Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022436 Arthrobacter sp. YN chromosome, complete genome 3 crisprs csa3,cas3,DinG,WYL,DEDDh 1 0 2 0

Results visualization

1. NZ_CP022436
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022436_1 1787369-1787466 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022436_2 3608177-3608314 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022436_3 4168542-4168700 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP022436_2 2.1|3608218|56|NZ_CP022436|CRISPRCasFinder 3608218-3608273 56 NZ_CP022436.1 3608283-3608338 0 1.0

1. spacer 2.1|3608218|56|NZ_CP022436|CRISPRCasFinder matches to position: 3608283-3608338, mismatch: 0, identity: 1.0

gctctctcacatcccgcgcccttccagacccaccgtctctcacatcccgcgccctt	CRISPR spacer
gctctctcacatcccgcgcccttccagacccaccgtctctcacatcccgcgccctt	Protospacer
********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1108313 : 1115953 8 Human_herpesvirus(16.67%) NA NA
DBSCAN-SWA_2 3082246 : 3105526 36 Arthrobacter_phage(35.29%) terminase,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage