Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022035 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed2, complete sequence 0 crisprs c2c9_V-U4 0 0 2 0
NZ_CP022034 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 chromosome, complete genome 4 crisprs PD-DExK,WYL,csa3,cas3,DEDDh,DinG,cas14j,c2c9_V-U4 0 21 13 0
NZ_CP022036 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence 0 crisprs NA 0 0 6 0

Results visualization

1. NZ_CP022035
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10646 : 88786 60 Stx2-converting_phage(38.46%) transposase,integrase NA
DBSCAN-SWA_2 92654 : 104528 18 Enterobacteria_phage(20.0%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP022034
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022034_1 933351-933745 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022034_2 941675-942496 Orphan I-E
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022034_3 2449131-2449211 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022034_4 3173709-3173834 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022034_2 2.14|941704|32|NZ_CP022034|CRISPRCasFinder,CRT 941704-941735 32 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 48761-48792 0 1.0
NZ_CP022034_4 4.1|3173754|36|NZ_CP022034|CRISPRCasFinder 3173754-3173789 36 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 22457-22492 0 1.0
NZ_CP022034_2 2.1|941702|34|NZ_CP022034|PILER-CR 941702-941735 34 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 48759-48792 1 0.971
NZ_CP022034_2 2.23|942253|32|NZ_CP022034|CRISPRCasFinder,CRT 942253-942284 32 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 23070-23101 1 0.969
NZ_CP022034_2 2.23|942253|32|NZ_CP022034|CRISPRCasFinder,CRT 942253-942284 32 NC_049393 Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1 22848-22879 1 0.969
NZ_CP022034_2 2.17|941887|32|NZ_CP022034|CRISPRCasFinder,CRT 941887-941918 32 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 2256-2287 2 0.938
NZ_CP022034_2 2.23|942253|32|NZ_CP022034|CRISPRCasFinder,CRT 942253-942284 32 NC_049394 Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1 24125-24156 2 0.938
NZ_CP022034_4 4.1|3173754|36|NZ_CP022034|CRISPRCasFinder 3173754-3173789 36 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 52523-52558 2 0.944
NZ_CP022034_4 4.1|3173754|36|NZ_CP022034|CRISPRCasFinder 3173754-3173789 36 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 100634-100669 2 0.944
NZ_CP022034_2 2.4|941885|34|NZ_CP022034|PILER-CR 941885-941918 34 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 2256-2289 3 0.912
NZ_CP022034_2 2.10|942251|34|NZ_CP022034|PILER-CR 942251-942284 34 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 23070-23103 3 0.912
NZ_CP022034_2 2.10|942251|34|NZ_CP022034|PILER-CR 942251-942284 34 NC_049393 Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1 22848-22881 3 0.912
NZ_CP022034_2 2.10|942251|34|NZ_CP022034|PILER-CR 942251-942284 34 NC_049394 Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1 24125-24158 3 0.912
NZ_CP022034_2 2.18|941948|32|NZ_CP022034|CRISPRCasFinder,CRT 941948-941979 32 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 35847-35878 3 0.906
NZ_CP022034_1 1.1|933380|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933380-933411 32 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 40366-40397 4 0.875
NZ_CP022034_1 1.7|933379|33|NZ_CP022034|CRT 933379-933411 33 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 40365-40397 4 0.879
NZ_CP022034_2 2.5|941946|34|NZ_CP022034|PILER-CR 941946-941979 34 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 35847-35880 4 0.882
NZ_CP022034_4 4.1|3173754|36|NZ_CP022034|CRISPRCasFinder 3173754-3173789 36 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 22376-22411 4 0.889
NZ_CP022034_1 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933624-933655 32 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 112052-112083 5 0.844
NZ_CP022034_1 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933624-933655 32 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 224971-225002 5 0.844
NZ_CP022034_1 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933624-933655 32 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 90792-90823 5 0.844
NZ_CP022034_1 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933624-933655 32 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 271400-271431 6 0.812
NZ_CP022034_1 1.11|933623|33|NZ_CP022034|CRT 933623-933655 33 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 90792-90824 6 0.818
NZ_CP022034_1 1.11|933623|33|NZ_CP022034|CRT 933623-933655 33 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 112051-112083 6 0.818
NZ_CP022034_1 1.11|933623|33|NZ_CP022034|CRT 933623-933655 33 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 224970-225002 6 0.818
NZ_CP022034_1 1.4|933563|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933563-933594 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 349601-349632 7 0.781
NZ_CP022034_1 1.4|933563|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933563-933594 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 349601-349632 7 0.781
NZ_CP022034_1 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933624-933655 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 343727-343758 7 0.781
NZ_CP022034_1 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933624-933655 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 654402-654433 7 0.781
NZ_CP022034_1 1.11|933623|33|NZ_CP022034|CRT 933623-933655 33 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 271400-271432 7 0.788
NZ_CP022034_2 2.22|942192|32|NZ_CP022034|CRISPRCasFinder,CRT 942192-942223 32 NC_048066 Vibrio phage 1.202.O._10N.222.45.E8, partial genome 25336-25367 7 0.781
NZ_CP022034_1 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933624-933655 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2052295-2052326 8 0.75
NZ_CP022034_1 1.10|933562|33|NZ_CP022034|CRT 933562-933594 33 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 349600-349632 8 0.758
NZ_CP022034_1 1.10|933562|33|NZ_CP022034|CRT 933562-933594 33 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 349600-349632 8 0.758
NZ_CP022034_2 2.9|942190|34|NZ_CP022034|PILER-CR 942190-942223 34 NC_048066 Vibrio phage 1.202.O._10N.222.45.E8, partial genome 25336-25369 8 0.765
NZ_CP022034_2 2.14|941704|32|NZ_CP022034|CRISPRCasFinder,CRT 941704-941735 32 NZ_CP025961 Rhodococcus qingshengii strain djl-6-2 plasmid pDJL2, complete sequence 12259-12290 8 0.75
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MT080601 UNVERIFIED: Staphylococcus phage vB_SauM_EW72, complete genome 28900-28931 8 0.75
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MT080585 UNVERIFIED: Staphylococcus phage vB_SauM_EW18, complete genome 142453-142484 8 0.75
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MT080591 UNVERIFIED: Staphylococcus phage vB_SauM_EW29, complete genome 138989-139020 8 0.75
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MT080589 UNVERIFIED: Staphylococcus phage vB_SauM_EW26, complete genome 41010-41041 8 0.75
NZ_CP022034_3 3.1|2449155|33|NZ_CP022034|CRISPRCasFinder 2449155-2449187 33 NC_017414 Borreliella burgdorferi N40 plasmid N40_lp36, complete sequence 16761-16793 8 0.758
NZ_CP022034_1 1.4|933563|32|NZ_CP022034|PILER-CR,CRISPRCasFinder 933563-933594 32 MN994500 Phage NBSal001, complete genome 9405-9436 9 0.719
NZ_CP022034_2 2.4|941885|34|NZ_CP022034|PILER-CR 941885-941918 34 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 59147-59180 9 0.735
NZ_CP022034_2 2.16|941826|32|NZ_CP022034|CRISPRCasFinder,CRT 941826-941857 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 189786-189817 9 0.719
NZ_CP022034_2 2.17|941887|32|NZ_CP022034|CRISPRCasFinder,CRT 941887-941918 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 59147-59178 9 0.719
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MN693066 Marine virus AFVG_25M551, complete genome 12287-12318 9 0.719
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MN693345 Marine virus AFVG_25M552, complete genome 18761-18792 9 0.719
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MN693995 Marine virus AFVG_250M873, complete genome 48672-48703 9 0.719
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MN693610 Marine virus AFVG_250M347, complete genome 5529-5560 9 0.719
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MN693983 Marine virus AFVG_250M348, complete genome 48251-48282 9 0.719
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MN694535 Marine virus AFVG_250M1087, complete genome 48621-48652 9 0.719
NZ_CP022034_2 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT 942009-942040 32 MN694384 Marine virus AFVG_250M349, complete genome 48100-48131 9 0.719
NZ_CP022034_2 2.22|942192|32|NZ_CP022034|CRISPRCasFinder,CRT 942192-942223 32 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 38488-38519 9 0.719
NZ_CP022034_2 2.6|942007|34|NZ_CP022034|PILER-CR 942007-942040 34 MN693066 Marine virus AFVG_25M551, complete genome 12287-12320 11 0.676
NZ_CP022034_2 2.6|942007|34|NZ_CP022034|PILER-CR 942007-942040 34 MN693345 Marine virus AFVG_25M552, complete genome 18759-18792 11 0.676

1. spacer 2.14|941704|32|NZ_CP022034|CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

cccgcaatctgcgggcgttctcgtcaatttac	CRISPR spacer
cccgcaatctgcgggcgttctcgtcaatttac	Protospacer
********************************

2. spacer 4.1|3173754|36|NZ_CP022034|CRISPRCasFinder matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0 

cttccgttgggaccgtggtcccatcttcatgggtac	CRISPR spacer
cttccgttgggaccgtggtcccatcttcatgggtac	Protospacer
************************************

3. spacer 2.1|941702|34|NZ_CP022034|PILER-CR matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971 

cgcccgcaatctgcgggcgttctcgtcaatttac	CRISPR spacer
ggcccgcaatctgcgggcgttctcgtcaatttac	Protospacer
 *********************************

4. spacer 2.23|942253|32|NZ_CP022034|CRISPRCasFinder,CRT matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 1, identity: 0.969 

cgcgcaacattcattactgcccactattcaga	CRISPR spacer
cgcgcaacgttcattactgcccactattcaga	Protospacer
********.***********************

5. spacer 2.23|942253|32|NZ_CP022034|CRISPRCasFinder,CRT matches to NC_049393 (Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1) position: , mismatch: 1, identity: 0.969 

cgcgcaacattcattactgcccactattcaga	CRISPR spacer
cgcgcaacgttcattactgcccactattcaga	Protospacer
********.***********************

6. spacer 2.17|941887|32|NZ_CP022034|CRISPRCasFinder,CRT matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.938 

cgtatttttgaactggccagcgccaccgatgc	CRISPR spacer
cgtatttttgaactggccagtgctaccgatgc	Protospacer
********************.**.********

7. spacer 2.23|942253|32|NZ_CP022034|CRISPRCasFinder,CRT matches to NC_049394 (Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.938 

cgcgcaacattcattactgcccactattcaga	CRISPR spacer
cgtgcaacgttcattactgcccactattcaga	Protospacer
**.*****.***********************

8. spacer 4.1|3173754|36|NZ_CP022034|CRISPRCasFinder matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.944 

cttccgttgggaccgtggtcccatcttcatgggtac	CRISPR spacer
cttccgttgggaccgcggtcccatcttcataggtac	Protospacer
***************.**************.*****

9. spacer 4.1|3173754|36|NZ_CP022034|CRISPRCasFinder matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.944 

cttccgttgggaccgtggtcccatcttcatgggtac	CRISPR spacer
cttccgttgggaccgcggtcccatcttcataggtac	Protospacer
***************.**************.*****

10. spacer 2.4|941885|34|NZ_CP022034|PILER-CR matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.912 

cgcgtatttttgaactggccagcgccaccgatgc	CRISPR spacer
agcgtatttttgaactggccagtgctaccgatgc	Protospacer
 *********************.**.********

11. spacer 2.10|942251|34|NZ_CP022034|PILER-CR matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.912 

cgcgcgcaacattcattactgcccactattcaga	CRISPR spacer
aacgcgcaacgttcattactgcccactattcaga	Protospacer
 .********.***********************

12. spacer 2.10|942251|34|NZ_CP022034|PILER-CR matches to NC_049393 (Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.912 

cgcgcgcaacattcattactgcccactattcaga	CRISPR spacer
aacgcgcaacgttcattactgcccactattcaga	Protospacer
 .********.***********************

13. spacer 2.10|942251|34|NZ_CP022034|PILER-CR matches to NC_049394 (Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.912 

cgcgcgcaacattcattactgcccactattcaga	CRISPR spacer
agcgtgcaacgttcattactgcccactattcaga	Protospacer
 ***.*****.***********************

14. spacer 2.18|941948|32|NZ_CP022034|CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906 

ggttacgcgggcgtctgttaaagagtcctcgt	CRISPR spacer
ggttgcgcgggcgtctgttgaagagtcctcgc	Protospacer
****.**************.***********.

15. spacer 1.1|933380|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875 

atatcgttgtatttggcgaccagatcatcata	CRISPR spacer
acgtcgttatatttagcgaccagatcatcata	Protospacer
*..*****.*****.*****************

16. spacer 1.7|933379|33|NZ_CP022034|CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.879 

gatatcgttgtatttggcgaccagatcatcata	CRISPR spacer
gacgtcgttatatttagcgaccagatcatcata	Protospacer
**..*****.*****.*****************

17. spacer 2.5|941946|34|NZ_CP022034|PILER-CR matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882 

cgggttacgcgggcgtctgttaaagagtcctcgt	CRISPR spacer
agggttgcgcgggcgtctgttgaagagtcctcgc	Protospacer
 *****.**************.***********.

18. spacer 4.1|3173754|36|NZ_CP022034|CRISPRCasFinder matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 4, identity: 0.889 

cttccgttgggaccgtggtcccatcttcatgggtac	CRISPR spacer
cttccgttgagaccgtggtcccatctacatgggcat	Protospacer
*********.**************** ******.*.

19. spacer 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 5, identity: 0.844 

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****.

20. spacer 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844 

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****.

21. spacer 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.844 

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****.

22. spacer 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 6, identity: 0.812 

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cagatcgcgctggcggcctcatccg-tgccgca	Protospacer
 .**************.* ****** *****.

23. spacer 1.11|933623|33|NZ_CP022034|CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.818 

ggggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cgagatcgcgctggcggcctcatccg-tgccgca	Protospacer
 *.**************.* ****** *****.

24. spacer 1.11|933623|33|NZ_CP022034|CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 6, identity: 0.818 

ggggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cgagatcgcgctggcggcctcatccg-tgccgca	Protospacer
 *.**************.* ****** *****.

25. spacer 1.11|933623|33|NZ_CP022034|CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818 

ggggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cgagatcgcgctggcggcctcatccg-tgccgca	Protospacer
 *.**************.* ****** *****.

26. spacer 1.4|933563|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

agccgttcccgttgaatacgccggcggttatc	CRISPR spacer
atccgttcccgttgaatacgtcagcgttctac	Protospacer
* ******************.*.*** *.  *

27. spacer 1.4|933563|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781 

agccgttcccgttgaatacgccggcggttatc	CRISPR spacer
atccgttcccgttgaatacgtcagcgttctac	Protospacer
* ******************.*.*** *.  *

28. spacer 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 7, identity: 0.781 

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gggatcgcggtggcggtcgc-ttcgaggaagtt	Protospacer
********* ********** *.**  *  **

29. spacer 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 7, identity: 0.781 

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cggctcgcgctggcggtcgcttcc-tcggcgcg	Protospacer
 ** **************** *** *.* **.

30. spacer 1.11|933623|33|NZ_CP022034|CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 7, identity: 0.788 

ggggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
tcagatcgcgctggcggcctcatccg-tgccgca	Protospacer
  .**************.* ****** *****.

31. spacer 2.22|942192|32|NZ_CP022034|CRISPRCasFinder,CRT matches to NC_048066 (Vibrio phage 1.202.O._10N.222.45.E8, partial genome) position: , mismatch: 7, identity: 0.781 

gtacgttgccagattgctttcaatgatggcgt	CRISPR spacer
ttctacagccaaattgctttcaatgatggcgt	Protospacer
 * ... ****.********************

32. spacer 1.5|933624|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75 

gggatcgcgctggcggtcgcatccgttgccgt	CRISPR spacer
cggctcgcgctcgcggtcgcatcctcggcccg	Protospacer
 ** ******* ************ . ***

33. spacer 1.10|933562|33|NZ_CP022034|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758 

gagccgttcccgttgaatacgccggcggttatc	CRISPR spacer
aatccgttcccgttgaatacgtcagcgttctac	Protospacer
.* ******************.*.*** *.  *

34. spacer 1.10|933562|33|NZ_CP022034|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.758 

gagccgttcccgttgaatacgccggcggttatc	CRISPR spacer
aatccgttcccgttgaatacgtcagcgttctac	Protospacer
.* ******************.*.*** *.  *

35. spacer 2.9|942190|34|NZ_CP022034|PILER-CR matches to NC_048066 (Vibrio phage 1.202.O._10N.222.45.E8, partial genome) position: , mismatch: 8, identity: 0.765 

cggtacgttgccagattgctttcaatgatggcgt	CRISPR spacer
agttctacagccaaattgctttcaatgatggcgt	Protospacer
 * * ... ****.********************

36. spacer 2.14|941704|32|NZ_CP022034|CRISPRCasFinder,CRT matches to NZ_CP025961 (Rhodococcus qingshengii strain djl-6-2 plasmid pDJL2, complete sequence) position: , mismatch: 8, identity: 0.75 

cccgcaatctgcgggcgttctc-gtcaatttac	CRISPR spacer
cctgcaatctgcgggcgatctcggcccatacg-	Protospacer
**.************** **** *.* ** ..

37. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MT080601 (UNVERIFIED: Staphylococcus phage vB_SauM_EW72, complete genome) position: , mismatch: 8, identity: 0.75 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
taccattattgtctattctatcaatagttaaa	Protospacer
 * ** . .********.*** **********

38. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MT080585 (UNVERIFIED: Staphylococcus phage vB_SauM_EW18, complete genome) position: , mismatch: 8, identity: 0.75 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
taccattattgtctattctatcaatagttaaa	Protospacer
 * ** . .********.*** **********

39. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MT080591 (UNVERIFIED: Staphylococcus phage vB_SauM_EW29, complete genome) position: , mismatch: 8, identity: 0.75 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
taccattattgtctattctatcaatagttaaa	Protospacer
 * ** . .********.*** **********

40. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MT080589 (UNVERIFIED: Staphylococcus phage vB_SauM_EW26, complete genome) position: , mismatch: 8, identity: 0.75 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
taccattattgtctattctatcaatagttaaa	Protospacer
 * ** . .********.*** **********

41. spacer 3.1|2449155|33|NZ_CP022034|CRISPRCasFinder matches to NC_017414 (Borreliella burgdorferi N40 plasmid N40_lp36, complete sequence) position: , mismatch: 8, identity: 0.758 

cgctttttattggtatcaaataaaatgcaaatc	CRISPR spacer
ctggttttattggtttcaaattaaatgcaacaa	Protospacer
*   ********** ****** ********

42. spacer 1.4|933563|32|NZ_CP022034|PILER-CR,CRISPRCasFinder matches to MN994500 (Phage NBSal001, complete genome) position: , mismatch: 9, identity: 0.719 

agccgttcccgttgaatacgccggcggttatc	CRISPR spacer
aggcgttcgcgttgaatacgccgttgatatgg	Protospacer
** ***** ************** .*.*

43. spacer 2.4|941885|34|NZ_CP022034|PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.735 

cgcgtatttttgaactggccagcgccaccgatgc	CRISPR spacer
cgaatttttttgaactggccgtcgccaccgcaat	Protospacer
** .* **************. ********  ..

44. spacer 2.16|941826|32|NZ_CP022034|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ctcggacggagtgttaacaccgttaatgatta	CRISPR spacer
gcccgggggagcgttaacgccgttaatgatcg	Protospacer
 .* *. ****.******.***********..

45. spacer 2.17|941887|32|NZ_CP022034|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719 

cgtatttttgaactggccagcgccaccgatgc	CRISPR spacer
aatttttttgaactggccgtcgccaccgcaat	Protospacer
 .* **************. ********  ..

46. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MN693066 (Marine virus AFVG_25M551, complete genome) position: , mismatch: 9, identity: 0.719 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
aaacaactctgtcgtttttatgaagtgggcgt	Protospacer
*************  *********  *   .

47. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MN693345 (Marine virus AFVG_25M552, complete genome) position: , mismatch: 9, identity: 0.719 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
aaacaactctgtcgtttttatgaagtgggcgt	Protospacer
*************  *********  *   .

48. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MN693995 (Marine virus AFVG_250M873, complete genome) position: , mismatch: 9, identity: 0.719 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
cttcaactttgtctgttttatgaatacctact	Protospacer
   *****.*****.*********** .**

49. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MN693610 (Marine virus AFVG_250M347, complete genome) position: , mismatch: 9, identity: 0.719 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
cttcaactttgtctgttttatgaatacctact	Protospacer
   *****.*****.*********** .**

50. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MN693983 (Marine virus AFVG_250M348, complete genome) position: , mismatch: 9, identity: 0.719 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
cttcaactttgtctgttttatgaatacctact	Protospacer
   *****.*****.*********** .**

51. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MN694535 (Marine virus AFVG_250M1087, complete genome) position: , mismatch: 9, identity: 0.719 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
cttcaactttgtctgttttatgaatacctact	Protospacer
   *****.*****.*********** .**

52. spacer 2.19|942009|32|NZ_CP022034|CRISPRCasFinder,CRT matches to MN694384 (Marine virus AFVG_250M349, complete genome) position: , mismatch: 9, identity: 0.719 

aaacaactctgtctattttatgaatagttaaa	CRISPR spacer
cttcaactttgtctgttttatgaatacctact	Protospacer
   *****.*****.*********** .**

53. spacer 2.22|942192|32|NZ_CP022034|CRISPRCasFinder,CRT matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 9, identity: 0.719 

gtacgttgccagattgctttcaatgatggcgt	CRISPR spacer
ttgtgttaccagattgctttcaataatcaccg	Protospacer
 *..***.****************.** .*

54. spacer 2.6|942007|34|NZ_CP022034|PILER-CR matches to MN693066 (Marine virus AFVG_25M551, complete genome) position: , mismatch: 11, identity: 0.676 

cgaaacaactctgtctattttatgaatagttaaa	CRISPR spacer
gcaaacaactctgtcgtttttatgaagtgggcgt	Protospacer
  *************  *********  *   .

55. spacer 2.6|942007|34|NZ_CP022034|PILER-CR matches to MN693345 (Marine virus AFVG_25M552, complete genome) position: , mismatch: 11, identity: 0.676 

cgaaacaactctgtctattttatgaatagttaaa	CRISPR spacer
gcaaacaactctgtcgtttttatgaagtgggcgt	Protospacer
  *************  *********  *   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1105516 : 1114498 9 Enterobacteria_phage(83.33%) integrase attL 1104061:1104075|attR 1117920:1117934
DBSCAN-SWA_2 1171347 : 1227440 67 Salmonella_phage(33.96%) terminase,tail,coat,integrase,holin,tRNA attL 1166414:1166429|attR 1213065:1213080
DBSCAN-SWA_3 1681983 : 1691154 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 1851206 : 1858443 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_5 1961071 : 2006715 64 Salmonella_phage(16.33%) tail,integrase,head,lysis attL 1959003:1959017|attR 1965854:1965868
DBSCAN-SWA_6 2011181 : 2017121 7 Salmonella_phage(66.67%) tail NA
DBSCAN-SWA_7 2189835 : 2196497 9 Salmonella_phage(33.33%) NA NA
DBSCAN-SWA_8 2408529 : 2447184 48 Shigella_phage(60.0%) protease,terminase,transposase,plate,tail,integrase,head attL 2408934:2408949|attR 2422107:2422122
DBSCAN-SWA_9 2709902 : 2718183 9 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_10 2929606 : 3038745 107 Vibrio_phage(21.67%) protease,terminase,transposase,plate,tail,portal,integrase,lysis,holin,capsid,tRNA attL 2984493:2984512|attR 3041726:3041745
DBSCAN-SWA_11 3157414 : 3207920 59 Klebsiella_phage(23.08%) terminase,transposase,tail,portal,integrase,head,holin,capsid attL 3162159:3162173|attR 3207329:3207343
DBSCAN-SWA_12 4073846 : 4131803 50 Acinetobacter_phage(14.29%) protease,integrase,transposase,tRNA attL 4082949:4082966|attR 4102511:4102528
DBSCAN-SWA_13 4139452 : 4241427 115 Enterobacteria_phage(59.52%) protease,terminase,transposase,plate,tail,portal,integrase,head,lysis,holin,capsid attL 4150296:4150320|attR 4213107:4213131

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP022036
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 18731 21 Morganella_phage(25.0%) tRNA NA
DBSCAN-SWA_2 38397 : 39129 1 Macacine_betaherpesvirus(100.0%) integrase attL 38109:38130|attR 39220:39241
DBSCAN-SWA_3 43047 : 44133 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_4 49043 : 50084 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_5 70687 : 74287 5 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_6 77676 : 90216 5 Klebsiella_phage(33.33%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage