Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021169 Bacillus subtilis strain TLO3 chromosome, complete genome 3 crisprs csa3,DEDDh,WYL,DinG,cas3 0 1 10 0

Results visualization

1. NZ_CP021169
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021169_1 767636-767738 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021169_2 873140-873245 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021169_3 2938853-2938960 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021169_3 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder 2938877-2938936 60 NZ_CP024037 Bacillus aryabhattai strain K13 plasmid unnamed2 10417-10476 7 0.883
NZ_CP021169_3 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder 2938877-2938936 60 NZ_CP026740 Bacillus megaterium strain YC4-R4 plasmid unnamed4 70764-70823 7 0.883
NZ_CP021169_3 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder 2938877-2938936 60 NC_017139 Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence 1318-1377 7 0.883
NZ_CP021169_3 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder 2938877-2938936 60 NZ_CP010587 Bacillus megaterium Q3 plasmid p1, complete sequence 838-897 7 0.883
NZ_CP021169_3 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder 2938877-2938936 60 NZ_CP023319 Bacillus megaterium strain A plasmid p2, complete sequence 75825-75884 7 0.883
NZ_CP021169_3 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder 2938877-2938936 60 NC_020451 Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence 1960-2019 9 0.85
NZ_CP021169_3 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder 2938877-2938936 60 NZ_CP015440 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence 64773-64832 12 0.8
NZ_CP021169_3 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder 2938877-2938936 60 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 483791-483850 13 0.783
NZ_CP021169_3 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder 2938877-2938936 60 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 57361-57420 14 0.767

1. spacer 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder matches to NZ_CP024037 (Bacillus aryabhattai strain K13 plasmid unnamed2) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

2. spacer 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder matches to NZ_CP026740 (Bacillus megaterium strain YC4-R4 plasmid unnamed4) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

3. spacer 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder matches to NC_017139 (Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

4. spacer 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder matches to NZ_CP010587 (Bacillus megaterium Q3 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

5. spacer 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder matches to NZ_CP023319 (Bacillus megaterium strain A plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

6. spacer 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder matches to NC_020451 (Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence) position: , mismatch: 9, identity: 0.85

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcattttagttatggcccggg	Protospacer
****************************************** ***   * ***  **. 

7. spacer 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder matches to NZ_CP015440 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence) position: , mismatch: 12, identity: 0.8

cagcttggaaggctgaggttttaccactaaactacacccgca-------atttttatttg	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcataataatatataccattg	Protospacer
******************************************       ** * .  ***

8. spacer 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.783

cagcttggaaggctgaggttttaccactaaactacacccgc--------aatttttattt	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatggttaaaagttttgcca	Protospacer
*****************************************        ** ****... 

9. spacer 3.1|2938877|60|NZ_CP021169|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 14, identity: 0.767

cagcttggaaggctgaggttttaccactaaactacacccgc---------aatttttatt	CRISPR spacer
cagcttggaaggctgtagttttaccactaaactacacccgcatagtaagtagttcttagt	Protospacer
*************** .************************         *.**.*** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 660873 : 669239 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1141617 : 1185388 49 Planktothrix_phage(25.0%) tRNA,coat NA
DBSCAN-SWA_3 1206370 : 1270521 76 Bacillus_phage(30.3%) coat,tRNA,holin,portal,terminase,plate,capsid,tail NA
DBSCAN-SWA_4 1787007 : 1793560 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_5 2052302 : 2096278 61 Bacillus_phage(100.0%) integrase attL 2083460:2083475|attR 2093990:2094005
DBSCAN-SWA_6 2103822 : 2113889 12 Bacillus_phage(90.0%) NA NA
DBSCAN-SWA_7 2251555 : 2257651 8 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_8 2599729 : 2653045 56 uncultured_Mediterranean_phage(12.5%) tRNA,protease,coat NA
DBSCAN-SWA_9 3223660 : 3231373 9 Organic_Lake_phycodnavirus(50.0%) holin NA
DBSCAN-SWA_10 3563738 : 3638787 74 Bacillus_phage(26.67%) protease,tRNA,bacteriocin,coat NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage