Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018390 Burkholderia pseudomallei strain 2011756189 chromosome 2, complete sequence 2 crisprs cas3,DinG,csa3,PD-DExK 0 0 4 0
NZ_CP018389 Burkholderia pseudomallei strain 2011756189 chromosome 1, complete sequence 1 crisprs PD-DExK,csa3,DEDDh,cas3,WYL 0 2 8 0

Results visualization

1. NZ_CP018390
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018390_1 2741737-2741829 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018390_2 3182521-3182606 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 128636 : 195428 51 Ralstonia_phage(25.0%) holin,transposase,plate NA
DBSCAN-SWA_2 726383 : 798045 57 Vibrio_phage(25.0%) holin,plate NA
DBSCAN-SWA_3 1481079 : 1523161 54 Burkholderia_phage(93.33%) tail,transposase,protease,terminase,plate,integrase attL 1476066:1476085|attR 1523953:1523972
DBSCAN-SWA_4 2875160 : 2960817 55 Stx2-converting_phage(20.0%) transposase,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP018389
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018389_1 3431657-3431850 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018389_1 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder 3431743-3431764 22 MF140416 Mycobacterium phage LastHope, complete genome 6359-6380 1 0.955
NZ_CP018389_1 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder 3431743-3431764 22 MT114163 Mycobacterium phage Settecandela, complete genome 64638-64659 1 0.955
NZ_CP018389_1 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder 3431743-3431764 22 MK937592 Mycobacterium phage Phrappuccino, complete genome 64638-64659 1 0.955
NZ_CP018389_1 1.1|3431689|22|NZ_CP018389|CRISPRCasFinder 3431689-3431710 22 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 379897-379918 2 0.909
NZ_CP018389_1 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder 3431743-3431764 22 NC_042031 Mycobacterium phage Anaya, complete sequence 7332-7353 2 0.909
NZ_CP018389_1 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder 3431743-3431764 22 NC_042031 Mycobacterium phage Anaya, complete sequence 7341-7362 2 0.909
NZ_CP018389_1 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder 3431743-3431764 22 MF347636 Streptomyces phage NootNoot, complete genome 102732-102753 3 0.864

1. spacer 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder matches to MF140416 (Mycobacterium phage LastHope, complete genome) position: , mismatch: 1, identity: 0.955

gtgccttcggtgccttcggtgc	CRISPR spacer
gtgccttcggtgccgtcggtgc	Protospacer
************** *******

2. spacer 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder matches to MT114163 (Mycobacterium phage Settecandela, complete genome) position: , mismatch: 1, identity: 0.955

gtgccttcggtgccttcggtgc	CRISPR spacer
gtgccttcggtgacttcggtgc	Protospacer
************ *********

3. spacer 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder matches to MK937592 (Mycobacterium phage Phrappuccino, complete genome) position: , mismatch: 1, identity: 0.955

gtgccttcggtgccttcggtgc	CRISPR spacer
gtgccttcggtgacttcggtgc	Protospacer
************ *********

4. spacer 1.1|3431689|22|NZ_CP018389|CRISPRCasFinder matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 2, identity: 0.909

atgccttcggcggcttcgatgc	CRISPR spacer
ttgcctccggcggcttcgatgc	Protospacer
 *****.***************

5. spacer 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder matches to NC_042031 (Mycobacterium phage Anaya, complete sequence) position: , mismatch: 2, identity: 0.909

gtgccttcggtgccttcggtgc	CRISPR spacer
gtgccttcggtgccttcggtcg	Protospacer
********************  

6. spacer 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder matches to NC_042031 (Mycobacterium phage Anaya, complete sequence) position: , mismatch: 2, identity: 0.909

gtgccttcggtgccttcggtgc	CRISPR spacer
ccgccttcggtgccttcggtgc	Protospacer
 .********************

7. spacer 1.2|3431743|22|NZ_CP018389|CRISPRCasFinder matches to MF347636 (Streptomyces phage NootNoot, complete genome) position: , mismatch: 3, identity: 0.864

gtgccttcggtgccttcggtgc	CRISPR spacer
cgaccttcggtgccttcggtgc	Protospacer
  .*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 705164 : 714602 14 Burkholderia_virus(44.44%) transposase NA
DBSCAN-SWA_2 1239764 : 1248611 8 Tanapox_virus(16.67%) NA NA
DBSCAN-SWA_3 1603741 : 1612990 7 unidentified_phage(16.67%) NA NA
DBSCAN-SWA_4 1896803 : 1950922 48 Pseudomonas_phage(14.29%) transposase,integrase,tRNA,plate attL 1938128:1938147|attR 1958291:1958310
DBSCAN-SWA_5 2213477 : 2224705 10 Burkholderia_phage(22.22%) integrase attL 2210682:2210699|attR 2227276:2227293
DBSCAN-SWA_6 3286932 : 3297882 10 Streptococcus_phage(16.67%) protease NA
DBSCAN-SWA_7 3460871 : 3542040 91 uncultured_Caudovirales_phage(26.83%) protease,integrase,portal,capsid,transposase,plate,tail,head,terminase attL 3503247:3503262|attR 3542578:3542593
DBSCAN-SWA_8 3958250 : 3966456 9 Burkholderia_virus(28.57%) integrase attL 3938680:3938700|attR 3983212:3983232
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage