Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021252 Corynebacterium striatum strain KC-Na-01 chromosome, complete genome 2 crisprs WYL,csa3,cas2,cas1,cas3,cas6e,cas5,cas7,cse2gr11,cas8e,DinG,DEDDh 0 27 204 0
NZ_CP021253 Corynebacterium striatum strain KC-Na-01 plasmid pCs-Na-1, complete sequence 0 crisprs DEDDh 0 0 2 0
NZ_CP021254 Corynebacterium striatum strain KC-Na-01 plasmid pCs-Na-2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP021252
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021252_1 267839-268783 TypeI-E I-C,I-E,II-B
15 spacers
cas2,cas1,cas3,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021252_2 270124-272775 TypeI-E I-C,I-E,II-B
43 spacers
cas2,cas1,cas3,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021252_2 2.30|271923|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271923-271954 32 KY653127 Corynebacterium phage IME1320_01, complete genome 6896-6927 1 0.969
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 KX160204 Lactococcus phage 38502, complete genome 903-934 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 KX160215 Lactococcus phage 98104, complete genome 2638-2669 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 AY766464 Lactococcus phage TP712, complete sequence 5131-5162 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 KX160205 Lactococcus phage 49801, complete genome 3571-3602 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 KX160209 Lactococcus phage 58502, complete genome 863-894 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 KX160212 Lactococcus phage 98101, complete genome 2570-2601 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 NC_002703 Lactococcus phage Tuc2009, complete genome 3489-3520 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 AF242738 Bacteriophage phi LC3, complete genome 3682-3713 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 AF323669 Bacteriophage bIL286, complete genome 4039-4070 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 NC_031040 Lactococcus phage 50101, complete genome 3589-3620 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 NC_005822 Lactococcus phage phiLC3, complete genome 3682-3713 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 AF109874 Bacteriophage Tuc2009, complete genome 3489-3520 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 MN552144 Lactococcus phage P1045, complete genome 894-925 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 KX160211 Lactococcus phage 62503, complete genome 600-631 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 KX160210 Lactococcus phage 62502, complete genome 863-894 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 KX160214 Lactococcus phage 98103, complete genome 2647-2678 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 JX567312 Lactococcus phage BM13, complete genome 600-631 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 NC_002667 Lactococcus prophage bIL286, complete genome 4039-4070 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 KX456212 Lactococcus phage 86501, complete genome 3589-3620 4 0.875
NZ_CP021252_2 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT 271252-271283 32 KX160213 Lactococcus phage 98102, complete genome 2713-2744 4 0.875
NZ_CP021252_1 1.1|267868|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 267868-267899 32 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 111972-112003 5 0.844
NZ_CP021252_2 2.8|270581|32|NZ_CP021252|CRISPRCasFinder,CRT 270581-270612 32 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 373619-373650 6 0.812
NZ_CP021252_2 2.31|271984|31|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271984-272014 31 NZ_CP046712 Nostoc sp. ATCC 53789 plasmid pNsp_i, complete sequence 748-778 6 0.806
NZ_CP021252_1 1.5|268112|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 268112-268143 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 885173-885204 7 0.781
NZ_CP021252_1 1.12|268539|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 268539-268570 32 NZ_CP013208 Paenibacillus sp. IHB B 3084 plasmid pHD05, complete sequence 36086-36117 7 0.781
NZ_CP021252_1 1.12|268539|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 268539-268570 32 NZ_CP040831 Paenibacillus polymyxa strain ZF129 plasmid pAP2, complete sequence 37448-37479 7 0.781
NZ_CP021252_2 2.1|270153|32|NZ_CP021252|CRISPRCasFinder,CRT 270153-270184 32 NC_014304 Erwinia billingiae Eb661 plasmid pEB102, complete sequence 28582-28613 7 0.781
NZ_CP021252_2 2.4|270337|32|NZ_CP021252|CRISPRCasFinder,CRT 270337-270368 32 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 33291-33322 7 0.781
NZ_CP021252_2 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271862-271893 32 NZ_CP020041 Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence 33479-33510 7 0.781
NZ_CP021252_2 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271862-271893 32 MT639649 Microbacterium phage Burritobowl, complete genome 25703-25734 7 0.781
NZ_CP021252_2 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271862-271893 32 MT818427 Microbacterium phage AnnaLie, complete genome 26130-26161 7 0.781
NZ_CP021252_2 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271862-271893 32 MT889389 Microbacterium phage DickRichards, complete genome 26032-26063 7 0.781
NZ_CP021252_2 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272166-272197 32 NZ_CP015441 Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence 52083-52114 7 0.781
NZ_CP021252_2 2.39|272471|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272471-272502 32 MH572469 Microviridae sp. isolate SD_MF_14, complete genome 2940-2971 7 0.781
NZ_CP021252_2 2.40|272532|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272532-272563 32 NC_005073 Rhodococcus erythropolis linear plasmid pBD2, complete sequence 186649-186680 7 0.781
NZ_CP021252_1 1.5|268112|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 268112-268143 32 NC_030937 Xanthomonas phage f30-Xaj, complete genome 2975-3006 8 0.75
NZ_CP021252_1 1.5|268112|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 268112-268143 32 NC_030928 Xanthomonas phage f20-Xaj, complete genome 16886-16917 8 0.75
NZ_CP021252_2 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT 270276-270307 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 483584-483615 8 0.75
NZ_CP021252_2 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT 270276-270307 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 52492-52523 8 0.75
NZ_CP021252_2 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT 270276-270307 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 486589-486620 8 0.75
NZ_CP021252_2 2.13|270886|32|NZ_CP021252|CRISPRCasFinder,CRT 270886-270917 32 NZ_CP019938 Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence 72204-72235 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP020897 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence 94601-94632 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 336220-336251 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 123599-123630 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 129006-129037 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP013559 Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence 125787-125818 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP013576 Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence 123851-123882 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP013548 Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence 123849-123880 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP013533 Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence 123849-123880 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP013543 Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence 127260-127291 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 123599-123630 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP013570 Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence 123851-123882 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 342802-342833 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 111188-111219 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 111827-111858 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 300455-300486 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 573085-573116 8 0.75
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 92303-92334 8 0.75
NZ_CP021252_2 2.22|271435|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271435-271466 32 MN582070 Myoviridae sp. ctThM1, complete genome 35979-36010 8 0.75
NZ_CP021252_2 2.26|271679|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271679-271710 32 NC_021536 Synechococcus phage S-IOM18 genomic sequence 115895-115926 8 0.75
NZ_CP021252_2 2.28|271801|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271801-271832 32 NZ_AP018719 Sterolibacteriaceae bacterium J5B plasmid pSTJ1, complete sequence 6136-6167 8 0.75
NZ_CP021252_2 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271862-271893 32 MT889392 Microbacterium phage Lahqtemish, complete genome 25775-25806 8 0.75
NZ_CP021252_2 2.33|272105|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272105-272136 32 NZ_CP028562 Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p1_045096, complete sequence 11655-11686 8 0.75
NZ_CP021252_2 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272166-272197 32 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 261551-261582 8 0.75
NZ_CP021252_2 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272166-272197 32 NC_004444 Pseudomonas resinovorans plasmid pCAR1, complete sequence 1554-1585 8 0.75
NZ_CP021252_2 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272166-272197 32 NC_021506 Pseudomonas resinovorans NBRC 106553 plasmid pCAR1.3, complete sequence 1554-1585 8 0.75
NZ_CP021252_2 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272166-272197 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1742044-1742075 8 0.75
NZ_CP021252_2 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272166-272197 32 NC_011838 Pseudomonas putida plasmid pCAR1.2, complete sequence 1554-1585 8 0.75
NZ_CP021252_2 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272166-272197 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 390319-390350 8 0.75
NZ_CP021252_2 2.36|272288|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272288-272319 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 511750-511781 8 0.75
NZ_CP021252_2 2.36|272288|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272288-272319 32 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 1030368-1030399 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_KX426227 Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence 217673-217704 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 CP033569 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-1, complete sequence 78100-78131 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_CP033130 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA23_010062, complete sequence 186699-186730 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 CP033531 Acinetobacter pittii strain 2014S07-126 plasmid p2014S07-126-1, complete sequence 197504-197535 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_CP042557 Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence 307963-307994 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_CP010351 Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence 27453-27484 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_CP029396 Acinetobacter defluvii strain WCHA30 plasmid pOXA58_010030, complete sequence 220493-220524 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_CP048828 Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence 84555-84586 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_CP032285 Acinetobacter sp. WCHA55 plasmid pOXA58_010055, complete sequence 14399-14430 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_CP042365 Acinetobacter pittii strain C54 plasmid pC54_001, complete sequence 20924-20955 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_MK134375 Acinetobacter baumannii strain 34AB plasmid p34AB, complete sequence 170397-170428 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_CP038010 Acinetobacter haemolyticus strain TJR01 plasmid pAHTJR1, complete sequence 301738-301769 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_CP043053 Acinetobacter pittii strain AP43 plasmid pAP43-OXA58-NDM1, complete sequence 215811-215842 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_MH220285 Acinetobacter ursingii strain RIVM0002 plasmid pRIVM0002_IMP-4_171109_B03, complete sequence 254080-254111 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_MH220287 Acinetobacter ursingii strain RIVM0061 plasmid pRIVM0061_IMP-4_171109_B01, complete sequence 251583-251614 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_CP043309 Acinetobacter johnsonii strain Acsw19 plasmid pAcsw19-2, complete sequence 84316-84347 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NZ_MH220286 Acinetobacter ursingii strain RIVM0051 plasmid pRIVM0051_IMP-4, complete sequence 197682-197713 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 JF974321 Cyanophage MED4-117 genomic sequence 36116-36147 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 MT647606 Pelagibacter phage Mosig EXVC030M, partial genome 36321-36352 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 MT490303 Prochlorococcus phage P-HS2, complete genome 31975-32006 8 0.75
NZ_CP021252_2 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272654-272685 32 NC_020847 Cyanophage MED4-184 genomic sequence 31975-32006 8 0.75
NZ_CP021252_1 1.1|267868|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 267868-267899 32 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 144370-144401 9 0.719
NZ_CP021252_1 1.3|267990|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 267990-268021 32 NZ_CP043619 Rhodobacteraceae bacterium SH-1 plasmid p1, complete sequence 126681-126712 9 0.719
NZ_CP021252_1 1.4|268051|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 268051-268082 32 MK962632 Achromobacter phage vB_AxyP_19-32_Axy13, complete genome 22422-22453 9 0.719
NZ_CP021252_2 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT 270276-270307 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1692121-1692152 9 0.719
NZ_CP021252_2 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT 270276-270307 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1935182-1935213 9 0.719
NZ_CP021252_2 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT 270276-270307 32 NZ_CP012641 Massilia sp. WG5 plasmid unnamed 1, complete sequence 4725-4756 9 0.719
NZ_CP021252_2 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT 270276-270307 32 NZ_CP012641 Massilia sp. WG5 plasmid unnamed 1, complete sequence 17505-17536 9 0.719
NZ_CP021252_2 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT 270276-270307 32 NZ_CP012642 Massilia sp. WG5 plasmid unnamed 2, complete sequence 12151-12182 9 0.719
NZ_CP021252_2 2.13|270886|32|NZ_CP021252|CRISPRCasFinder,CRT 270886-270917 32 NC_010335 Caulobacter sp. K31 plasmid pCAUL01, complete sequence 124745-124776 9 0.719
NZ_CP021252_2 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT 271191-271222 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 286215-286246 9 0.719
NZ_CP021252_2 2.26|271679|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271679-271710 32 NZ_CP010862 Marinovum algicola DG 898 plasmid pMaD7 82490-82521 9 0.719
NZ_CP021252_2 2.27|271740|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271740-271771 32 NZ_CP011571 Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence 59178-59209 9 0.719
NZ_CP021252_2 2.27|271740|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271740-271771 32 NZ_CP011580 Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence 51099-51130 9 0.719
NZ_CP021252_2 2.27|271740|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271740-271771 32 NZ_CP011583 Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence 72736-72767 9 0.719
NZ_CP021252_2 2.27|271740|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271740-271771 32 NZ_CP011649 Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence 51099-51130 9 0.719
NZ_CP021252_2 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271862-271893 32 NZ_CP015740 Shinella sp. HZN7 plasmid pShin-04, complete sequence 161477-161508 9 0.719
NZ_CP021252_2 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272166-272197 32 AP014456 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15-MedDCM-OCT-S45-C152, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces 10316-10347 9 0.719
NZ_CP021252_2 2.35|272227|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272227-272258 32 KC139516 Salmonella phage FSL SP-016, partial genome 25502-25533 9 0.719
NZ_CP021252_2 2.39|272471|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272471-272502 32 MK249195 Blackfly microvirus SF02 isolate 130, complete genome 3097-3128 9 0.719
NZ_CP021252_1 1.6|268173|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 268173-268204 32 NC_008739 Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence 62831-62862 10 0.688
NZ_CP021252_1 1.6|268173|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT 268173-268204 32 NZ_CP034143 Marinobacter sp. NP-4(2019) plasmid unnamed1, complete sequence 58650-58681 10 0.688
NZ_CP021252_2 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 272166-272197 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1004803-1004834 10 0.688
NZ_CP021252_2 2.26|271679|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR 271679-271710 32 NZ_CP009453 Sphingopyxis sp. 113P3 plasmid unnamed, complete sequence 156824-156855 11 0.656

1. spacer 2.30|271923|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to KY653127 (Corynebacterium phage IME1320_01, complete genome) position: , mismatch: 1, identity: 0.969 

agcaaacctttaacgacgtgcttggcgccctg	CRISPR spacer
agcagacctttaacgacgtgcttggcgccctg	Protospacer
****.***************************

2. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to KX160204 (Lactococcus phage 38502, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

3. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to KX160215 (Lactococcus phage 98104, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

4. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to AY766464 (Lactococcus phage TP712, complete sequence) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

5. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to KX160205 (Lactococcus phage 49801, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

6. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to KX160209 (Lactococcus phage 58502, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

7. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to KX160212 (Lactococcus phage 98101, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

8. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NC_002703 (Lactococcus phage Tuc2009, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

9. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to AF242738 (Bacteriophage phi LC3, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

10. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to AF323669 (Bacteriophage bIL286, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttctttggccat	Protospacer
  ******************.***** *****

11. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NC_031040 (Lactococcus phage 50101, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

12. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NC_005822 (Lactococcus phage phiLC3, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

13. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to AF109874 (Bacteriophage Tuc2009, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

14. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to MN552144 (Lactococcus phage P1045, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

15. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to KX160211 (Lactococcus phage 62503, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

16. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to KX160210 (Lactococcus phage 62502, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

17. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to KX160214 (Lactococcus phage 98103, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

18. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to JX567312 (Lactococcus phage BM13, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

19. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NC_002667 (Lactococcus prophage bIL286, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttctttggccat	Protospacer
  ******************.***** *****

20. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to KX456212 (Lactococcus phage 86501, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

21. spacer 2.19|271252|32|NZ_CP021252|CRISPRCasFinder,CRT matches to KX160213 (Lactococcus phage 98102, complete genome) position: , mismatch: 4, identity: 0.875 

gaacgctgaatcatggaaatctctttcgccat	CRISPR spacer
ttacgctgaatcatggaaatttcttttgccat	Protospacer
  ******************.*****.*****

22. spacer 1.1|267868|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 5, identity: 0.844 

aagagtgccgcgtcacggccaccattggcgat	CRISPR spacer
atggctgcggcgtcacggccaccattggcgag	Protospacer
* *. *** **********************

23. spacer 2.8|270581|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

tggtcttggtctacttggtcgaggtcgttggt	CRISPR spacer
tggtcttggtctacttggtagtggattttgtt	Protospacer
******************* * ** . *** *

24. spacer 2.31|271984|31|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046712 (Nostoc sp. ATCC 53789 plasmid pNsp_i, complete sequence) position: , mismatch: 6, identity: 0.806 

cattaagccacacgaggctgaagattacgcc	CRISPR spacer
tctagagcgacacgaggctgaagagtacgcc	Protospacer
. * .*** *************** ******

25. spacer 1.5|268112|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.781 

cagacatggcaccagaacagcgcgcagcctgc	CRISPR spacer
gtgacatggcaccagaacagctcgccgttggc	Protospacer
  ******************* *** *.. **

26. spacer 1.12|268539|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013208 (Paenibacillus sp. IHB B 3084 plasmid pHD05, complete sequence) position: , mismatch: 7, identity: 0.781 

tttagtg--gtcatttcttctccctcatgatgtt	CRISPR spacer
--aggtggtgtcattccgtctccctcatgatgtg	Protospacer
   .***  ******.* ***************

27. spacer 1.12|268539|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040831 (Paenibacillus polymyxa strain ZF129 plasmid pAP2, complete sequence) position: , mismatch: 7, identity: 0.781 

tttagtg--gtcatttcttctccctcatgatgtt	CRISPR spacer
--aggtggtgtcattccgtctccctcatgatgta	Protospacer
   .***  ******.* ***************

28. spacer 2.1|270153|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NC_014304 (Erwinia billingiae Eb661 plasmid pEB102, complete sequence) position: , mismatch: 7, identity: 0.781 

aatcaatacccggcactgacgcgggtagcagt	CRISPR spacer
acggtatacccggcactgacgctggttgcagc	Protospacer
*    ***************** *** ****.

29. spacer 2.4|270337|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 7, identity: 0.781 

tcgctgtgagcaccggggcggcctttttgcgt	CRISPR spacer
tcgccgtgggcaccggggcggcctttctctac	Protospacer
****.***.*****************.* ...

30. spacer 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 7, identity: 0.781 

acggtgccgttggcgaccttcacg--tagccgtt	CRISPR spacer
tcggtgccgttgtcgacctccacgaacagcag--	Protospacer
 *********** ******.****  .*** *

31. spacer 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to MT639649 (Microbacterium phage Burritobowl, complete genome) position: , mismatch: 7, identity: 0.781 

acggtgccgttggcgaccttcacgtagccgtt	CRISPR spacer
ccgtagacgtcggcgacctccacgtagccgat	Protospacer
 **  * ***.********.********** *

32. spacer 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to MT818427 (Microbacterium phage AnnaLie, complete genome) position: , mismatch: 7, identity: 0.781 

acggtgccgttggcgaccttcacgtagccgtt	CRISPR spacer
ccgtagacgtcggcgacctccacgtagccgat	Protospacer
 **  * ***.********.********** *

33. spacer 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to MT889389 (Microbacterium phage DickRichards, complete genome) position: , mismatch: 7, identity: 0.781 

acggtgccgttggcgaccttcacgtagccgtt	CRISPR spacer
ccgtagacgtcggcgacctccacgtagccgat	Protospacer
 **  * ***.********.********** *

34. spacer 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

actgctg--gatcgccaccactgcctcggcggtg	CRISPR spacer
--tgatggtgatcgccaccgctgccgcggcggca	Protospacer
  ** **  **********.***** ******..

35. spacer 2.39|272471|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to MH572469 (Microviridae sp. isolate SD_MF_14, complete genome) position: , mismatch: 7, identity: 0.781 

cgccctatgcgtggaggcattctgtttggggt	CRISPR spacer
cgccctatgcgtggtggcattcggttatgata	Protospacer
************** ******* ***  *.

36. spacer 2.40|272532|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 7, identity: 0.781 

gggaaacagtcccagccacaaccggaaagaga	CRISPR spacer
gtgaaacagtgccagccacaacagggggaaga	Protospacer
* ******** *********** **....***

37. spacer 1.5|268112|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 8, identity: 0.75 

cagacatggcaccagaacagcgcgcagcctgc	CRISPR spacer
accgcatggcagcagaacagcgcgcggccggg	Protospacer
   .******* *************.*** *

38. spacer 1.5|268112|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 8, identity: 0.75 

cagacatggcaccagaacagcgcgcagcctgc	CRISPR spacer
accgcatggcagcagaacagcgcgcggccggg	Protospacer
   .******* *************.*** *

39. spacer 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 8, identity: 0.75 

aggtggtgccctcgacttcgagcagctcccag	CRISPR spacer
tcagaatgccctcgacttcgagcacctcgcag	Protospacer
  . ..****************** *** ***

40. spacer 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.75 

aggtggtgccctcgacttcgagcagctcccag	CRISPR spacer
tcaaaatgccctcgacttcgagcacctcgcag	Protospacer
  . ..****************** *** ***

41. spacer 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

aggtggtgccctcgacttcgagcagctcccag	CRISPR spacer
ggttggtggcctcggcttcgagcagcaagctg	Protospacer
.* ***** *****.***********   * *

42. spacer 2.13|270886|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

attaata-cgggccgcctggcgcacaagctttc	CRISPR spacer
-ctgttgtcgggccgcatggcgcgcaagcttgc	Protospacer
 .*. *. ******** ******.******* *

43. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP020897 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

44. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

45. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

46. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

47. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

48. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

49. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

50. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

51. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

52. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

53. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

54. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
ggaggcatgggttccggcatgtcgcggccgat	Protospacer
 *  ********* ******** *****.*.

55. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
gaccgcatgggtttcggcatgcggcaggtcga	Protospacer
 .*********** *******.***.* * *.

56. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
gaccgcatgggtttcggcatgcggcaggtcga	Protospacer
 .*********** *******.***.* * *.

57. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
gaccgcatgggtttcggcatgcggcagatcga	Protospacer
 .*********** *******.***.* * *.

58. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
gaccgcatgggtttcggcatgcggcaggtcga	Protospacer
 .*********** *******.***.* * *.

59. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 8, identity: 0.75 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
gaccgcatgggtttcggcatgcggcagatcga	Protospacer
 .*********** *******.***.* * *.

60. spacer 2.22|271435|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to MN582070 (Myoviridae sp. ctThM1, complete genome) position: , mismatch: 8, identity: 0.75 

ggcagggagcagataatcaccattcacaccga	CRISPR spacer
cgaaacgtgcaaataaacaccattcacaccgc	Protospacer
 * *. * ***.**** **************

61. spacer 2.26|271679|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 8, identity: 0.75 

tcgtctgcaaagtcagcatctgcgccgcagta	CRISPR spacer
ttctcagcaaagtcagcatcagcgccaacgtt	Protospacer
*. ** ************** *****.  **

62. spacer 2.28|271801|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018719 (Sterolibacteriaceae bacterium J5B plasmid pSTJ1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcgtgataagtgattccgccgtgaacttcgat	CRISPR spacer
aaatgagtcgtgattccggcgtgaccttcgat	Protospacer
  .***   ********* ***** *******

63. spacer 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to MT889392 (Microbacterium phage Lahqtemish, complete genome) position: , mismatch: 8, identity: 0.75 

acggtgccgttggcgaccttcacgtagccgtt	CRISPR spacer
ctgtcgacgtcggcgacctccacgtagccgat	Protospacer
 .* .* ***.********.********** *

64. spacer 2.33|272105|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028562 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p1_045096, complete sequence) position: , mismatch: 8, identity: 0.75 

gtcggtatgcggggacggtggtctgctcaacg	CRISPR spacer
gcggatcagcgtggaaggtggtctgctcaact	Protospacer
*. *.*  *** *** ***************

65. spacer 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

actgctgg-----atcgccaccactgcctcggcggtg	CRISPR spacer
-----tgggaggcgtcgcctcgactgcctcggcggtg	Protospacer
     ***     .***** * ***************

66. spacer 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NC_004444 (Pseudomonas resinovorans plasmid pCAR1, complete sequence) position: , mismatch: 8, identity: 0.75 

actgctggatcgccaccactgcctcggcggtg	CRISPR spacer
acatggcgatcgccaccacggccccggcggcg	Protospacer
**     ************ ***.******.*

67. spacer 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NC_021506 (Pseudomonas resinovorans NBRC 106553 plasmid pCAR1.3, complete sequence) position: , mismatch: 8, identity: 0.75 

actgctggatcgccaccactgcctcggcggtg	CRISPR spacer
acatggcgatcgccaccacggccccggcggcg	Protospacer
**     ************ ***.******.*

68. spacer 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

-actgctggatcgccaccactgcctcggcggtg	CRISPR spacer
ggatgat-gatcgccaccaccggctcggcggac	Protospacer
 . ** * ************.* ********

69. spacer 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NC_011838 (Pseudomonas putida plasmid pCAR1.2, complete sequence) position: , mismatch: 8, identity: 0.75 

actgctggatcgccaccactgcctcggcggtg	CRISPR spacer
acatggcgatcgccaccacggccccggcggcg	Protospacer
**     ************ ***.******.*

70. spacer 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

-actgctggatcgccaccactgcctcggcggtg	CRISPR spacer
ggatgat-gatcgccaccaccggctcggcggac	Protospacer
 . ** * ************.* ********

71. spacer 2.36|272288|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

gacaagtggaaggccgacaagacggacatccc	CRISPR spacer
tcctgttcgaaggccgacaaggcggacagccc	Protospacer
  * . * *************.****** ***

72. spacer 2.36|272288|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gacaagtggaaggccgacaagacggacatccc	CRISPR spacer
tacgagtggaagggcgacaagacgatcgtcgt	Protospacer
 **.********* **********. *.** .

73. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX426227 (Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

74. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to CP033569 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-1, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

75. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033130 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA23_010062, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

76. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to CP033531 (Acinetobacter pittii strain 2014S07-126 plasmid p2014S07-126-1, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

77. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042557 (Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

78. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010351 (Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

79. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029396 (Acinetobacter defluvii strain WCHA30 plasmid pOXA58_010030, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

80. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

81. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032285 (Acinetobacter sp. WCHA55 plasmid pOXA58_010055, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

82. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042365 (Acinetobacter pittii strain C54 plasmid pC54_001, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

83. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK134375 (Acinetobacter baumannii strain 34AB plasmid p34AB, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

84. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038010 (Acinetobacter haemolyticus strain TJR01 plasmid pAHTJR1, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

85. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043053 (Acinetobacter pittii strain AP43 plasmid pAP43-OXA58-NDM1, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

86. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH220285 (Acinetobacter ursingii strain RIVM0002 plasmid pRIVM0002_IMP-4_171109_B03, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

87. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH220287 (Acinetobacter ursingii strain RIVM0061 plasmid pRIVM0061_IMP-4_171109_B01, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

88. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043309 (Acinetobacter johnsonii strain Acsw19 plasmid pAcsw19-2, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

89. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH220286 (Acinetobacter ursingii strain RIVM0051 plasmid pRIVM0051_IMP-4, complete sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
tgttcctcaactttcttttcaatgggatctat	Protospacer
 ***.*** *************** *  * *

90. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to JF974321 (Cyanophage MED4-117 genomic sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
agttcctctactttctttttaatcagtccagt	Protospacer
****.**************.***  ** *..

91. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to MT647606 (Pelagibacter phage Mosig EXVC030M, partial genome) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
aatttttcttctttcttttcaatgcctaaaat	Protospacer
*.***.*** *************** *. .*

92. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to MT490303 (Prochlorococcus phage P-HS2, complete genome) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
agttcctctactttctttttaatcagtccagt	Protospacer
****.**************.***  ** *..

93. spacer 2.42|272654|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NC_020847 (Cyanophage MED4-184 genomic sequence) position: , mismatch: 8, identity: 0.75 

agtttctctactttcttttcaatgcgtgcgag	CRISPR spacer
agttcctctactttctttttaatcagtccagt	Protospacer
****.**************.***  ** *..

94. spacer 1.1|267868|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 9, identity: 0.719 

aagagtgccgcgtcacggccaccattggcgat	CRISPR spacer
aagagtgccccgtcacggcgaccggcaccaaa	Protospacer
********* ********* ***. .. *.*

95. spacer 1.3|267990|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043619 (Rhodobacteraceae bacterium SH-1 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

---attctagaaactcccgcgccgtggcacgtgcc	CRISPR spacer
gacgctcc---aactccaacgccgtggcacgtgca	Protospacer
   ..**.   ****** .***************

96. spacer 1.4|268051|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to MK962632 (Achromobacter phage vB_AxyP_19-32_Axy13, complete genome) position: , mismatch: 9, identity: 0.719 

caccaatggccttccacggtgccacggaaagt	CRISPR spacer
tcacgttggccttccacgatgtcacggaacat	Protospacer
.  *. ************.**.******* .*

97. spacer 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

aggtggtgccctcgacttcgagcagctcccag	CRISPR spacer
gttcgatgccatcgacttcgagcagcgcccct	Protospacer
.  .*.**** *************** ***

98. spacer 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719 

aggtggtgccctcgacttcgagcagctcccag	CRISPR spacer
gttcgatgccatcgacttcgagcagcgcccct	Protospacer
.  .*.**** *************** ***

99. spacer 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 9, identity: 0.719 

aggtggtgccctcgacttcgagcagctcccag	CRISPR spacer
tggtggtgccctcgccttcgaccacataaaac	Protospacer
 ************* ****** **  *   *

100. spacer 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 9, identity: 0.719 

aggtggtgccctcgacttcgagcagctcccag	CRISPR spacer
tggtggtgccctcgccttcgaccacataaaac	Protospacer
 ************* ****** **  *   *

101. spacer 2.3|270276|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP012642 (Massilia sp. WG5 plasmid unnamed 2, complete sequence) position: , mismatch: 9, identity: 0.719 

aggtggtgccctcgacttcgagcagctcccag	CRISPR spacer
tggtggtgccctcgccttcgaccacataaaac	Protospacer
 ************* ****** **  *   *

102. spacer 2.13|270886|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 9, identity: 0.719 

attaatacgggccgcctggcgcacaagctttc	CRISPR spacer
cacacggcgggccgcctcgcgcaaaagcttta	Protospacer
  .*  .********** ***** *******

103. spacer 2.18|271191|32|NZ_CP021252|CRISPRCasFinder,CRT matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.719 

cgccgcatgggttgcggcatgtggcggctggg	CRISPR spacer
gcaggcatgggttccggcatgtcgcggccgat	Protospacer
    ********* ******** *****.*.

104. spacer 2.26|271679|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010862 (Marinovum algicola DG 898 plasmid pMaD7) position: , mismatch: 9, identity: 0.719 

tcgtctgcaaagtcagcatctgcgccgcagta	CRISPR spacer
tgatctgcaaggtcagcatcggcgccagcgcc	Protospacer
* .*******.********* *****.  *.

105. spacer 2.27|271740|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011571 (Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgattggccagtcctgcgcggcacctcccga	CRISPR spacer
tcgcttggccagtccggcgcggcaggcgtcgc	Protospacer
.** *********** ********  . .**

106. spacer 2.27|271740|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011580 (Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgattggccagtcctgcgcggcacctcccga	CRISPR spacer
tcgcttggccagtccggcgcggcaggcgtcgc	Protospacer
.** *********** ********  . .**

107. spacer 2.27|271740|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011583 (Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgattggccagtcctgcgcggcacctcccga	CRISPR spacer
tcgcttggccagtccggcgcggcaggcgtcgc	Protospacer
.** *********** ********  . .**

108. spacer 2.27|271740|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011649 (Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgattggccagtcctgcgcggcacctcccga	CRISPR spacer
tcgcttggccagtccggcgcggcaggcgtcgc	Protospacer
.** *********** ********  . .**

109. spacer 2.29|271862|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015740 (Shinella sp. HZN7 plasmid pShin-04, complete sequence) position: , mismatch: 9, identity: 0.719 

acggtgccgttggcgaccttcacgtagccgtt	CRISPR spacer
acgcggccgttggcgaccttcaccgtgtgctc	Protospacer
***  ******************   *.  *.

110. spacer 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to AP014456 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15-MedDCM-OCT-S45-C152, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces) position: , mismatch: 9, identity: 0.719 

actgctggatcgccaccactgcctcggcggtg	CRISPR spacer
gctgctggatcgctaccacttcctcgttttaa	Protospacer
.************.****** ***** .   .

111. spacer 2.35|272227|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 9, identity: 0.719 

taccggttgcatagctggcaggcgggtacgag	CRISPR spacer
tatgcgttgcatagctgccacgcgggtagctt	Protospacer
**.  ************ ** *******

112. spacer 2.39|272471|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to MK249195 (Blackfly microvirus SF02 isolate 130, complete genome) position: , mismatch: 9, identity: 0.719 

cgccctatgcgtggaggcattctgtttggggt	CRISPR spacer
ctgcctatgcgtggtggcattcggttgtagca	Protospacer
*  *********** ******* ***  .*

113. spacer 1.6|268173|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to NC_008739 (Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgaagtcctcaagtgtgacgagctctaccgg	CRISPR spacer
actttctcctcaagtctggcgagctctacttc	Protospacer
 *    ********* **.**********.

114. spacer 1.6|268173|32|NZ_CP021252|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034143 (Marinobacter sp. NP-4(2019) plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgaagtcctcaagtgtgacgagctctaccgg	CRISPR spacer
actttctcctcaagtctggcgagctctacttc	Protospacer
 *    ********* **.**********.

115. spacer 2.34|272166|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688 

actgctggatcgccaccactgcctcggcggtg	CRISPR spacer
cggagcggatcgccgccaccgcctcggcgttc	Protospacer
   . .********.****.********* *

116. spacer 2.26|271679|32|NZ_CP021252|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009453 (Sphingopyxis sp. 113P3 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

tcgtctgcaaagtcagcatctgcgccgcagta	CRISPR spacer
caacctgcaaagtccgcatcttcgccgagaat	Protospacer
. ..********** ****** ***** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 25403 30 Gordonia_phage(64.29%) integrase,terminase,capsid,portal attL 12062:12075|attR 27489:27502
DBSCAN-SWA_2 39408 : 40461 1 Pacmanvirus(100.0%) NA NA
DBSCAN-SWA_3 49384 : 50191 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_4 65471 : 67409 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_5 72630 : 77049 2 Catovirus(50.0%) holin NA
DBSCAN-SWA_6 80836 : 83113 1 Saudi_moumouvirus(100.0%) NA NA
DBSCAN-SWA_7 86773 : 88114 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_8 91976 : 94202 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_9 97771 : 98581 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_10 103079 : 104003 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_11 108553 : 109405 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_12 114360 : 118198 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_13 121970 : 152235 25 Mycobacterium_phage(20.0%) transposase NA
DBSCAN-SWA_14 156845 : 157811 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_15 164551 : 167932 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_16 174100 : 174631 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_17 189722 : 198753 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_18 203968 : 212194 8 Natrialba_phage(20.0%) NA NA
DBSCAN-SWA_19 218845 : 220249 1 Mycobacterium_phage(100.0%) tRNA NA
DBSCAN-SWA_20 230468 : 231491 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_21 246300 : 246798 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_22 253837 : 258481 6 Streptococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_23 273108 : 274041 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_24 286059 : 288915 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_25 298071 : 300141 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_26 314560 : 315886 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_27 322096 : 326579 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_28 339932 : 340508 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_29 344500 : 357297 13 Staphylococcus_phage(40.0%) NA NA
DBSCAN-SWA_30 379315 : 379918 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_31 392830 : 394087 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_32 403892 : 405089 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_33 413332 : 416542 2 Macacine_betaherpesvirus(100.0%) NA NA
DBSCAN-SWA_34 447980 : 453812 6 Enterobacteria_phage(33.33%) transposase NA
DBSCAN-SWA_35 461428 : 468759 6 Bacillus_phage(66.67%) tRNA NA
DBSCAN-SWA_36 478157 : 483225 4 Amsacta_moorei_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_37 486977 : 491472 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_38 494620 : 499906 4 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_39 507134 : 508427 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_40 517568 : 520052 1 Moloney_murine_sarcoma_virus(100.0%) NA NA
DBSCAN-SWA_41 523226 : 526125 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_42 529657 : 530561 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_43 544637 : 546284 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_44 549409 : 556467 6 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_45 559837 : 566962 7 uncultured_Caudovirales_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_46 574256 : 575834 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_47 579783 : 582504 1 Cronobacter_phage(100.0%) protease NA
DBSCAN-SWA_48 593491 : 597339 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_49 608179 : 613753 7 Gordonia_phage(50.0%) integrase attL 604838:604874|attR 613889:613925
DBSCAN-SWA_50 619503 : 621724 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_51 625008 : 625878 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_52 629496 : 637694 4 Microbacterium_phage(50.0%) NA NA
DBSCAN-SWA_53 642968 : 645541 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_54 655279 : 656053 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_55 663649 : 664585 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_56 673133 : 673871 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_57 682928 : 691041 8 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_58 818184 : 818595 1 Anguillid_herpesvirus(100.0%) NA NA
DBSCAN-SWA_59 836675 : 838836 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_60 841910 : 845862 5 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_61 853808 : 857607 4 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_62 866331 : 871582 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_63 881266 : 883159 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_64 888401 : 890243 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_65 897017 : 899893 3 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_66 907742 : 948240 32 Catovirus(16.67%) integrase,transposase,protease,tRNA attL 916973:916991|attR 937700:937718
DBSCAN-SWA_67 972576 : 973782 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_68 996743 : 998741 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_69 1011408 : 1014264 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_70 1018461 : 1020009 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_71 1023727 : 1025650 1 Phaeocystis_globosa_virus(100.0%) NA NA
DBSCAN-SWA_72 1033960 : 1035804 2 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_73 1039989 : 1043293 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_74 1070116 : 1073293 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_75 1082934 : 1086507 1 Saccharomonospora_phage(100.0%) NA NA
DBSCAN-SWA_76 1091185 : 1095749 6 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_77 1116824 : 1122022 4 Iris_mild_mosaic_virus(50.0%) NA NA
DBSCAN-SWA_78 1125632 : 1127224 2 Dishui_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_79 1132678 : 1134211 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_80 1146958 : 1149229 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_81 1170713 : 1171613 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_82 1186991 : 1192732 4 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_83 1197889 : 1198225 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_84 1203604 : 1206418 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_85 1219295 : 1220045 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_86 1224090 : 1228910 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_87 1232716 : 1235740 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_88 1238990 : 1239719 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_89 1250170 : 1251451 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_90 1255175 : 1264066 6 Stenotrophomonas_phage(33.33%) NA NA
DBSCAN-SWA_91 1269563 : 1277720 6 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_92 1284594 : 1286645 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_93 1292803 : 1296251 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_94 1304369 : 1309373 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_95 1321186 : 1325218 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_96 1328223 : 1328697 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_97 1343350 : 1345414 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_98 1354475 : 1363886 7 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_99 1381693 : 1382587 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_100 1385926 : 1390121 2 Bacillus_virus(50.0%) tRNA NA
DBSCAN-SWA_101 1393500 : 1394712 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_102 1399353 : 1400118 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_103 1403348 : 1406015 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_104 1417590 : 1426486 9 Mycobacterium_phage(25.0%) tRNA NA
DBSCAN-SWA_105 1432995 : 1434165 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_106 1438744 : 1440004 1 Serratia_phage(100.0%) tRNA NA
DBSCAN-SWA_107 1454636 : 1459071 5 Virus_Rctr41k(33.33%) NA NA
DBSCAN-SWA_108 1466199 : 1471699 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_109 1482879 : 1484325 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_110 1497375 : 1498269 1 Sulfolobus_monocaudavirus(100.0%) NA NA
DBSCAN-SWA_111 1503440 : 1506269 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_112 1512968 : 1517639 4 Lymphocystis_disease_virus(50.0%) tRNA NA
DBSCAN-SWA_113 1525300 : 1526539 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_114 1532130 : 1533364 1 Enterobacteria_phage(100.0%) transposase NA
DBSCAN-SWA_115 1538741 : 1540643 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_116 1552981 : 1556838 4 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_117 1562824 : 1563754 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_118 1571256 : 1572789 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_119 1579766 : 1580732 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_120 1584352 : 1586749 3 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_121 1591169 : 1597510 6 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_122 1602322 : 1605856 3 Halovirus(50.0%) NA NA
DBSCAN-SWA_123 1611281 : 1611758 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_124 1616158 : 1616824 1 Beluga_whale_alphaherpesvirus(100.0%) NA NA
DBSCAN-SWA_125 1626249 : 1626840 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_126 1637874 : 1638615 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_127 1648453 : 1650040 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_128 1654583 : 1656431 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_129 1668505 : 1669558 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_130 1679343 : 1682128 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_131 1689225 : 1690308 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_132 1695256 : 1696366 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_133 1700137 : 1700980 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_134 1720950 : 1723655 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_135 1737049 : 1738645 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_136 1759924 : 1760350 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_137 1766307 : 1769349 1 Choristoneura_rosaceana_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_138 1772522 : 1774538 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_139 1779336 : 1780890 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_140 1784760 : 1789948 3 Agrobacterium_phage(33.33%) transposase NA
DBSCAN-SWA_141 1797835 : 1803139 5 Burkholderia_virus(50.0%) transposase NA
DBSCAN-SWA_142 1813085 : 1814303 1 Sphingomonas_phage(100.0%) NA NA
DBSCAN-SWA_143 1820279 : 1821044 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_144 1842449 : 1844234 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_145 1874341 : 1875583 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_146 1882603 : 1893991 11 Yellowstone_lake_phycodnavirus(20.0%) NA NA
DBSCAN-SWA_147 1903737 : 1905015 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_148 1916493 : 1918929 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_149 1926775 : 1928655 2 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_150 1933250 : 1934894 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_151 1949492 : 1955322 5 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_152 1958709 : 1959861 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_153 1963102 : 1966915 2 Indivirus(50.0%) tRNA NA
DBSCAN-SWA_154 1975367 : 1976294 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_155 1979474 : 1983318 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_156 1988890 : 1990171 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_157 1993604 : 2000429 6 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_158 2003459 : 2006852 2 Corynebacterium_phage(50.0%) NA NA
DBSCAN-SWA_159 2017381 : 2021648 7 Gordonia_phage(33.33%) NA NA
DBSCAN-SWA_160 2032420 : 2041889 9 Moraxella_phage(25.0%) NA NA
DBSCAN-SWA_161 2050463 : 2053256 3 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_162 2060115 : 2093061 30 Burkholderia_virus(21.43%) transposase NA
DBSCAN-SWA_163 2096556 : 2097999 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_164 2111599 : 2118827 4 Clostridium_botulinum_C_phage(50.0%) NA NA
DBSCAN-SWA_165 2124220 : 2130503 8 Diachasmimorpha_longicaudata_entomopoxvirus(25.0%) tRNA NA
DBSCAN-SWA_166 2141141 : 2143603 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_167 2158577 : 2160425 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_168 2175680 : 2181896 1 Tenacibaculum_phage(100.0%) NA NA
DBSCAN-SWA_169 2193175 : 2194255 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_170 2197667 : 2198918 1 Corynebacterium_phage(100.0%) transposase NA
DBSCAN-SWA_171 2212043 : 2216813 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_172 2237477 : 2238290 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_173 2256915 : 2257416 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_174 2261637 : 2262630 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_175 2286389 : 2290824 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_176 2296938 : 2297766 1 Leuconostoc_phage(100.0%) NA NA
DBSCAN-SWA_177 2302109 : 2303018 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_178 2316612 : 2317413 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_179 2321351 : 2323621 2 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_180 2343156 : 2344011 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_181 2360222 : 2365647 4 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_182 2375178 : 2375850 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_183 2379883 : 2381227 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_184 2389731 : 2400119 10 uncultured_virus(40.0%) tRNA NA
DBSCAN-SWA_185 2404857 : 2406729 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_186 2415026 : 2421667 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_187 2430806 : 2431352 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_188 2458151 : 2481352 16 Hokovirus(14.29%) NA NA
DBSCAN-SWA_189 2493942 : 2496369 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_190 2501359 : 2502046 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_191 2519585 : 2521091 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_192 2531259 : 2588181 44 Bacillus_phage(22.22%) integrase,transposase,protease,tRNA attL 2522954:2522969|attR 2590391:2590406
DBSCAN-SWA_193 2606295 : 2607708 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_194 2612642 : 2620404 7 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_195 2624894 : 2625794 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_196 2631343 : 2642708 8 uncultured_Mediterranean_phage(40.0%) NA NA
DBSCAN-SWA_197 2651168 : 2652403 2 Mycobacterium_phage(50.0%) transposase NA
DBSCAN-SWA_198 2662101 : 2662755 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_199 2671469 : 2675000 3 Tsukamurella_phage(50.0%) NA NA
DBSCAN-SWA_200 2682058 : 2683606 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_201 2702500 : 2705158 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_202 2713752 : 2715729 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_203 2737730 : 2742355 4 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_204 2747124 : 2753565 6 Corynebacterium_phage(100.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021253
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6406 7 Acidithiobacillus_phage(50.0%) transposase NA
DBSCAN-SWA_2 10176 : 17140 6 Tupanvirus(50.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage