Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022207 Francisella noatunensis subsp. noatunensis FSC772 chromosome, complete genome 2 crisprs cas3,csa3,cas2,cas1,cas4,DEDDh 0 1 3 0

Results visualization

1. NZ_CP022207
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022207_1 1048446-1048808 Unclear V-A
5 spacers
cas2,cas1,cas4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022207_2 1895652-1895761 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022207_1 1.2|1048548|30|NZ_CP022207|CRISPRCasFinder,CRT,PILER-CR 1048548-1048577 30 NZ_CP042327 Euhalothece natronophila Z-M001 plasmid pEu1, complete sequence 22997-23026 6 0.8
NZ_CP022207_1 1.2|1048548|30|NZ_CP022207|CRISPRCasFinder,CRT,PILER-CR 1048548-1048577 30 KY971610 Pseudomonas phage PspYZU05, complete genome 57129-57158 7 0.767

1. spacer 1.2|1048548|30|NZ_CP022207|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042327 (Euhalothece natronophila Z-M001 plasmid pEu1, complete sequence) position: , mismatch: 6, identity: 0.8

tcgcttgggaaagccattaccaaaaacaaa	CRISPR spacer
tgtctggggagagccattaccaaaaatgaa	Protospacer
*  ** ****.***************..**

2. spacer 1.2|1048548|30|NZ_CP022207|CRISPRCasFinder,CRT,PILER-CR matches to KY971610 (Pseudomonas phage PspYZU05, complete genome) position: , mismatch: 7, identity: 0.767

tcgcttgggaaagccattaccaaaaacaaa	CRISPR spacer
cagatttttaaagccattatcaaaaacaaa	Protospacer
. * **   **********.**********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 81350 : 92249 10 Staphylococcus_phage(25.0%) tRNA NA
DBSCAN-SWA_2 381052 : 390694 9 Enterococcus_phage(16.67%) NA NA
DBSCAN-SWA_3 1493618 : 1504054 10 Escherichia_phage(22.22%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage