Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022227 Escherichia coli strain WCHEC96200 plasmid pOXA1_WCHEC96200, complete sequence 0 crisprs csa3,RT 0 0 2 0
NZ_CP022228 Escherichia coli strain WCHEC96200 plasmid p_WCHEC96200, complete sequence 0 crisprs c2c9_V-U4 0 0 2 0
NZ_CP022229 Escherichia coli strain WCHEC96200 chromosome, complete genome 5 crisprs csa3,PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,c2c9_V-U4,RT 0 7 8 0
NZ_CP022226 Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence 0 crisprs NA 0 0 5 0

Results visualization

1. NZ_CP022227
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10315 : 53084 51 Escherichia_phage(53.85%) integrase,transposase attL 13533:13592|attR 61295:62115
DBSCAN-SWA_2 57937 : 74512 18 Escherichia_phage(60.0%) protease,transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP022226
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11104 9 Escherichia_phage(40.0%) transposase NA
DBSCAN-SWA_2 16574 : 18561 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_3 24053 : 25013 1 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_4 29851 : 33500 4 Escherichia_phage(33.33%) integrase attL 27297:27310|attR 41786:41799
DBSCAN-SWA_5 41110 : 46213 5 Stx2-converting_phage(60.0%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP022229
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022229_1 1071171-1071504 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022229_2 1098642-1099216 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022229_3 2325381-2325504 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022229_4 3073618-3073709 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022229_5 4405381-4405530 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022229_4 4.1|3073644|40|NZ_CP022229|CRISPRCasFinder 3073644-3073683 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP022229_2 2.4|1098851|35|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT 1098851-1098885 35 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42676-42710 2 0.943
NZ_CP022229_3 3.1|2325424|38|NZ_CP022229|CRISPRCasFinder 2325424-2325461 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP022229_1 1.3|1071322|32|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT 1071322-1071353 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
NZ_CP022229_1 1.1|1071200|32|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT 1071200-1071231 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
NZ_CP022229_1 1.1|1071200|32|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT 1071200-1071231 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
NZ_CP022229_1 1.4|1071383|32|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT 1071383-1071414 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
NZ_CP022229_2 2.5|1098912|35|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT 1098912-1098946 35 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20186 12 0.657

1. spacer 4.1|3073644|40|NZ_CP022229|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

gcgctgcgggtcatttttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.************************

2. spacer 2.4|1098851|35|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.943 

tcggcgagtaagagtactgagtattttaatctcat	CRISPR spacer
acggcgagtaagagtgctgagtattttaatctcat	Protospacer
 **************.*******************

3. spacer 3.1|2325424|38|NZ_CP022229|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 1.3|1071322|32|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812 

tgcacgccctgccggaatctcccctcgctctc	CRISPR spacer
tgcacgccctgccggaagatcccctcacgatt	Protospacer
*****************  *******.*  *.

5. spacer 1.1|1071200|32|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75 

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

6. spacer 1.1|1071200|32|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

7. spacer 1.4|1071383|32|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75 

agtaagccggttgattatcgcca----gggatatta	CRISPR spacer
agtaagcaggatgattatcgccaccatggcgt----	Protospacer
******* ** ************    ** .*

8. spacer 2.5|1098912|35|NZ_CP022229|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.657 

tcggccatagactttattaacttcattgggggtta	CRISPR spacer
atcgccatagaattttttaacttcattgcctaaag	Protospacer
 . ******** *** ************   .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1115574 : 1122714 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_2 1498507 : 1536488 60 Enterobacteria_phage(48.28%) terminase,lysis,holin,head,portal NA
DBSCAN-SWA_3 1784057 : 1793500 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 1804939 : 1870026 75 Escherichia_phage(40.43%) transposase,integrase,tRNA,tail,capsid,plate,terminase,holin,lysis,head,portal attL 1832833:1832859|attR 1865712:1865738
DBSCAN-SWA_5 1917431 : 1924949 8 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_6 2399016 : 2474579 96 Enterobacteria_phage(39.66%) transposase,tail,capsid,protease,terminase,lysis,head,portal NA
DBSCAN-SWA_7 2900683 : 2959125 76 Escherichia_phage(35.85%) integrase,tRNA,tail,capsid,terminase,lysis,holin,head,portal attL 2908876:2908890|attR 2959227:2959241
DBSCAN-SWA_8 3320452 : 3376654 79 Enterobacteria_phage(37.29%) transposase,integrase,tail,capsid,protease,terminase,holin,head,portal attL 3343180:3343196|attR 3384529:3384545

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP022228
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 66056 87 Escherichia_phage(82.05%) integrase,holin,transposase,portal,tail,head attL 13592:13608|attR 26863:26879
DBSCAN-SWA_2 70512 : 92517 29 Escherichia_phage(100.0%) tail,plate NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage