Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020105 Spirosoma rigui strain KCTC 12531 chromosome, complete genome 3 crisprs cas3,csa3,Cas9_archaeal,DEDDh,WYL 0 2 1 0

Results visualization

1. NZ_CP020105
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020105_1 1915453-1915591 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020105_2 2356967-2357181 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020105_3 2433125-2433205 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020105_1 1.1|1915495|22|NZ_CP020105|PILER-CR 1915495-1915516 22 NZ_CP015231 Epibacterium mobile F1926 plasmid unnamed1, complete sequence 1122345-1122366 2 0.909
NZ_CP020105_1 1.2|1915559|28|NZ_CP020105|PILER-CR 1915559-1915586 28 MN062704 Gordonia phage JuJu, complete genome 48536-48563 6 0.786

1. spacer 1.1|1915495|22|NZ_CP020105|PILER-CR matches to NZ_CP015231 (Epibacterium mobile F1926 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

accggtgcacgaccaaagacca	CRISPR spacer
gccgatgcacgaccaaagacca	Protospacer
.***.*****************

2. spacer 1.2|1915559|28|NZ_CP020105|PILER-CR matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 6, identity: 0.786

aagcgaagtcttcgtcgggcaacatgcg	CRISPR spacer
gggcgaagtcttcgtcggtgaacatggc	Protospacer
..****************  ******  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1448378 : 1456185 9 Mycobacterium_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage