Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022412 Bacteroides caccae strain ATCC 43185 chromosome, complete genome 3 crisprs PrimPol,cas3,RT,PD-DExK,DEDDh,cas9 0 1 2 0

Results visualization

1. NZ_CP022412
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022412_1 1470871-1470976 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022412_2 1550700-1550800 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022412_3 4126978-4127052 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022412_3 3.1|4127001|29|NZ_CP022412|CRISPRCasFinder 4127001-4127029 29 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 922997-923025 7 0.759

1. spacer 3.1|4127001|29|NZ_CP022412|CRISPRCasFinder matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 7, identity: 0.759

aatgcttttatatcatttttctccgtata	CRISPR spacer
gatgctattatatcatttttctgatttaa	Protospacer
.***** ***************   *  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1134635 : 1142255 8 Ostreococcus_tauri_virus(16.67%) NA NA
DBSCAN-SWA_2 2710220 : 2718149 12 Riemerella_phage(33.33%) portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage