Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021329 Raoultella ornithinolytica strain Ro24724 chromosome, complete genome 6 crisprs DEDDh,cas3,csa3,DinG,WYL 1 1 4 0
NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 0 crisprs csa3,WYL,RT 0 0 6 0

Results visualization

1. NZ_CP021329
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021329_1 553467-553556 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021329_2 763370-763592 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021329_3 1524759-1524903 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021329_4 2936533-2936678 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021329_5 5160891-5161008 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021329_6 5389084-5389207 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP021329.1 5389045-5389082 1 0.974

1. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to position: 5389045-5389082, mismatch: 1, identity: 0.974 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
agaaatcccccggtggcgctgcgcttaccggggctaca	Protospacer
** ***********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 376936-376973 4 0.895
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 47047-47084 5 0.868
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 208412-208449 5 0.868
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 734323-734360 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 734444-734481 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP026282 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence 172732-172769 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP042535 Citrobacter freundii strain E51 plasmid pE51_001, complete sequence 112014-112051 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 179829-179866 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP026058 Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence 283603-283640 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP029436 Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence 290565-290602 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP029431 Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence 411220-411257 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP018017 Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence 130826-130863 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP029442 Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence 382419-382456 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 CP045556 Citrobacter sp. S39 plasmid pS39-1, complete sequence 107065-107102 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 229939-229976 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP022152 Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence 64066-64103 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP019987 Citrobacter werkmanii strain BF-6 plasmid unnamed, complete sequence 124432-124469 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP030224 Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence 86487-86524 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP026213 Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence 51140-51177 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_MG387191 Citrobacter freundii strain 2262 plasmid pTEM-2262, complete sequence 109982-110019 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP048383 Citrobacter freundii strain 62 plasmid p6_A, complete sequence 127037-127074 6 0.842
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 263673-263710 7 0.816
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 42138-42175 7 0.816
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 734201-734238 8 0.789
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 396221-396258 8 0.789
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 368803-368840 8 0.789
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP019203 Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence 16043-16080 8 0.789
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_LN868945 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence 12925-12962 8 0.789
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 CP022016 Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence 156613-156650 8 0.789
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 289940-289977 9 0.763
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 263133-263170 9 0.763
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 422322-422359 9 0.763
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 NZ_KU254579 Escherichia coli strain YD786 plasmid pYD786-2, complete sequence 59868-59905 9 0.763
NZ_CP021329_6 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder 5389127-5389164 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 355127-355164 10 0.737

1. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.895 

agcaatc-ccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
-tcaatctccccggtggcgctgcgcttactggggctacg	Protospacer
  ***** *********************.********.

2. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.868 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
cgccgctccccggtggcgctgcgcttaccggggctaca	Protospacer
 ** ...*******************************

3. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 5, identity: 0.868 

agcaatc--ccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
--ccatcttccccggtggcgctacgcttaccggggctacc	Protospacer
  * ***  *************.****************

4. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.842 

agcaat-cccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
-tcaacgtccccggtggcgcttcgcttaccggggctacg	Protospacer
  ***. .************* ****************.

5. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.842 

agcaat-cccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
-tcaacgtccccggtggcgcttcgcttaccggggctacg	Protospacer
  ***. .************* ****************.

6. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP026282 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

7. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP042535 (Citrobacter freundii strain E51 plasmid pE51_001, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

8. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

9. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

10. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP029436 (Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

11. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP029431 (Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

12. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP018017 (Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

13. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP029442 (Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

14. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to CP045556 (Citrobacter sp. S39 plasmid pS39-1, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

15. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

16. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP022152 (Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

17. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP019987 (Citrobacter werkmanii strain BF-6 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

18. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP030224 (Salmonella enterica strain SA20083039 plasmid pSA20083039.1, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

19. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP026213 (Citrobacter sp. CFNIH10 plasmid pKPC-933d, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

20. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_MG387191 (Citrobacter freundii strain 2262 plasmid pTEM-2262, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

21. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP048383 (Citrobacter freundii strain 62 plasmid p6_A, complete sequence) position: , mismatch: 6, identity: 0.842 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aagcctcacccggtggcgctgcgcttaccggggcgaca	Protospacer
*.   ** ************************** ***

22. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 7, identity: 0.816 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
gcccattgcccggtggcgctgcgcttaccgggcctacg	Protospacer
. * **. ************************ ****.

23. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.816 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
gcagattgcccggtggcgctgcgcttaccgggcctaca	Protospacer
.  .**. ************************ *****

24. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.789 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
ttgacctccccggtggcgcttcgcttaccggggctacg	Protospacer
   * ..************* ****************.

25. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 8, identity: 0.789 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
gttttttgcccggtggcgctgcgcttaccgggcctaca	Protospacer
. .  *. ************************ *****

26. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 8, identity: 0.789 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aaactctccccggtgacgctacgcttaccggggctaca	Protospacer
*.   ..********.****.*****************

27. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 8, identity: 0.789 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
ccgggttgcccggtggcgctgcgcttaccgggcctaca	Protospacer
   ..*. ************************ *****

28. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.789 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
ccgggttgcccggtggcgctgcgcttaccgggcctaca	Protospacer
   ..*. ************************ *****

29. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to CP022016 (Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.789 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
gtgtgttgcccggtggcgctgcgcttaccgggcctaca	Protospacer
.   .*. ************************ *****

30. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 9, identity: 0.763 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
gacagaagcccggtggcgctgcgcttaccggccctacc	Protospacer
..**.   ***********************  ****

31. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 9, identity: 0.763 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
aaacaaagcccggtggcgcttcgcttaccgggcctacg	Protospacer
*.  *   ************ *********** ****.

32. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 9, identity: 0.763 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
taaaaaagcccggtggcgctacgcttaccgggcctacg	Protospacer
 . **   ************.*********** ****.

33. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to NZ_KU254579 (Escherichia coli strain YD786 plasmid pYD786-2, complete sequence) position: , mismatch: 9, identity: 0.763 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
ctgttctccccggtggagctgcgcttaccggggctacg	Protospacer
     ..********* ********************.

34. spacer 6.1|5389127|38|NZ_CP021329|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 10, identity: 0.737 

agcaatcccccggtggcgctgcgcttaccggggctaca	CRISPR spacer
gaattttgcccggtggcgctacgcttaccgggcctacg	Protospacer
..   *. ************.*********** ****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2025047 : 2078267 63 Erwinia_phage(30.43%) plate,terminase,portal,lysis,capsid,tail,tRNA,transposase,holin,integrase,head attL 2038946:2038994|attR 2071972:2072020
DBSCAN-SWA_2 2613218 : 2622846 10 Enterobacteria_phage(83.33%) NA NA
DBSCAN-SWA_3 3830791 : 3841940 10 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 4033624 : 4046795 11 Escherichia_phage(28.57%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021328
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12755 : 61830 52 Escherichia_phage(26.09%) transposase,protease,integrase attL 12724:12783|attR 18880:20076
DBSCAN-SWA_2 142494 : 154586 12 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_3 159161 : 185752 23 Enterobacteria_phage(20.0%) transposase,integrase attL 172361:172420|attR 189542:190361
DBSCAN-SWA_4 188844 : 223506 23 Escherichia_phage(53.33%) transposase,integrase attL 182451:182465|attR 227598:227612
DBSCAN-SWA_5 232452 : 246175 21 Salmonella_phage(53.85%) NA NA
DBSCAN-SWA_6 348491 : 404727 53 Escherichia_phage(25.0%) transposase,integrase attL 347626:347639|attR 399732:399748

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage