Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021203 Escherichia coli strain Z1002 plasmid p1002-1, complete sequence 0 crisprs cas14j 0 0 1 0
NZ_CP021206 Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP021202 Escherichia coli strain Z1002 chromosome, complete genome 3 crisprs csa3,cas3,WYL,DEDDh,c2c9_V-U4,DinG,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 12 10 0
NZ_CP021205 Escherichia coli strain Z1002 plasmid p1002-MCR1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP021204 Escherichia coli strain Z1002 plasmid p1002-4, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP021203
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3442 : 110390 109 Escherichia_phage(63.0%) holin,integrase,tail,transposase,head attL 12585:12644|attR 113054:113874

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021206
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20009 : 38587 15 Escherichia_phage(44.44%) transposase,integrase attL 13814:13873|attR 37282:37505

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP021202
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021202_1 1232156-1232305 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021202_2 4572216-4572793 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021202_3 4599931-4600569 Orphan I-E
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021202_2 2.6|4572550|32|NZ_CP021202|PILER-CR 4572550-4572581 32 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42679-42710 1 0.969
NZ_CP021202_2 2.15|4572550|35|NZ_CP021202|CRISPRCasFinder,CRT 4572550-4572584 35 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42676-42710 2 0.943
NZ_CP021202_3 3.2|4600021|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR 4600021-4600052 32 KT898133 Aeromonas phage phiARM81ld, complete genome 45655-45686 2 0.938
NZ_CP021202_3 3.8|4600387|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR 4600387-4600418 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
NZ_CP021202_2 2.3|4572367|32|NZ_CP021202|PILER-CR 4572367-4572398 32 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 39410-39441 7 0.781
NZ_CP021202_3 3.6|4600265|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR 4600265-4600296 32 KC821619 Cellulophaga phage phi18:1, complete genome 6924-6955 7 0.781
NZ_CP021202_3 3.6|4600265|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR 4600265-4600296 32 KC821627 Cellulophaga phage phi18:2, complete genome 6924-6955 7 0.781
NZ_CP021202_2 2.2|4572306|32|NZ_CP021202|PILER-CR 4572306-4572337 32 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 347859-347890 8 0.75
NZ_CP021202_2 2.5|4572489|32|NZ_CP021202|PILER-CR 4572489-4572520 32 KC847113 Bacillus phage PBP180, complete sequence 100-131 8 0.75
NZ_CP021202_3 3.2|4600021|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR 4600021-4600052 32 MN901520 Halorubrum coriense virus Hardycor2, complete genome 16524-16555 8 0.75
NZ_CP021202_3 3.7|4600326|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR 4600326-4600357 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
NZ_CP021202_3 3.10|4600509|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR 4600509-4600540 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
NZ_CP021202_3 3.10|4600509|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR 4600509-4600540 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
NZ_CP021202_2 2.1|4572245|32|NZ_CP021202|PILER-CR 4572245-4572276 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 11267-11298 9 0.719
NZ_CP021202_2 2.5|4572489|32|NZ_CP021202|PILER-CR 4572489-4572520 32 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20183 9 0.719
NZ_CP021202_2 2.5|4572489|32|NZ_CP021202|PILER-CR 4572489-4572520 32 NC_049837 Klebsiella phage vB_KpnS_Alina, complete genome 13583-13614 9 0.719
NZ_CP021202_2 2.6|4572550|32|NZ_CP021202|PILER-CR 4572550-4572581 32 NZ_CP019063 Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence 287201-287232 9 0.719
NZ_CP021202_3 3.6|4600265|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR 4600265-4600296 32 NZ_CP020483 Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence 383-414 9 0.719
NZ_CP021202_2 2.5|4572489|32|NZ_CP021202|PILER-CR 4572489-4572520 32 MN480762 Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence 179050-179081 10 0.688
NZ_CP021202_2 2.14|4572489|35|NZ_CP021202|CRISPRCasFinder,CRT 4572489-4572523 35 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20186 12 0.657

1. spacer 2.6|4572550|32|NZ_CP021202|PILER-CR matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.969 

atgagattaaaatactcagtactcttactcgc	CRISPR spacer
atgagattaaaatactcagcactcttactcgc	Protospacer
*******************.************

2. spacer 2.15|4572550|35|NZ_CP021202|CRISPRCasFinder,CRT matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.943 

atgagattaaaatactcagtactcttactcgccga	CRISPR spacer
atgagattaaaatactcagcactcttactcgccgt	Protospacer
*******************.**************

3. spacer 3.2|4600021|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR matches to KT898133 (Aeromonas phage phiARM81ld, complete genome) position: , mismatch: 2, identity: 0.938 

acgaacgcggcacaccagggcgtctcatcgtc	CRISPR spacer
acgaacgcggcgcaccagggcgtctcgtcgtc	Protospacer
***********.**************.*****

4. spacer 3.8|4600387|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812 

gagagcgaggggagattccggcagggcgtgca	CRISPR spacer
aatcgtgaggggatcttccggcagggcgtgca	Protospacer
.*  *.*******  *****************

5. spacer 2.3|4572367|32|NZ_CP021202|PILER-CR matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 7, identity: 0.781 

gatcgcctgctccagcgtcactccctgcccct	CRISPR spacer
gttcgcctgctccagcgtcaatgccccctccc	Protospacer
* ****************** * **. *.**.

6. spacer 3.6|4600265|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR matches to KC821619 (Cellulophaga phage phi18:1, complete genome) position: , mismatch: 7, identity: 0.781 

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
gcggttttattttccctgaaaagaaaaaagag	Protospacer
** *. **************** ** ****

7. spacer 3.6|4600265|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR matches to KC821627 (Cellulophaga phage phi18:2, complete genome) position: , mismatch: 7, identity: 0.781 

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
gcggttttattttccctgaaaagaaaaaagag	Protospacer
** *. **************** ** ****

8. spacer 2.2|4572306|32|NZ_CP021202|PILER-CR matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gttgaggtcgataagtacgaacggtttccctg	CRISPR spacer
gaagaggtcgatgagtacgaatggttacagcg	Protospacer
*  *********.********.**** *  .*

9. spacer 2.5|4572489|32|NZ_CP021202|PILER-CR matches to KC847113 (Bacillus phage PBP180, complete sequence) position: , mismatch: 8, identity: 0.75 

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
ttctctctaatgtagttaataaagtcgatggt	Protospacer
*  .*.*.**** ************* ****.

10. spacer 3.2|4600021|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR matches to MN901520 (Halorubrum coriense virus Hardycor2, complete genome) position: , mismatch: 8, identity: 0.75 

acgaacgcggcacaccagggcgtctcatcgtc--	CRISPR spacer
ccgaacgcggcacacccgagcg--tcggcggcgg	Protospacer
 *************** *.***  **. ** *

11. spacer 3.7|4600326|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75 

taatatccc----tggcgataatcaaccggcttact	CRISPR spacer
----acgccatggtggcgataatcatcctgcttact	Protospacer
    *. **    ************ ** *******

12. spacer 3.10|4600509|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75 

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.*

13. spacer 3.10|4600509|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.*

14. spacer 2.1|4572245|32|NZ_CP021202|PILER-CR matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

gtcaataggcggcgtcccgtagccgtcccctt	CRISPR spacer
gtgctctggcggcgtgccgtagccatccccga	Protospacer
**   . ******** ********.*****

15. spacer 2.5|4572489|32|NZ_CP021202|PILER-CR matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
ctttaggcaatgaagttaaaaaattctatggc	Protospacer
.  .   ************ *** ********

16. spacer 2.5|4572489|32|NZ_CP021202|PILER-CR matches to NC_049837 (Klebsiella phage vB_KpnS_Alina, complete genome) position: , mismatch: 9, identity: 0.719 

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
acattggcgatgaagttaataacgtgtatggc	Protospacer
  *..  *.************* ** ******

17. spacer 2.6|4572550|32|NZ_CP021202|PILER-CR matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

atgagattaaaatactcagtactcttactcgc	CRISPR spacer
cgggaattaacatactcggtactcttaccgtc	Protospacer
  *..***** ******.**********.  *

18. spacer 3.6|4600265|32|NZ_CP021202|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020483 (Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence) position: , mismatch: 9, identity: 0.719 

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
tagcctttattttcactcaaaacaataaaagt	Protospacer
    * ******** ** ***********. *

19. spacer 2.5|4572489|32|NZ_CP021202|PILER-CR matches to MN480762 (Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence) position: , mismatch: 10, identity: 0.688 

taacccccaatgaagttaataaagtctatggc	CRISPR spacer
gtagattcaatgaagttaataaaaactatgat	Protospacer
  *  ..****************. *****..

20. spacer 2.14|4572489|35|NZ_CP021202|CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.657 

taacccccaatgaagttaataaagtctatggccga	CRISPR spacer
ctttaggcaatgaagttaaaaaattctatggcgat	Protospacer
.  .   ************ *** ******** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1205261 : 1273681 55 uncultured_Caudovirales_phage(17.65%) tRNA,protease,holin,transposase NA
DBSCAN-SWA_2 2634719 : 2712035 91 Escherichia_phage(33.9%) tRNA,terminase,lysis,holin,tail,transposase,portal,head,integrase,capsid attL 2631896:2631910|attR 2651133:2651147
DBSCAN-SWA_3 2928994 : 3037755 107 Escherichia_phage(48.28%) tRNA,terminase,lysis,holin,tail,transposase NA
DBSCAN-SWA_4 3186356 : 3246215 77 Enterobacteria_phage(45.1%) terminase,lysis,tail,head,portal,transposase,capsid NA
DBSCAN-SWA_5 3732751 : 3740269 7 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_6 3787674 : 3839662 63 Escherichia_phage(33.33%) tRNA,terminase,holin,lysis,integrase,tail,head,portal,transposase,plate,capsid attL 3791963:3791989|attR 3824861:3824887
DBSCAN-SWA_7 3875204 : 3884647 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_8 4286552 : 4331771 56 Escherichia_phage(56.86%) integrase,terminase,holin attL 4288391:4288407|attR 4328657:4328673
DBSCAN-SWA_9 4548720 : 4555860 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_10 4803759 : 4847257 44 Staphylococcus_phage(25.0%) tRNA,protease,integrase,transposase attL 4819633:4819647|attR 4835262:4835276

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage