Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020830 Listeria monocytogenes strain MOD1_LS152 chromosome, complete genome 2 crisprs DinG,cas3,WYL,casR,DEDDh,csa3 0 1 5 0

Results visualization

1. NZ_CP020830
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020830_1 491524-492108 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020830_2 530695-530983 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020830_2 2.3|530854|35|NZ_CP020830|PILER-CR,CRISPRCasFinder,CRT 530854-530888 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_CP020830_2 2.3|530854|35|NZ_CP020830|PILER-CR,CRISPRCasFinder,CRT 530854-530888 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943

1. spacer 2.3|530854|35|NZ_CP020830|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

2. spacer 2.3|530854|35|NZ_CP020830|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 119370 : 125895 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_2 1107571 : 1114994 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_3 1799227 : 1807513 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 2322587 : 2363497 63 Listeria_phage(96.77%) plate,capsid,portal,holin,terminase,tail NA
DBSCAN-SWA_5 2506791 : 2514636 6 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage