-34595 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 CP016512 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence 23704-23737 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP016529 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence 23704-23737 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP016518 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence 23705-23738 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 50710-50743 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 23885-23918 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP012922 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence 23704-23737 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP033093 Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence 19532-19565 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP012926 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence 37369-37402 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP023360 Escherichia coli strain 1943 plasmid p54, complete sequence 52726-52759 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 37807-37840 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP039600 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence 32872-32905 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 49947-49980 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 70648-70681 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_017624 Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence 23689-23722 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP050710 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence 15569-15602 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP024290 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence 33653-33686 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 1446-1479 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP041631 Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence 4799-4832 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP050773 Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence 30707-30740 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 38005-38038 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP019180 Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence 24566-24599 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP050765 Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence 6593-6626 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_010422 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence 59434-59467 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP050759 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence 5734-5767 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_AP022652 Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence 295-328 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP024136 Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence 79478-79511 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_LT985315 Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence 47119-47152 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MN436006 Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence 27492-27525 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MN436007 Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence 27131-27164 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 44664-44697 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 48284-48317 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 12454-12487 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 43402-43435 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MT197111 Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence 12897-12930 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 59284-59317 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 118931-118964 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 MT219821 Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence 3734-3767 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 29004-29037 0 1.0
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP030195 Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence 159-192 1 0.971
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP033353 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence 78450-78483 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP050780 Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence 203947-203980 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP022061 Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence 1711-1744 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 CP048927 Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence 45611-45644 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP029841 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence 98434-98467 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP028313 Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence 41569-41602 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP018662 Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence 41992-42025 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 CP049987 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence 41386-41419 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 CP049982 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence 42740-42773 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NC_010421 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence 27662-27695 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_MK625201 Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence 41824-41857 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP023476 Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence 33473-33506 2 0.941
NZ_CP020060_1 1.1|30572|34|NZ_CP020060|CRISPRCasFinder 30572-30605 34 NZ_CP044292 Escherichia coli strain P43A plasmid pP43A-1, complete sequence 44259-44292 4 0.882

1. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

2. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

3. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

4. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

5. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP010164 (Escherichia coli strain H2 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

6. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

7. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP022964 (Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

8. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP024467 (Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

9. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

10. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

11. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

12. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP047093 (Salmonella sp. S13 plasmid pS13-4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

13. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

14. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

15. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

16. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

17. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

18. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP032386 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

19. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP032389 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

20. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_LT904873 (Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

21. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_KT754163 (Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

22. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

23. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP020836 (Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

24. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

25. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP043216 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

26. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

27. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP031361 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

28. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

29. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

30. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP033386 (Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

31. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

32. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

33. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

34. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP047339 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

35. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_010860 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

36. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP022453 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

37. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

38. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP030208 (Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

39. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP005994 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

40. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

41. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP010155 (Escherichia coli strain D9 plasmid C, complete genome) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

42. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

43. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP029061 (Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

44. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

45. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

46. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

47. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

48. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

49. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

50. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

51. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

52. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

53. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_019106 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

54. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP010127 (Escherichia coli strain C8 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

55. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

56. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP022072 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

57. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

58. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

59. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

60. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP032394 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

61. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

62. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

63. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

64. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MH229869 (Escherichia coli plasmid pKANJ7, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

65. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

66. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

67. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

68. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

69. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

70. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MK731977 (Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

71. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

72. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP032447 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

73. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

74. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

75. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

76. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

77. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP025558 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

78. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

79. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

80. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

81. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

82. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

83. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

84. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

85. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

86. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

87. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

88. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

89. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MT219822 (Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

90. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

91. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

92. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

93. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP016575 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

94. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

95. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP032994 (Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

96. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MN783746 (Escherichia coli plasmid pIncX1_p1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

97. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

98. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_KU254580 (Escherichia coli strain YD786 plasmid pYD786-3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

99. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

100. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP032392 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

101. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

102. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

103. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP037995 (Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

104. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP053740 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

105. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP016580 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

106. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

107. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

108. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP029182 (Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

109. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

110. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP053047 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

111. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP014974 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

112. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

113. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP035774 (Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

114. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP044182 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

115. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP042608 (Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

116. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

117. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_019046 (Escherichia coli plasmid pNMEC31_31, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

118. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

119. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

120. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP035315 (Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

121. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP050748 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

122. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_024961 (Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

123. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_021842 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

124. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_LT985261 (Escherichia coli strain 657 plasmid RCS50_p, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

125. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_AP019678 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

126. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP009074 (Escherichia coli ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

127. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP010168 (Escherichia coli strain H3 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

128. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_010378 (Escherichia coli plasmid pOLA52, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

129. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to CP016512 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

130. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP016529 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

131. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP016518 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

132. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

133. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

134. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP012922 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

135. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP033093 (Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

136. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP012926 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

137. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP023360 (Escherichia coli strain 1943 plasmid p54, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

138. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

139. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP039600 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

140. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

141. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_011204 (Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

142. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_017624 (Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

143. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

144. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP024290 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

145. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

146. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP041631 (Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

147. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP050773 (Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

148. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

149. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP019180 (Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

150. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP050765 (Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

151. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_010422 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

152. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP050759 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

153. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_AP022652 (Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

154. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP024136 (Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

155. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_LT985315 (Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

156. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MN436006 (Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

157. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MN436007 (Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

158. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

159. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

160. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP032381 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

161. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

162. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MT197111 (Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

163. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

164. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

165. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to MT219821 (Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

166. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

167. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP030195 (Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence) position: , mismatch: 1, identity: 0.971 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaatcacag	Protospacer
*****************************.****

168. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP033353 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gcccgcagccatccacctttcatgaaaattacag	Protospacer
*. *******************************

169. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP050780 (Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gcccgcagccatccacctttcatgaaaattacag	Protospacer
*. *******************************

170. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP022061 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

171. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to CP048927 (Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

172. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

173. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP028313 (Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

174. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP018662 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

175. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to CP049987 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

176. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to CP049982 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

177. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NC_010421 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

178. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_MK625201 (Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

179. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP023476 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence) position: , mismatch: 2, identity: 0.941 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

180. spacer 1.1|30572|34|NZ_CP020060|CRISPRCasFinder matches to NZ_CP044292 (Escherichia coli strain P43A plasmid pP43A-1, complete sequence) position: , mismatch: 4, identity: 0.882 

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
tcgaacagccatccacctttcatgaaaattacag	Protospacer
 .* .*****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 820 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_2 9503 : 10472 1 Salmonella_phage(100.0%) transposase NA
DBSCAN-SWA_3 14447 : 15152 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_4 19336 : 20041 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_5 25395 : 27083 2 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_6 31750 : 43537 15 Enterobacteria_phage(30.0%) integrase,transposase NA
DBSCAN-SWA_7 46856 : 49897 5 Pandoravirus(50.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage