Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022440 Campylobacter jejuni strain 81-176_G1_B0 chromosome, complete genome 1 crisprs DEDDh,cas2,cas1 0 1 1 0

Results visualization

1. NZ_CP022440
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022440_1 1433741-1433842 Unclear NA
1 spacers
cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022440_1 1.1|1433777|30|NZ_CP022440|CRISPRCasFinder 1433777-1433806 30 MN530981 Campylobacter phage DA10, complete genome 34848-34877 2 0.933

1. spacer 1.1|1433777|30|NZ_CP022440|CRISPRCasFinder matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 2, identity: 0.933

tcgagcttggcggtattatggcaaattcag	CRISPR spacer
tcgagcttggcggaattatggcaaattctg	Protospacer
************* ************** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1344160 : 1351052 7 Tupanvirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage