Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007198 Listeria monocytogenes serotype 1/2a str. 10-4758 chromosome, complete genome 2 crisprs DinG,cas3,WYL,casR,DEDDh,csa3 0 2 5 0

Results visualization

1. NZ_CP007198
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007198_1 528564-529178 Orphan I-A
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007198_2 2749720-2749830 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007198_1 1.4|528791|37|NZ_CP007198|PILER-CR,CRISPRCasFinder 528791-528827 37 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 218117-218153 1 0.973
NZ_CP007198_1 1.8|529053|34|NZ_CP007198|PILER-CR,CRISPRCasFinder 529053-529086 34 NZ_CP032628 Lactococcus sp. 1JSPR-7 plasmid unnamed1, complete sequence 36527-36560 11 0.676

1. spacer 1.4|528791|37|NZ_CP007198|PILER-CR,CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.973

agcgcaacaggtgccatatacaaactgcctttttttc	CRISPR spacer
agcgcaacaggggccatatacaaactgcctttttttc	Protospacer
*********** *************************

2. spacer 1.8|529053|34|NZ_CP007198|PILER-CR,CRISPRCasFinder matches to NZ_CP032628 (Lactococcus sp. 1JSPR-7 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

gttggtaggtttaaccaaagatgatcaccatgtc	CRISPR spacer
cttagtacgtttaaccaaagatgatgatggaaag	Protospacer
 **.*** ***************** *. . .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 126222 : 132747 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_2 1105392 : 1114350 9 Hokovirus(28.57%) NA NA
DBSCAN-SWA_3 1199974 : 1302078 113 Listeria_phage(76.12%) portal,holin,integrase,tRNA,protease,capsid,tail,terminase attL 1206414:1206431|attR 1269423:1269440
DBSCAN-SWA_4 1837544 : 1845830 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2505514 : 2513358 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage