Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011837 Azotobacter chroococcum strain B3 plasmid pacX50dB3a sequence 0 crisprs NA 0 0 0 0
NZ_CP011836 Azotobacter chroococcum strain B3 plasmid pacX50fB3 sequence 0 crisprs c2c9_V-U4,PrimPol,cas14j 0 0 2 0
NZ_CP011835 Azotobacter chroococcum strain B3, complete genome 5 crisprs cas3,DEDDh,cas14j,RT,casR,csa3,DinG,cas2,cas6e,cas5,cas7,cse2gr11,cas8e,c2c9_V-U4,WYL 0 2 7 0
NZ_CP011838 Azotobacter chroococcum strain B3 plasmid pacx50dB3b sequence 0 crisprs DEDDh 0 0 0 0

Results visualization

1. NZ_CP011836
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 51584 : 160333 103 Pseudomonas_phage(12.0%) transposase,integrase attL 76441:76455|attR 141596:141612
DBSCAN-SWA_2 218460 : 256553 27 Escherichia_phage(33.33%) transposase,integrase attL 215487:215502|attR 224691:224706

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP011835
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011835_1 1012069-1012151 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011835_2 1050961-1051066 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011835_3 1774489-1774584 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011835_4 2740496-2740580 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011835_5 2751567-2751716 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_019410 Caulobacter phage CcrKarma, complete genome 7520-7552 6 0.818
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_019410 Caulobacter phage CcrKarma, complete genome 219094-219126 6 0.818
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_019407 Caulobacter phage CcrMagneto, complete genome 7528-7560 6 0.818
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_019407 Caulobacter phage CcrMagneto, complete genome 216511-216543 6 0.818
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 756198-756230 6 0.818
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 162139-162171 6 0.818
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 973615-973647 6 0.818
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 223869-223901 6 0.818
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 9527-9559 7 0.788
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 43604-43636 7 0.788
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 9527-9559 7 0.788
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 430130-430162 7 0.788
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 176273-176305 8 0.758
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 88169-88201 8 0.758
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 176010-176042 8 0.758
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1844350-1844382 8 0.758
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1844504-1844536 8 0.758
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1843993-1844025 8 0.758
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1843937-1843969 8 0.758
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 63251-63283 8 0.758
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NZ_CP017427 Methylobacterium sp. XJLW plasmid unnamed1, complete sequence 102507-102539 8 0.758
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NZ_CP011666 Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence 75024-75056 8 0.758
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 521427-521459 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 634308-634340 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 725537-725569 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 855298-855330 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 590539-590571 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 796208-796240 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP015743 Shinella sp. HZN7 plasmid pShin-07, complete sequence 57475-57507 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 1049003-1049035 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_021911 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence 602979-603011 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 526070-526102 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 391084-391116 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 591750-591782 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 394449-394481 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 524733-524765 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 767104-767136 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 325184-325216 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 888049-888081 9 0.727
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 587129-587161 9 0.727
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1184388-1184420 9 0.727
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 949038-949070 9 0.727
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1864810-1864842 9 0.727
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 959298-959330 9 0.727
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 2097969-2098001 9 0.727
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1026827-1026859 9 0.727
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 233281-233313 9 0.727
NZ_CP011835_5 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder 2751595-2751627 33 JN106175 Uncultured bacterium plasmid pAKD34, complete sequence 71976-72008 10 0.697
NZ_CP011835_5 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder 2751656-2751688 33 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 323789-323821 10 0.697

1. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 6, identity: 0.818 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cgtcgcggcgggcggcgagttcggccagggcgt	Protospacer
    ***** ********.**************

2. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 6, identity: 0.818 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cgtcgcggcgggcggcgagttcggccagggcgt	Protospacer
    ***** ********.**************

3. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 6, identity: 0.818 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cgtcgcggcgggcggcgagttcggccagggcgt	Protospacer
    ***** ********.**************

4. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 6, identity: 0.818 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cgtcgcggcgggcggcgagttcggccagggcgt	Protospacer
    ***** ********.**************

5. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.818 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccagccggccggccgcgaattcggccaggacca	Protospacer
 *** ******** ***************.*

6. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.818 

gcaggcggccggcggcgaattcggccagggcgt----	CRISPR spacer
gcaggcggccggcggcgacatcggc----gcgtagtg	Protospacer
******************  *****    ****

7. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.818 

gcaggcggccggcggcgaattcggc-cagggcgt	CRISPR spacer
gcaggcggccggcggcgatgtcggcgcgcagcg-	Protospacer
******************  ***** *. .***

8. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.818 

gcaggcggccggcggcgaattcggccagggcgt----	CRISPR spacer
gcaggcggccggcggcgacatcggc----gcgtagtg	Protospacer
******************  *****    ****

9. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 7, identity: 0.788 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ggtcgtagccggcggcgaagtcggccagggagt	Protospacer
*   *..************ ********** **

10. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccggtacgcccgcggcgagttcggccagggcgt	Protospacer
 *.*   *** *******.**************

11. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 7, identity: 0.788 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ggtcgtagccggcggcgaagtcggccagggagt	Protospacer
*   *..************ ********** **

12. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 7, identity: 0.788 

gcaggcggccggcggcgaattcggc-cagggcgt	CRISPR spacer
tcaggcggccggccgcgagttcggcatcgagcg-	Protospacer
 ************ ****.****** . *.***

13. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cttcgcggccggcggcgaattcgggccgggcac	Protospacer
 .  ******************** * ****..

14. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cttcgcggccggcggcgaattcgggccgggcac	Protospacer
 .  ******************** * ****..

15. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cttcgcggccggcggcgaattcgggccgggcac	Protospacer
 .  ******************** * ****..

16. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cttcgcggccggcggcgaattcgggccgggcac	Protospacer
 .  ******************** * ****..

17. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cttcgcggccggcggcgaattcgggccgggcac	Protospacer
 .  ******************** * ****..

18. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cttcgcggccggcggcgaattcgggccgggcac	Protospacer
 .  ******************** * ****..

19. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cttcgcggccggcggcgaattcgggccgggcac	Protospacer
 .  ******************** * ****..

20. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
tcaggcgcccggcggcgaaatcggcattgtcga	Protospacer
 ****** *********** *****   * **

21. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP017427 (Methylobacterium sp. XJLW plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
ggccgccatgccgggggcggaggccgacctgat	Protospacer
  ** *  ****** *.***************.

22. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 8, identity: 0.758 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
gcccttgcggccggcgacggaggccaggccgat	Protospacer
 ****.** ****************.. *.**.

23. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cgaggcggccggcggcgacttcggcaagaagcc	Protospacer
  **************** ****** **..  .

24. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

25. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

26. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

27. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

28. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

29. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP015743 (Shinella sp. HZN7 plasmid pShin-07, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
caaggcggcgcgcggcgaattcggccttgggcc	Protospacer
  *******  ***************  **  .

30. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

31. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

32. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

33. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
acaggcggccggcgccgaaatcggcatgaagct	Protospacer
.************* **** *****  *..  *

34. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

35. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

36. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

37. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

38. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

39. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
ccaggcggccggcgccgaaatcggcatgaagct	Protospacer
 ************* **** *****  *..  *

40. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.727 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
gctgatcctggcggcgacggtggccgacctgaa	Protospacer
 *.  . *** ********* ***********

41. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.727 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
gctgatcctggcggcgacggtggccgacctgaa	Protospacer
 *.  . *** ********* ***********

42. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
gctgatcctggcggcgacggtggccgacctgaa	Protospacer
 *.  . *** ********* ***********

43. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
gctgatcctggcggcgacggtggccgacctgaa	Protospacer
 *.  . *** ********* ***********

44. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
cttcccgctgccggcggcggaagccgaccagcg	Protospacer
...*.***********.****.******* *

45. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.727 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
cgacccgctgccggcgctggaggccgaccccgc	Protospacer
.  *.*********** .***********. .*

46. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
cgacccgctgccggcgctggaggccgaccccgc	Protospacer
.  *.*********** .***********. .*

47. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 9, identity: 0.727 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
ggcggccatgccgggggcggaggccgacctgat	Protospacer
  *  *  ****** *.***************.

48. spacer 5.1|2751595|33|NZ_CP011835|CRISPRCasFinder matches to JN106175 (Uncultured bacterium plasmid pAKD34, complete sequence) position: , mismatch: 10, identity: 0.697 

gcaggcggccggcggcgaattcggccagggcgt	CRISPR spacer
cgaggcggccggcggcgaggtcggccgcatccg	Protospacer
  ****************. ******. . *

49. spacer 5.2|2751656|33|NZ_CP011835|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.697 

tccctcgctgccggcgacggaggccgacctgac	CRISPR spacer
ccaggatctgccggcggcggaggccgccctgct	Protospacer
.*     *********.********* **** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1702600 : 1762608 78 Pseudomonas_phage(43.48%) capsid,protease,tail,portal,transposase,integrase,holin,terminase,tRNA,head attL 1702451:1702510|attR 1754262:1754376
DBSCAN-SWA_2 2352786 : 2364220 12 uncultured_Caudovirales_phage(66.67%) tRNA NA
DBSCAN-SWA_3 2640056 : 2650051 7 Enterobacter_phage(16.67%) transposase NA
DBSCAN-SWA_4 2711564 : 2773565 63 uncultured_Caudovirales_phage(27.27%) capsid,portal,transposase,holin,terminase,head NA
DBSCAN-SWA_5 2828724 : 2838202 9 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_6 3145698 : 3223863 88 uncultured_Caudovirales_phage(39.02%) capsid,protease,tail,portal,transposase,plate,holin,terminase,tRNA,head NA
DBSCAN-SWA_7 3782365 : 3791806 15 Pseudomonas_phage(25.0%) integrase attL 3771832:3771848|attR 3791894:3791910

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage