Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP008837 Listeria monocytogenes serotype 1/2a str. 10-5024, complete genome 3 crisprs casR,cas3,DEDDh,DinG,WYL,csa3 3 10 7 3

Results visualization

1. NZ_CP008837
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008837_1 162147-162255 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008837_2 539210-539687 Orphan I-A
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008837_3 2785760-2785911 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP008837_2 2.1|539239|35|NZ_CP008837|PILER-CR,CRT 539239-539273 35 NZ_CP008837.1 1285754-1285788 0 1.0
NZ_CP008837_2 2.7|539624|35|NZ_CP008837|PILER-CR,CRT 539624-539658 35 NZ_CP008837.1 2451828-2451862 0 1.0
NZ_CP008837_2 2.6|539559|36|NZ_CP008837|PILER-CR,CRT 539559-539594 36 NZ_CP008837.1 1284606-1284641 1 0.972

1. spacer 2.1|539239|35|NZ_CP008837|PILER-CR,CRT matches to position: 1285754-1285788, mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

2. spacer 2.7|539624|35|NZ_CP008837|PILER-CR,CRT matches to position: 2451828-2451862, mismatch: 0, identity: 1.0

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc	Protospacer
***********************************

3. spacer 2.6|539559|36|NZ_CP008837|PILER-CR,CRT matches to position: 1284606-1284641, mismatch: 1, identity: 0.972

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa	Protospacer
****************.*******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP008837_2 2.1|539239|35|NZ_CP008837|PILER-CR,CRT 539239-539273 35 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 214611-214645 0 1.0
NZ_CP008837_2 2.1|539239|35|NZ_CP008837|PILER-CR,CRT 539239-539273 35 MT500540 Listeria phage LP-HM00113468, complete genome 39834-39868 0 1.0
NZ_CP008837_2 2.1|539239|35|NZ_CP008837|PILER-CR,CRT 539239-539273 35 KJ094023 Listeria phage LP-101, complete genome 5084-5118 0 1.0
NZ_CP008837_2 2.6|539559|36|NZ_CP008837|PILER-CR,CRT 539559-539594 36 MT500540 Listeria phage LP-HM00113468, complete genome 683-718 0 1.0
NZ_CP008837_2 2.6|539559|36|NZ_CP008837|PILER-CR,CRT 539559-539594 36 NC_009812 Listeria phage B025, complete genome 3896-3931 0 1.0
NZ_CP008837_2 2.6|539559|36|NZ_CP008837|PILER-CR,CRT 539559-539594 36 KJ094023 Listeria phage LP-101, complete genome 3936-3971 0 1.0
NZ_CP008837_2 2.7|539624|35|NZ_CP008837|PILER-CR,CRT 539624-539658 35 DQ003642 Listeria phage A006, complete genome 15712-15746 0 1.0
NZ_CP008837_2 2.3|539368|35|NZ_CP008837|PILER-CR,CRT 539368-539402 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_CP008837_2 2.5|539495|35|NZ_CP008837|PILER-CR,CRT 539495-539529 35 NC_021539 Listeria phage LP-030-2, complete genome 18926-18960 1 0.971
NZ_CP008837_2 2.5|539495|35|NZ_CP008837|PILER-CR,CRT 539495-539529 35 KJ094023 Listeria phage LP-101, complete genome 22882-22916 1 0.971
NZ_CP008837_2 2.6|539559|36|NZ_CP008837|PILER-CR,CRT 539559-539594 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213498 1 0.972
NZ_CP008837_2 2.8|539239|36|NZ_CP008837|CRISPRCasFinder 539239-539274 36 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 214611-214646 1 0.972
NZ_CP008837_2 2.8|539239|36|NZ_CP008837|CRISPRCasFinder 539239-539274 36 MT500540 Listeria phage LP-HM00113468, complete genome 39833-39868 1 0.972
NZ_CP008837_2 2.8|539239|36|NZ_CP008837|CRISPRCasFinder 539239-539274 36 KJ094023 Listeria phage LP-101, complete genome 5084-5119 1 0.972
NZ_CP008837_2 2.10|539368|36|NZ_CP008837|CRISPRCasFinder 539368-539403 36 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10174 1 0.972
NZ_CP008837_2 2.12|539495|36|NZ_CP008837|CRISPRCasFinder 539495-539530 36 NC_021539 Listeria phage LP-030-2, complete genome 18926-18961 1 0.972
NZ_CP008837_2 2.12|539495|36|NZ_CP008837|CRISPRCasFinder 539495-539530 36 KJ094023 Listeria phage LP-101, complete genome 22882-22917 1 0.972
NZ_CP008837_2 2.13|539559|37|NZ_CP008837|CRISPRCasFinder 539559-539595 37 NC_009812 Listeria phage B025, complete genome 3896-3932 1 0.973
NZ_CP008837_2 2.13|539559|37|NZ_CP008837|CRISPRCasFinder 539559-539595 37 KJ094023 Listeria phage LP-101, complete genome 3936-3972 1 0.973
NZ_CP008837_2 2.13|539559|37|NZ_CP008837|CRISPRCasFinder 539559-539595 37 MT500540 Listeria phage LP-HM00113468, complete genome 682-718 1 0.973
NZ_CP008837_2 2.14|539624|36|NZ_CP008837|CRISPRCasFinder 539624-539659 36 DQ003642 Listeria phage A006, complete genome 15711-15746 1 0.972
NZ_CP008837_2 2.1|539239|35|NZ_CP008837|PILER-CR,CRT 539239-539273 35 NC_009812 Listeria phage B025, complete genome 5044-5078 2 0.943
NZ_CP008837_2 2.3|539368|35|NZ_CP008837|PILER-CR,CRT 539368-539402 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943
NZ_CP008837_2 2.5|539495|35|NZ_CP008837|PILER-CR,CRT 539495-539529 35 NC_009812 Listeria phage B025, complete genome 23381-23415 2 0.943
NZ_CP008837_2 2.10|539368|36|NZ_CP008837|CRISPRCasFinder 539368-539403 36 NC_009813 Listeria phage B054, complete genome 10139-10174 2 0.944
NZ_CP008837_2 2.12|539495|36|NZ_CP008837|CRISPRCasFinder 539495-539530 36 NC_009812 Listeria phage B025, complete genome 23381-23416 2 0.944
NZ_CP008837_2 2.13|539559|37|NZ_CP008837|CRISPRCasFinder 539559-539595 37 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 213463-213499 2 0.946
NZ_CP008837_2 2.8|539239|36|NZ_CP008837|CRISPRCasFinder 539239-539274 36 NC_009812 Listeria phage B025, complete genome 5044-5079 3 0.917
NZ_CP008837_2 2.6|539559|36|NZ_CP008837|PILER-CR,CRT 539559-539594 36 JN700520 Staphylococcus phage StB12, complete genome 6832-6867 5 0.861
NZ_CP008837_2 2.13|539559|37|NZ_CP008837|CRISPRCasFinder 539559-539595 37 JN700520 Staphylococcus phage StB12, complete genome 6832-6868 6 0.838
NZ_CP008837_2 2.6|539559|36|NZ_CP008837|PILER-CR,CRT 539559-539594 36 MW084976 Bacillus phage Kirov, complete genome 27565-27600 8 0.778
NZ_CP008837_2 2.13|539559|37|NZ_CP008837|CRISPRCasFinder 539559-539595 37 MW084976 Bacillus phage Kirov, complete genome 27565-27601 9 0.757
NZ_CP008837_2 2.7|539624|35|NZ_CP008837|PILER-CR,CRT 539624-539658 35 NZ_CP029455 Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence 130632-130666 11 0.686
NZ_CP008837_2 2.7|539624|35|NZ_CP008837|PILER-CR,CRT 539624-539658 35 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 17622-17656 11 0.686
NZ_CP008837_2 2.7|539624|35|NZ_CP008837|PILER-CR,CRT 539624-539658 35 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 31860-31894 11 0.686
NZ_CP008837_2 2.7|539624|35|NZ_CP008837|PILER-CR,CRT 539624-539658 35 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 338888-338922 11 0.686

1. spacer 2.1|539239|35|NZ_CP008837|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

2. spacer 2.1|539239|35|NZ_CP008837|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

3. spacer 2.1|539239|35|NZ_CP008837|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggc	Protospacer
***********************************

4. spacer 2.6|539559|36|NZ_CP008837|PILER-CR,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

5. spacer 2.6|539559|36|NZ_CP008837|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

6. spacer 2.6|539559|36|NZ_CP008837|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa	Protospacer
************************************

7. spacer 2.7|539624|35|NZ_CP008837|PILER-CR,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc	Protospacer
***********************************

8. spacer 2.3|539368|35|NZ_CP008837|PILER-CR,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

9. spacer 2.5|539495|35|NZ_CP008837|PILER-CR,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

10. spacer 2.5|539495|35|NZ_CP008837|PILER-CR,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.971

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat	Protospacer
******************* ***************

11. spacer 2.6|539559|36|NZ_CP008837|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa	Protospacer
****************.*******************

12. spacer 2.8|539239|36|NZ_CP008837|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

13. spacer 2.8|539239|36|NZ_CP008837|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

14. spacer 2.8|539239|36|NZ_CP008837|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
acagatcaaactccggaagggtgattgtaaatggct	Protospacer
*********************************** 

15. spacer 2.10|539368|36|NZ_CP008837|CRISPRCasFinder matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.972

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaag	Protospacer
*****************.******************

16. spacer 2.12|539495|36|NZ_CP008837|CRISPRCasFinder matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

17. spacer 2.12|539495|36|NZ_CP008837|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.972

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctata	Protospacer
******************* ****************

18. spacer 2.13|539559|37|NZ_CP008837|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

19. spacer 2.13|539559|37|NZ_CP008837|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

20. spacer 2.13|539559|37|NZ_CP008837|CRISPRCasFinder matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.973

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaaa	Protospacer
************************************.

21. spacer 2.14|539624|36|NZ_CP008837|CRISPRCasFinder matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.972

tttgttgaatcaacggatatagattttacaatttcg	CRISPR spacer
tttgttgaatcaacggatatagattttacaatttct	Protospacer
*********************************** 

22. spacer 2.1|539239|35|NZ_CP008837|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

acagatcaaactccggaagggtgattgtaaatggc	CRISPR spacer
gcagaacaaactccggaagggtgattgtaaatggc	Protospacer
.**** *****************************

23. spacer 2.3|539368|35|NZ_CP008837|PILER-CR,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

24. spacer 2.5|539495|35|NZ_CP008837|PILER-CR,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943

ctaaaacatccttcactgtatcaactcctttctat	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctat	Protospacer
*****************.* ***************

25. spacer 2.10|539368|36|NZ_CP008837|CRISPRCasFinder matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.944

gcgatttttgtcaaagggacagcgatgggttacaag	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaag	Protospacer
*****************.**.***************

26. spacer 2.12|539495|36|NZ_CP008837|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.944

ctaaaacatccttcactgtatcaactcctttctata	CRISPR spacer
ctaaaacatccttcactatctcaactcctttctata	Protospacer
*****************.* ****************

27. spacer 2.13|539559|37|NZ_CP008837|CRISPRCasFinder matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.946

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaaa	Protospacer
****************.*******************.

28. spacer 2.8|539239|36|NZ_CP008837|CRISPRCasFinder matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 3, identity: 0.917

acagatcaaactccggaagggtgattgtaaatggcg	CRISPR spacer
gcagaacaaactccggaagggtgattgtaaatggct	Protospacer
.**** ***************************** 

29. spacer 2.6|539559|36|NZ_CP008837|PILER-CR,CRT matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 5, identity: 0.861

aaaataggaggaaataaattatgact-atcaaattaa	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaacta-	Protospacer
 ************.***** ****** ******.** 

30. spacer 2.13|539559|37|NZ_CP008837|CRISPRCasFinder matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 6, identity: 0.838

aaaataggaggaaataaattatgact-atcaaattaag	CRISPR spacer
taaataggaggaagtaaataatgactaatcaaactat-	Protospacer
 ************.***** ****** ******.**  

31. spacer 2.6|539559|36|NZ_CP008837|PILER-CR,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 8, identity: 0.778

aaaataggaggaaataaattatgactatcaaattaa	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaa	Protospacer
  ***************** ***.*****. *  **

32. spacer 2.13|539559|37|NZ_CP008837|CRISPRCasFinder matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 9, identity: 0.757

aaaataggaggaaataaattatgactatcaaattaag	CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaaa	Protospacer
  ***************** ***.*****. *  **.

33. spacer 2.7|539624|35|NZ_CP008837|PILER-CR,CRT matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

34. spacer 2.7|539624|35|NZ_CP008837|PILER-CR,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
aagaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

35. spacer 2.7|539624|35|NZ_CP008837|PILER-CR,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

36. spacer 2.7|539624|35|NZ_CP008837|PILER-CR,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.686

tttgttgaatcaacggatatagattttacaatttc	CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt	Protospacer
   .  .******* ************* ***.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 98064 : 108096 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_2 1126763 : 1136316 9 Hokovirus(28.57%) NA NA
DBSCAN-SWA_3 1233096 : 1340179 116 Listeria_phage(68.85%) holin,integrase,capsid,tRNA,portal,tail,terminase,protease attL 1257730:1257751|attR 1302477:1302498
DBSCAN-SWA_4 1923216 : 1931502 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2444766 : 2483997 57 Listeria_phage(98.08%) terminase,holin,tail NA
DBSCAN-SWA_6 2626201 : 2634045 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_7 2869001 : 2875526 10 Streptococcus_pyogenes_phage(33.33%) tail NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP008837.1|WP_003723550.1|1311326_1311521_-|hypothetical-protein 1311326_1311521_- 64 aa aa NA NA NA 1233096-1340179 yes
NZ_CP008837.1|WP_012951967.1|2479658_2480366_+|hypothetical-protein 2479658_2480366_+ 235 aa aa NA NA NA 2444766-2483997 yes
NZ_CP008837.1|WP_003733687.1|2478192_2478387_-|hypothetical-protein 2478192_2478387_- 64 aa aa NA NA NA 2444766-2483997 yes