Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015964 Mycobacterium yongonense strain Asan 36912, complete genome 2 crisprs DEDDh,cas3,csa3,DinG,cas4,WYL,c2c9_V-U4,PrimPol 1 1 3 0

Results visualization

1. NZ_CP015964
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015964_1 2138941-2139006 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015964_2 5275506-5275592 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP015964_1 1.1|2138964|20|NZ_CP015964|CRISPRCasFinder 2138964-2138983 20 NZ_CP015964.1 2138997-2139016 0 1.0

1. spacer 1.1|2138964|20|NZ_CP015964|CRISPRCasFinder matches to position: 2138997-2139016, mismatch: 0, identity: 1.0

gcgggtcgccactaaaggat	CRISPR spacer
gcgggtcgccactaaaggat	Protospacer
********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 NC_011961 Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence 77886-77912 4 0.852
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 274827-274853 5 0.815
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 29825-29851 5 0.815
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 NZ_CP033227 Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence 469539-469565 5 0.815
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 NZ_CP024309 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence 198167-198193 6 0.778
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 50057-50083 6 0.778
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 9821-9847 6 0.778
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MK977708 Mycobacterium phage Fulbright, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MG099948 Mycobacterium phage Philonius, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MH926055 Mycobacterium phage Chewbacca, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 KF986246 Mycobacterium phage MichelleMyBell, complete genome 10591-10617 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MT723932 Mycobacterium phage Schnauzer, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 KU935726 Mycobacterium phage Xerxes, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MT498042 Mycobacterium phage Rebel, complete genome 10597-10623 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MH316570 Mycobacterium phage Silvafighter, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MK524518 Mycobacterium phage Smurph, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MH697585 Mycobacterium phage Gex, complete genome 10550-10576 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MH399787 Mycobacterium phage Rubeelu, complete genome 10572-10598 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 KM588359 Mycobacterium phage Carcharodon, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MH697576 Mycobacterium phage Aggie, complete genome 10552-10578 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 NC_021061 Mycobacterium phage Butters, complete genome 10572-10598 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MH697593 Mycobacterium phage Tapioca, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MK524500 Mycobacterium phage Kevin1, complete genome 10573-10599 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 KU935727 Mycobacterium phage Panchino, complete genome 10573-10599 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 KU935729 Mycobacterium phage SkinnyPete, complete genome 10597-10623 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 MG099936 Mycobacterium phage Andies, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 NC_031243 Mycobacterium phage Xeno, complete genome 10551-10577 7 0.741
NZ_CP015964_2 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder 5275536-5275562 27 JN256079 Mycobacterium phage Charlie, complete genome 10551-10577 7 0.741

1. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to NC_011961 (Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

agtccggcgacggcgagcgccgagtag	CRISPR spacer
agtccgacgacggcgagcgcccagtcc	Protospacer
******.************** ***  

2. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

agtccggcgacggcgagcgccgagtag	CRISPR spacer
cgtccggcgacggcgagggccgactcc	Protospacer
 **************** ***** *  

3. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 5, identity: 0.815

agtccggcgacggcgagcgccgagtag	CRISPR spacer
agtccggcggcggcgagcgcctggccg	Protospacer
*********.*********** .*. *

4. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 5, identity: 0.815

agtccggcgacggcgagcgccgagtag	CRISPR spacer
tttccggcgaccgcgagcgccgtgtcg	Protospacer
  ********* ********** ** *

5. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to NZ_CP024309 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence) position: , mismatch: 6, identity: 0.778

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gacacggcgacggcgagcgccgagccg	Protospacer
... ********************. *

6. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 6, identity: 0.778

agtccggcgacggcgagcgccgagtag	CRISPR spacer
ccgccggcgacggcgagcgccgcgccg	Protospacer
   ******************* *. *

7. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 6, identity: 0.778

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gatccggcgacggtgaccgccgagtct	Protospacer
..***********.** ********  

8. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

9. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

10. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

11. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

12. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

13. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

14. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MT498042 (Mycobacterium phage Rebel, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtaccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

15. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

16. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

17. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

18. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

19. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

20. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MH399787 (Mycobacterium phage Rubeelu, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

21. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

22. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

23. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to NC_021061 (Mycobacterium phage Butters, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

24. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

25. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MK524500 (Mycobacterium phage Kevin1, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

26. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to KU935727 (Mycobacterium phage Panchino, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtaccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

27. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to KU935729 (Mycobacterium phage SkinnyPete, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtaccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

28. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

29. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

30. spacer 2.1|5275536|27|NZ_CP015964|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.741

agtccggcgacggcgagcgccgagtag	CRISPR spacer
gtgccggcggcggcgagcgccgagggc	Protospacer
.  ******.************** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3266030 : 3275120 8 Shahe_endorna-like_virus(50.0%) NA NA
DBSCAN-SWA_2 3978079 : 3984655 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 4490015 : 4500054 9 Burkholderia_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage