Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028587 Escherichia coli strain WCHEC4533 plasmid pCTXM15_000533, complete sequence 0 crisprs csa3,RT 0 0 1 0
NZ_CP028589 Escherichia coli strain WCHEC4533 chromosome, complete genome 6 crisprs csa3,PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,c2c9_V-U4,DinG,RT 0 9 9 0
NZ_CP028585 Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence 0 crisprs c2c9_V-U4 0 0 1 0
NZ_CP028588 Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP028586 Escherichia coli strain WCHEC4533 plasmid p2_000533, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP028587
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262 : 88640 94 Escherichia_phage(43.48%) protease,transposase,integrase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP028589
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028589_1 1071047-1071380 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028589_2 1098518-1099092 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028589_3 2325559-2325682 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028589_4 3074216-3074307 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028589_5 4176782-4176914 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028589_6 4405920-4406069 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028589_4 4.1|3074242|40|NZ_CP028589|CRISPRCasFinder 3074242-3074281 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP028589_5 5.1|4176799|42|NZ_CP028589|PILER-CR 4176799-4176840 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
NZ_CP028589_5 5.2|4176858|40|NZ_CP028589|PILER-CR 4176858-4176897 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
NZ_CP028589_2 2.4|1098727|35|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT 1098727-1098761 35 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42676-42710 2 0.943
NZ_CP028589_3 3.1|2325602|38|NZ_CP028589|CRISPRCasFinder 2325602-2325639 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP028589_1 1.3|1071198|32|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT 1071198-1071229 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
NZ_CP028589_1 1.1|1071076|32|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT 1071076-1071107 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
NZ_CP028589_1 1.1|1071076|32|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT 1071076-1071107 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
NZ_CP028589_1 1.4|1071259|32|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT 1071259-1071290 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
NZ_CP028589_2 2.5|1098788|35|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT 1098788-1098822 35 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20186 12 0.657

1. spacer 4.1|3074242|40|NZ_CP028589|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

gcgctgcgggtcatttttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.************************

2. spacer 5.1|4176799|42|NZ_CP028589|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976 

tgtcacacgcagataaatccaactttcaatattgttaagtcc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
****************************************.*

3. spacer 5.2|4176858|40|NZ_CP028589|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975 

catggcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *****************************

4. spacer 2.4|1098727|35|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.943 

tcggcgagtaagagtactgagtattttaatctcat	CRISPR spacer
acggcgagtaagagtgctgagtattttaatctcat	Protospacer
 **************.*******************

5. spacer 3.1|2325602|38|NZ_CP028589|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

6. spacer 1.3|1071198|32|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812 

tgcacgccctgccggaatctcccctcgctctc	CRISPR spacer
tgcacgccctgccggaagatcccctcacgatt	Protospacer
*****************  *******.*  *.

7. spacer 1.1|1071076|32|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75 

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

8. spacer 1.1|1071076|32|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

9. spacer 1.4|1071259|32|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75 

agtaagccggttgattatcgcca----gggatatta	CRISPR spacer
agtaagcaggatgattatcgccaccatggcgt----	Protospacer
******* ** ************    ** .*

10. spacer 2.5|1098788|35|NZ_CP028589|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.657 

tcggccatagactttattaacttcattgggggtta	CRISPR spacer
atcgccatagaattttttaacttcattgcctaaag	Protospacer
 . ******** *** ************   .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1115450 : 1122590 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_2 1498361 : 1536342 59 Enterobacteria_phage(46.55%) integrase,holin,lysis,portal,head,terminase attL 1490601:1490623|attR 1539286:1539308
DBSCAN-SWA_3 1783911 : 1793354 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 1804793 : 1869880 74 Escherichia_phage(41.3%) integrase,holin,plate,tail,tRNA,transposase,capsid,portal,lysis,head,terminase attL 1832687:1832713|attR 1865566:1865592
DBSCAN-SWA_5 1917285 : 1924803 7 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_6 2399194 : 2474757 95 Enterobacteria_phage(39.66%) integrase,tail,transposase,capsid,lysis,portal,head,terminase,protease attL 2406770:2406785|attR 2443889:2443904
DBSCAN-SWA_7 2900505 : 2958947 77 Escherichia_phage(38.18%) holin,integrase,tRNA,capsid,portal,lysis,head,terminase,tail attL 2908698:2908712|attR 2959049:2959063
DBSCAN-SWA_8 3320871 : 3377073 77 Enterobacteria_phage(36.21%) holin,integrase,transposase,capsid,portal,head,terminase,tail,protease attL 3343599:3343615|attR 3384948:3384964
DBSCAN-SWA_9 4488236 : 4555004 60 Vibrio_phage(14.29%) integrase,transposase,tRNA,protease attL 4493016:4493033|attR 4560808:4560825

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP028585
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 92104 115 Escherichia_phage(86.79%) head,portal,holin,integrase,plate,tail,transposase attL 55708:55724|attR 68979:68995

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP028588
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11795 : 19910 8 Stx2-converting_phage(42.86%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage