Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018546 Brucella melitensis strain BwIM_TUR_19 chromosome 1, complete sequence 1 crisprs csa3,WYL,DEDDh 0 1 3 0
NZ_CP018547 Brucella melitensis strain BwIM_TUR_19 chromosome 2 0 crisprs csa3,cas3,DEDDh 0 0 0 0

Results visualization

1. NZ_CP018546
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018546_1 659602-659684 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018546_1 1.1|659630|27|NZ_CP018546|CRISPRCasFinder 659630-659656 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|659630|27|NZ_CP018546|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ataagatgcgcgcaaggaaagatctgt	CRISPR spacer
aacagatgctctcaaggaaagatctga	Protospacer
*  ****** * ************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 534875 : 650481 107 Paracoccus_phage(12.0%) capsid,head,transposase,portal,integrase,tail,holin,protease attL 643056:643070|attR 653091:653105
DBSCAN-SWA_2 875665 : 887577 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_3 958288 : 966627 10 Brucella_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage