Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007007 Listeria monocytogenes serotype 1/2a str. 02-5993, complete genome 4 crisprs casR,cas3,DEDDh,DinG,WYL,csa3 3 11 7 3

Results visualization

1. NZ_CP007007
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007007_1 162147-162255 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007007_2 375779-375950 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007007_3 539209-539686 Orphan I-A
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007007_4 2785758-2785909 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP007007_3 3.1|539238|35|NZ_CP007007|PILER-CR,CRT 539238-539272 35 NZ_CP007007.1 1285752-1285786 0 1.0
NZ_CP007007_3 3.7|539623|35|NZ_CP007007|PILER-CR,CRT 539623-539657 35 NZ_CP007007.1 2451826-2451860 0 1.0
NZ_CP007007_3 3.6|539558|36|NZ_CP007007|PILER-CR,CRT 539558-539593 36 NZ_CP007007.1 1284604-1284639 1 0.972

1. spacer 3.1|539238|35|NZ_CP007007|PILER-CR,CRT matches to position: 1285752-1285786, mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

2. spacer 3.7|539623|35|NZ_CP007007|PILER-CR,CRT matches to position: 2451826-2451860, mismatch: 0, identity: 1.0

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc	Protospacer
***********************************

3. spacer 3.6|539558|36|NZ_CP007007|PILER-CR,CRT matches to position: 1284604-1284639, mismatch: 1, identity: 0.972

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa	Protospacer
****************.*******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007007_3 3.1|539238|35|NZ_CP007007|PILER-CR,CRT 539238-539272 35 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 214611-214645 0 1.0
NZ_CP007007_3 3.1|539238|35|NZ_CP007007|PILER-CR,CRT 539238-539272 35 MT500540 Listeria phage LP-HM00113468, complete genome 39834-39868 0 1.0
NZ_CP007007_3 3.1|539238|35|NZ_CP007007|PILER-CR,CRT 539238-539272 35 KJ094023 Listeria phage LP-101, complete genome 5084-5118 0 1.0
NZ_CP007007_3 3.6|539558|36|NZ_CP007007|PILER-CR,CRT 539558-539593 36 MT500540 Listeria phage LP-HM00113468, complete genome 683-718 0 1.0
NZ_CP007007_3 3.6|539558|36|NZ_CP007007|PILER-CR,CRT 539558-539593 36 NC_009812 Listeria phage B025, complete genome 3896-3931 0 1.0
NZ_CP007007_3 3.6|539558|36|NZ_CP007007|PILER-CR,CRT 539558-539593 36 KJ094023 Listeria phage LP-101, complete genome 3936-3971 0 1.0
NZ_CP007007_3 3.7|539623|35|NZ_CP007007|PILER-CR,CRT 539623-539657 35 DQ003642 Listeria phage A006, complete genome 15712-15746 0 1.0
NZ_CP007007_3 3.3|539367|35|NZ_CP007007|PILER-CR,CRT 539367-539401 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_CP007007_3 3.5|539494|35|NZ_CP007007|PILER-CR,CRT 539494-539528 35 NC_021539 Listeria phage LP-030-2, complete genome 18926-18960 1 0.971
NZ_CP007007_3 3.5|539494|35|NZ_CP007007|PILER-CR,CRT 539494-539528 35 KJ094023 Listeria phage LP-101, complete genome 22882-22916 1 0.971
NZ_CP007007_3 3.6|539558|36|NZ_CP007007|PILER-CR,CRT 539558-539593 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213498 1 0.972
NZ_CP007007_3 3.8|539238|36|NZ_CP007007|CRISPRCasFinder 539238-539273 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 214611-214646 1 0.972
NZ_CP007007_3 3.8|539238|36|NZ_CP007007|CRISPRCasFinder 539238-539273 36 MT500540 Listeria phage LP-HM00113468, complete genome 39833-39868 1 0.972
NZ_CP007007_3 3.8|539238|36|NZ_CP007007|CRISPRCasFinder 539238-539273 36 KJ094023 Listeria phage LP-101, complete genome 5084-5119 1 0.972
NZ_CP007007_3 3.10|539367|36|NZ_CP007007|CRISPRCasFinder 539367-539402 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10174 1 0.972
NZ_CP007007_3 3.12|539494|36|NZ_CP007007|CRISPRCasFinder 539494-539529 36 NC_021539 Listeria phage LP-030-2, complete genome 18926-18961 1 0.972
NZ_CP007007_3 3.12|539494|36|NZ_CP007007|CRISPRCasFinder 539494-539529 36 KJ094023 Listeria phage LP-101, complete genome 22882-22917 1 0.972
NZ_CP007007_3 3.13|539558|37|NZ_CP007007|CRISPRCasFinder 539558-539594 37 NC_009812 Listeria phage B025, complete genome 3896-3932 1 0.973
NZ_CP007007_3 3.13|539558|37|NZ_CP007007|CRISPRCasFinder 539558-539594 37 KJ094023 Listeria phage LP-101, complete genome 3936-3972 1 0.973
NZ_CP007007_3 3.13|539558|37|NZ_CP007007|CRISPRCasFinder 539558-539594 37 MT500540 Listeria phage LP-HM00113468, complete genome 682-718 1 0.973
NZ_CP007007_3 3.14|539623|36|NZ_CP007007|CRISPRCasFinder 539623-539658 36 DQ003642 Listeria phage A006, complete genome 15711-15746 1 0.972
NZ_CP007007_3 3.1|539238|35|NZ_CP007007|PILER-CR,CRT 539238-539272 35 NC_009812 Listeria phage B025, complete genome 5044-5078 2 0.943
NZ_CP007007_3 3.3|539367|35|NZ_CP007007|PILER-CR,CRT 539367-539401 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943
NZ_CP007007_3 3.5|539494|35|NZ_CP007007|PILER-CR,CRT 539494-539528 35 NC_009812 Listeria phage B025, complete genome 23381-23415 2 0.943
NZ_CP007007_3 3.10|539367|36|NZ_CP007007|CRISPRCasFinder 539367-539402 36 NC_009813 Listeria phage B054, complete genome 10139-10174 2 0.944
NZ_CP007007_3 3.12|539494|36|NZ_CP007007|CRISPRCasFinder 539494-539529 36 NC_009812 Listeria phage B025, complete genome 23381-23416 2 0.944
NZ_CP007007_3 3.13|539558|37|NZ_CP007007|CRISPRCasFinder 539558-539594 37 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213499 2 0.946
NZ_CP007007_3 3.8|539238|36|NZ_CP007007|CRISPRCasFinder 539238-539273 36 NC_009812 Listeria phage B025, complete genome 5044-5079 3 0.917
NZ_CP007007_2 2.1|375825|27|NZ_CP007007|PILER-CR 375825-375851 27 NZ_CP032875 Escherichia coli strain WCHEC000837 plasmid p1_000837, complete sequence 9411-9437 5 0.815
NZ_CP007007_2 2.1|375825|27|NZ_CP007007|PILER-CR 375825-375851 27 NZ_CP022228 Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence 50376-50402 5 0.815
NZ_CP007007_2 2.1|375825|27|NZ_CP007007|PILER-CR 375825-375851 27 NZ_CP032492 Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_91, complete sequence 43495-43521 5 0.815
NZ_CP007007_2 2.1|375825|27|NZ_CP007007|PILER-CR 375825-375851 27 NZ_CP028585 Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence 13071-13097 5 0.815
NZ_CP007007_3 3.6|539558|36|NZ_CP007007|PILER-CR,CRT 539558-539593 36 JN700520 Staphylococcus phage StB12, complete genome 6832-6867 5 0.861
NZ_CP007007_2 2.1|375825|27|NZ_CP007007|PILER-CR 375825-375851 27 MK356557 Salmonella sp. strain Sa1423 plasmid pSa1423-90k, complete sequence 31984-32010 6 0.778
NZ_CP007007_3 3.13|539558|37|NZ_CP007007|CRISPRCasFinder 539558-539594 37 JN700520 Staphylococcus phage StB12, complete genome 6832-6868 6 0.838
NZ_CP007007_3 3.6|539558|36|NZ_CP007007|PILER-CR,CRT 539558-539593 36 MW084976 Bacillus phage Kirov, complete genome 27565-27600 8 0.778
NZ_CP007007_3 3.13|539558|37|NZ_CP007007|CRISPRCasFinder 539558-539594 37 MW084976 Bacillus phage Kirov, complete genome 27565-27601 9 0.757
NZ_CP007007_3 3.7|539623|35|NZ_CP007007|PILER-CR,CRT 539623-539657 35 NZ_CP029455 Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence 130632-130666 11 0.686
NZ_CP007007_3 3.7|539623|35|NZ_CP007007|PILER-CR,CRT 539623-539657 35 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 17622-17656 11 0.686
NZ_CP007007_3 3.7|539623|35|NZ_CP007007|PILER-CR,CRT 539623-539657 35 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 31860-31894 11 0.686
NZ_CP007007_3 3.7|539623|35|NZ_CP007007|PILER-CR,CRT 539623-539657 35 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 338888-338922 11 0.686

1. spacer 3.1|539238|35|NZ_CP007007|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

2. spacer 3.1|539238|35|NZ_CP007007|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

3. spacer 3.1|539238|35|NZ_CP007007|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

4. spacer 3.6|539558|36|NZ_CP007007|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

5. spacer 3.6|539558|36|NZ_CP007007|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

6. spacer 3.6|539558|36|NZ_CP007007|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

7. spacer 3.7|539623|35|NZ_CP007007|PILER-CR,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc	Protospacer
***********************************

8. spacer 3.3|539367|35|NZ_CP007007|PILER-CR,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

9. spacer 3.5|539494|35|NZ_CP007007|PILER-CR,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

10. spacer 3.5|539494|35|NZ_CP007007|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

11. spacer 3.6|539558|36|NZ_CP007007|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa	Protospacer
****************.*******************

12. spacer 3.8|539238|36|NZ_CP007007|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

13. spacer 3.8|539238|36|NZ_CP007007|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

14. spacer 3.8|539238|36|NZ_CP007007|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

15. spacer 3.10|539367|36|NZ_CP007007|CRISPRCasFinder matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.972

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaag	Protospacer
*****************.******************

16. spacer 3.12|539494|36|NZ_CP007007|CRISPRCasFinder matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

17. spacer 3.12|539494|36|NZ_CP007007|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

18. spacer 3.13|539558|37|NZ_CP007007|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

19. spacer 3.13|539558|37|NZ_CP007007|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

20. spacer 3.13|539558|37|NZ_CP007007|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

21. spacer 3.14|539623|36|NZ_CP007007|CRISPRCasFinder matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.972

tttgttgaatcaacggatatagattttacaatttcg	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttct	Protospacer
*********************************** 

22. spacer 3.1|539238|35|NZ_CP007007|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
gcagaacaaactccggaagggtgattgtaaatggc	Protospacer
.**** *****************************

23. spacer 3.3|539367|35|NZ_CP007007|PILER-CR,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

24. spacer 3.5|539494|35|NZ_CP007007|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctat	Protospacer
*****************.* ***************

25. spacer 3.10|539367|36|NZ_CP007007|CRISPRCasFinder matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.944

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaag	Protospacer
*****************.**.***************

26. spacer 3.12|539494|36|NZ_CP007007|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.944

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctata	Protospacer
*****************.* ****************

27. spacer 3.13|539558|37|NZ_CP007007|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.946

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaaa	Protospacer
****************.*******************.

28. spacer 3.8|539238|36|NZ_CP007007|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 3, identity: 0.917

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
gcagaacaaactccggaagggtgattgtaaatggct	Protospacer
.**** ***************************** 

29. spacer 2.1|375825|27|NZ_CP007007|PILER-CR matches to NZ_CP032875 (Escherichia coli strain WCHEC000837 plasmid p1_000837, complete sequence) position: , mismatch: 5, identity: 0.815

tcagaacaaaccaaagtgcttaaattc	CRISPR spacer
gaagaacaaaccaaagttcttcaatcc	Protospacer
  *************** *** ***.*

30. spacer 2.1|375825|27|NZ_CP007007|PILER-CR matches to NZ_CP022228 (Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence) position: , mismatch: 5, identity: 0.815

tcagaacaaaccaaagtgcttaaattc	CRISPR spacer
gaagaacaaaccaaagttcttcaatcc	Protospacer
  *************** *** ***.*

31. spacer 2.1|375825|27|NZ_CP007007|PILER-CR matches to NZ_CP032492 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_91, complete sequence) position: , mismatch: 5, identity: 0.815

tcagaacaaaccaaagtgcttaaattc	CRISPR spacer
gaagaacaaaccaaagttcttcaatcc	Protospacer
  *************** *** ***.*

32. spacer 2.1|375825|27|NZ_CP007007|PILER-CR matches to NZ_CP028585 (Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence) position: , mismatch: 5, identity: 0.815

tcagaacaaaccaaagtgcttaaattc	CRISPR spacer
gaagaacaaaccaaagttcttcaatcc	Protospacer
  *************** *** ***.*

33. spacer 3.6|539558|36|NZ_CP007007|PILER-CR,CRT matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 5, identity: 0.861

aaaataggaggaaataaattatgact-atcaaattaa	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaacta-	Protospacer
 ************.***** ****** ******.** 

34. spacer 2.1|375825|27|NZ_CP007007|PILER-CR matches to MK356557 (Salmonella sp. strain Sa1423 plasmid pSa1423-90k, complete sequence) position: , mismatch: 6, identity: 0.778

tcagaacaaaccaaagtgcttaaattc	CRISPR spacer
gaagaacaaaccaaagttcttcaatca	Protospacer
  *************** *** ***. 

35. spacer 3.13|539558|37|NZ_CP007007|CRISPRCasFinder matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 6, identity: 0.838

aaaataggaggaaataaattatgact-atcaaattaag	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaactat-	Protospacer
 ************.***** ****** ******.**  

36. spacer 3.6|539558|36|NZ_CP007007|PILER-CR,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 8, identity: 0.778

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaa	Protospacer
  ***************** ***.*****. *  **

37. spacer 3.13|539558|37|NZ_CP007007|CRISPRCasFinder matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 9, identity: 0.757

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaaa	Protospacer
  ***************** ***.*****. *  **.

38. spacer 3.7|539623|35|NZ_CP007007|PILER-CR,CRT matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

39. spacer 3.7|539623|35|NZ_CP007007|PILER-CR,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
aagaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

40. spacer 3.7|539623|35|NZ_CP007007|PILER-CR,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

41. spacer 3.7|539623|35|NZ_CP007007|PILER-CR,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 98064 : 108096 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_2 1126761 : 1136314 9 Hokovirus(28.57%) NA NA
DBSCAN-SWA_3 1233094 : 1340177 116 Listeria_phage(68.85%) integrase,tRNA,tail,protease,terminase,portal,holin,capsid attL 1257728:1257749|attR 1302475:1302496
DBSCAN-SWA_4 1923214 : 1931500 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2444764 : 2483995 57 Listeria_phage(98.08%) tail,holin,terminase NA
DBSCAN-SWA_6 2626199 : 2634043 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_7 2868999 : 2875524 10 Streptococcus_pyogenes_phage(33.33%) tail NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP007007.1|WP_003723550.1|1311324_1311519_-|hypothetical-protein 1311324_1311519_- 64 aa aa NA NA NA 1233094-1340177 yes
NZ_CP007007.1|WP_012951967.1|2479656_2480364_+|hypothetical-protein 2479656_2480364_+ 235 aa aa NA NA NA 2444764-2483995 yes
NZ_CP007007.1|WP_003733687.1|2478190_2478385_-|hypothetical-protein 2478190_2478385_- 64 aa aa NA NA NA 2444764-2483995 yes