Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018628 Lelliottia jeotgali strain PFL01 chromosome, complete genome 6 crisprs cas3,DEDDh,csa3,WYL,DinG 1 1 2 0

Results visualization

1. NZ_CP018628
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018628_1 285691-285833 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018628_2 460286-460367 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018628_3 1416086-1416359 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018628_4 2348529-2348606 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018628_5 2557833-2558017 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018628_6 3144481-3144617 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP018628_4 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder 2348555-2348580 26 NZ_CP018628.1 611227-611252 1 0.962
NZ_CP018628_4 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder 2348555-2348580 26 NZ_CP018628.1 611279-611304 1 0.962

1. spacer 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder matches to position: 611227-611252, mismatch: 1, identity: 0.962

acggtctttttgtcgggtggcggctg	CRISPR spacer
acggtctttttgccgggtggcggctg	Protospacer
************.*************

2. spacer 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder matches to position: 611279-611304, mismatch: 1, identity: 0.962

acggtctttttgtcgggtggcggctg	CRISPR spacer
acggtctttttgccgggtggcggctg	Protospacer
************.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018628_4 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder 2348555-2348580 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 324005-324030 4 0.846
NZ_CP018628_4 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder 2348555-2348580 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 533033-533058 4 0.846
NZ_CP018628_4 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder 2348555-2348580 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323576-323601 4 0.846
NZ_CP018628_4 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder 2348555-2348580 26 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447541-447566 4 0.846
NZ_CP018628_4 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder 2348555-2348580 26 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 316973-316998 4 0.846
NZ_CP018628_4 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder 2348555-2348580 26 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447701-447726 4 0.846
NZ_CP018628_4 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder 2348555-2348580 26 NZ_CP022370 Bosea sp. AS-1 plasmid unnamed1, complete sequence 36912-36937 5 0.808
NZ_CP018628_4 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder 2348555-2348580 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 80939-80964 6 0.769

1. spacer 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.846

acggtctttttgtcgggtggcggctg	CRISPR spacer
gccgtttttttgtcgggtggcggcta	Protospacer
.* **.*******************.

2. spacer 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.846

acggtctttttgtcgggtggcggctg	CRISPR spacer
gccgtttttttgtcgggtggcggcta	Protospacer
.* **.*******************.

3. spacer 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.846

-acggtctttttgtcgggtggcggctg	CRISPR spacer
tgccgt-tttttgtcgggtggcggcta	Protospacer
 .* ** *******************.

4. spacer 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 4, identity: 0.846

acggtctttttgtcgggtggcggctg	CRISPR spacer
gccgtttttttgtcgggtggcggcta	Protospacer
.* **.*******************.

5. spacer 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 4, identity: 0.846

-acggtctttttgtcgggtggcggctg	CRISPR spacer
tgccgt-tttttgtcgggtggcggcta	Protospacer
 .* ** *******************.

6. spacer 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 4, identity: 0.846

-acggtctttttgtcgggtggcggctg	CRISPR spacer
tgccgt-tttttgtcgggtggcggcta	Protospacer
 .* ** *******************.

7. spacer 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder matches to NZ_CP022370 (Bosea sp. AS-1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

acggtctttttgtcgggtggcggctg	CRISPR spacer
ccggtatttttgtcgcgtggcggcga	Protospacer
 **** ********* ******** .

8. spacer 4.1|2348555|26|NZ_CP018628|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.769

acggtctttttgtcgggtggcggctg	CRISPR spacer
ggaatatttttgtcgggtggcggcta	Protospacer
. ..* *******************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2359620 : 2391365 49 Enterobacteria_phage(23.68%) transposase,tail NA
DBSCAN-SWA_2 2764808 : 2819005 47 Pseudomonas_phage(16.67%) integrase,transposase,plate attL 2760740:2760754|attR 2768932:2768946
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage