Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013922 Staphylococcus xylosus strain S170, complete genome 3 crisprs cas3,csa3,DEDDh,DinG,WYL 1 0 8 0

Results visualization

1. NZ_CP013922
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013922_1 539174-539262 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013922_2 1387197-1387283 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013922_3 2380748-2380848 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP013922_1 1.1|539203|31|NZ_CP013922|CRISPRCasFinder 539203-539233 31 NZ_CP013922.1 539926-539956 2 0.935

1. spacer 1.1|539203|31|NZ_CP013922|CRISPRCasFinder matches to position: 539926-539956, mismatch: 2, identity: 0.935

tatcagaattgtctgtgctatcctcttgaac	CRISPR spacer
tatcagaagtgtctgtgttatcctcttgaac	Protospacer
******** ********.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 269539 : 276930 9 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_2 290197 : 305970 13 uncultured_Caudovirales_phage(41.67%) NA NA
DBSCAN-SWA_3 555018 : 563494 9 Tetraselmis_virus(16.67%) NA NA
DBSCAN-SWA_4 623210 : 712410 98 Staphylococcus_phage(54.55%) tail,integrase,tRNA,terminase,holin,plate,head,portal attL 631746:631761|attR 658761:658776
DBSCAN-SWA_5 885362 : 921740 54 uncultured_Caudovirales_phage(47.83%) terminase,integrase,tail,capsid attL 885341:885358|attR 933479:933496
DBSCAN-SWA_6 1247188 : 1256387 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_7 1377889 : 1411995 35 Staphylococcus_phage(96.15%) tRNA NA
DBSCAN-SWA_8 2140176 : 2174004 41 Staphylococcus_phage(59.38%) tail,capsid,terminase,head,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage