Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023011 Enterococcus hirae strain FDAARGOS_234 chromosome, complete genome 4 crisprs cas3,cas9,cas1,cas2,csn2,cas14j,csa3,DinG,DEDDh 0 7 217 0

Results visualization

1. NZ_CP023011
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023011_1 223192-223319 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023011_2 614124-614264 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023011_3 939102-939520 TypeII II-A,II-B
5 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023011_4 2112971-2113205 Orphan II-A,II-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023011_4 4.4|2113072|30|NZ_CP023011|CRISPRCasFinder 2113072-2113101 30 NZ_LR135334 Enterococcus faecium isolate E7471 plasmid 4 48147-48176 0 1.0
NZ_CP023011_4 4.4|2113072|30|NZ_CP023011|CRISPRCasFinder 2113072-2113101 30 NZ_LR135205 Enterococcus faecium isolate E7171 plasmid 3 42408-42437 0 1.0
NZ_CP023011_4 4.6|2113080|28|NZ_CP023011|PILER-CR 2113080-2113107 28 NZ_LR135334 Enterococcus faecium isolate E7471 plasmid 4 48147-48174 0 1.0
NZ_CP023011_4 4.6|2113080|28|NZ_CP023011|PILER-CR 2113080-2113107 28 NZ_LR135205 Enterococcus faecium isolate E7171 plasmid 3 42408-42435 0 1.0
NZ_CP023011_3 3.1|939138|30|NZ_CP023011|PILER-CR,CRISPRCasFinder,CRT 939138-939167 30 MN582070 Myoviridae sp. ctThM1, complete genome 79022-79051 6 0.8
NZ_CP023011_3 3.4|939336|30|NZ_CP023011|CRISPRCasFinder,CRT 939336-939365 30 NZ_CP045723 Pantoea eucalypti strain LMG 24197 plasmid unnamed3, complete sequence 50282-50311 6 0.8
NZ_CP023011_4 4.2|2113074|38|NZ_CP023011|CRT 2113074-2113111 38 NZ_LR135334 Enterococcus faecium isolate E7471 plasmid 4 48137-48174 6 0.842
NZ_CP023011_4 4.2|2113074|38|NZ_CP023011|CRT 2113074-2113111 38 NZ_LR135205 Enterococcus faecium isolate E7171 plasmid 3 42398-42435 6 0.842
NZ_CP023011_4 4.5|2113138|30|NZ_CP023011|CRISPRCasFinder 2113138-2113167 30 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1547775-1547804 7 0.767
NZ_CP023011_3 3.1|939138|30|NZ_CP023011|PILER-CR,CRISPRCasFinder,CRT 939138-939167 30 JN638751 Bacillus phage G, complete genome 7294-7323 8 0.733
NZ_CP023011_3 3.2|939204|30|NZ_CP023011|PILER-CR,CRISPRCasFinder,CRT 939204-939233 30 MN530981 Campylobacter phage DA10, complete genome 23604-23633 8 0.733
NZ_CP023011_3 3.1|939138|30|NZ_CP023011|PILER-CR,CRISPRCasFinder,CRT 939138-939167 30 NC_021789 Cellulophaga phage phi19:3, complete genome 7479-7508 9 0.7

1. spacer 4.4|2113072|30|NZ_CP023011|CRISPRCasFinder matches to NZ_LR135334 (Enterococcus faecium isolate E7471 plasmid 4) position: , mismatch: 0, identity: 1.0

ctaccagaagtaccaaacattaagccactc	CRISPR spacer
ctaccagaagtaccaaacattaagccactc	Protospacer
******************************

2. spacer 4.4|2113072|30|NZ_CP023011|CRISPRCasFinder matches to NZ_LR135205 (Enterococcus faecium isolate E7171 plasmid 3) position: , mismatch: 0, identity: 1.0

ctaccagaagtaccaaacattaagccactc	CRISPR spacer
ctaccagaagtaccaaacattaagccactc	Protospacer
******************************

3. spacer 4.6|2113080|28|NZ_CP023011|PILER-CR matches to NZ_LR135334 (Enterococcus faecium isolate E7471 plasmid 4) position: , mismatch: 0, identity: 1.0

accagaagtaccaaacattaagccactc	CRISPR spacer
accagaagtaccaaacattaagccactc	Protospacer
****************************

4. spacer 4.6|2113080|28|NZ_CP023011|PILER-CR matches to NZ_LR135205 (Enterococcus faecium isolate E7171 plasmid 3) position: , mismatch: 0, identity: 1.0

accagaagtaccaaacattaagccactc	CRISPR spacer
accagaagtaccaaacattaagccactc	Protospacer
****************************

5. spacer 3.1|939138|30|NZ_CP023011|PILER-CR,CRISPRCasFinder,CRT matches to MN582070 (Myoviridae sp. ctThM1, complete genome) position: , mismatch: 6, identity: 0.8

ttttcatagttatttagcattgcattatct	CRISPR spacer
ttttcatcgttatttagaattgcttgcttt	Protospacer
******* ********* ***** *  *.*

6. spacer 3.4|939336|30|NZ_CP023011|CRISPRCasFinder,CRT matches to NZ_CP045723 (Pantoea eucalypti strain LMG 24197 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8

cggaatctcgcgttttgaactgctagtttt	CRISPR spacer
aaaattctcgcgttttgaacttctactttt	Protospacer
 ..* **************** *** ****

7. spacer 4.2|2113074|38|NZ_CP023011|CRT matches to NZ_LR135334 (Enterococcus faecium isolate E7471 plasmid 4) position: , mismatch: 6, identity: 0.842

accagaagtaccaaacattaagccactcgttttggaag	CRISPR spacer
accagaagtaccaaacattaagccactcggtgttagaa	Protospacer
***************************** * * ..*.

8. spacer 4.2|2113074|38|NZ_CP023011|CRT matches to NZ_LR135205 (Enterococcus faecium isolate E7171 plasmid 3) position: , mismatch: 6, identity: 0.842

accagaagtaccaaacattaagccactcgttttggaag	CRISPR spacer
accagaagtaccaaacattaagccactcggtgttagaa	Protospacer
***************************** * * ..*.

9. spacer 4.5|2113138|30|NZ_CP023011|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.767

taaatgagagcaacggcaatttccatttga	CRISPR spacer
taattgagaggaacggcaatttcagatcgt	Protospacer
*** ****** ************ . *.* 

10. spacer 3.1|939138|30|NZ_CP023011|PILER-CR,CRISPRCasFinder,CRT matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 8, identity: 0.733

ttttcatagttatttagcattgcattatct	CRISPR spacer
gaaagatatttatttagcattgtattatca	Protospacer
     *** *************.****** 

11. spacer 3.2|939204|30|NZ_CP023011|PILER-CR,CRISPRCasFinder,CRT matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 8, identity: 0.733

taatgccgatttgattttacttcctttata	CRISPR spacer
aattatttttttcattttacttcctttata	Protospacer
 * *...  *** *****************

12. spacer 3.1|939138|30|NZ_CP023011|PILER-CR,CRISPRCasFinder,CRT matches to NC_021789 (Cellulophaga phage phi19:3, complete genome) position: , mismatch: 9, identity: 0.7

ttttcatagttatttagcattgcattatct	CRISPR spacer
aacaagtagttatttagcaatgcactatcc	Protospacer
  .  .************* ****.****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4820 3 Anguillid_herpesvirus(50.0%) NA NA
DBSCAN-SWA_2 12565 : 13642 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_3 16968 : 18136 2 Lactobacillus_virus(50.0%) NA NA
DBSCAN-SWA_4 37344 : 38229 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_5 42275 : 52761 7 Planktothrix_phage(40.0%) transposase NA
DBSCAN-SWA_6 70882 : 71293 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_7 87422 : 96199 9 Lactococcus_phage(40.0%) integrase attL 83660:83673|attR 96469:96482
DBSCAN-SWA_8 100014 : 100371 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_9 105231 : 106875 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_10 111631 : 118303 6 Powai_lake_megavirus(25.0%) NA NA
DBSCAN-SWA_11 130281 : 132192 1 Bradyrhizobium_phage(100.0%) NA NA
DBSCAN-SWA_12 147844 : 151458 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_13 159390 : 161700 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_14 167387 : 169337 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_15 173155 : 181096 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_16 188201 : 189395 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_17 193592 : 197146 3 Enterococcus_phage(66.67%) NA NA
DBSCAN-SWA_18 213832 : 217997 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_19 235812 : 240645 3 Pneumococcus_phage(50.0%) NA NA
DBSCAN-SWA_20 253941 : 255105 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_21 259761 : 261150 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_22 273531 : 273873 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_23 294592 : 298025 4 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_24 304957 : 307162 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_25 325916 : 333873 6 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_26 338602 : 342777 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_27 351629 : 357066 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_28 365087 : 366344 1 Pectobacterium_phage(100.0%) tRNA NA
DBSCAN-SWA_29 395130 : 405247 12 Streptococcus_phage(40.0%) integrase attL 385902:385951|attR 401880:401929
DBSCAN-SWA_30 414593 : 415739 1 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_31 436586 : 446500 4 Lonomia_obliqua_multiple_nucleopolyhedrovirus(33.33%) tRNA NA
DBSCAN-SWA_32 458305 : 461807 4 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_33 468064 : 469438 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_34 478512 : 480474 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_35 483949 : 484513 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_36 490263 : 494618 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_37 500775 : 503934 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_38 507977 : 512753 2 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_39 518882 : 519862 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_40 522875 : 523610 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_41 531866 : 534518 3 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_42 548235 : 548922 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_43 552923 : 554873 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_44 574740 : 576425 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_45 599872 : 608678 9 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_46 612236 : 617974 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_47 623828 : 625394 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_48 630218 : 631385 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_49 641786 : 649341 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_50 654364 : 662785 7 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_51 675346 : 686279 10 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_52 693385 : 699760 4 Enterobacteria_phage(33.33%) protease NA
DBSCAN-SWA_53 730169 : 740963 6 Pithovirus(33.33%) NA NA
DBSCAN-SWA_54 745199 : 745667 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_55 757060 : 765133 7 Amsacta_moorei_entomopoxvirus(25.0%) NA NA
DBSCAN-SWA_56 770990 : 775352 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_57 782528 : 785308 3 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_58 790446 : 791859 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_59 796003 : 798554 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_60 802090 : 803131 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_61 809074 : 809881 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_62 815011 : 820285 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_63 825580 : 834739 8 Abalone_herpesvirus(25.0%) tRNA NA
DBSCAN-SWA_64 838806 : 840369 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_65 854072 : 861936 6 Cafeteria_roenbergensis_virus(25.0%) protease,tRNA NA
DBSCAN-SWA_66 870621 : 871815 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_67 876006 : 879491 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_68 888426 : 896082 5 Staphylococcus_phage(75.0%) tRNA NA
DBSCAN-SWA_69 928189 : 929323 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_70 947707 : 950251 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_71 955751 : 957065 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_72 976243 : 979371 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_73 997229 : 1003651 5 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_74 1007692 : 1008919 1 Acidithiobacillus_phage(100.0%) NA NA
DBSCAN-SWA_75 1047007 : 1047349 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_76 1061479 : 1062217 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_77 1078750 : 1080046 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_78 1084091 : 1086305 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_79 1090157 : 1096943 4 Orpheovirus(66.67%) tRNA NA
DBSCAN-SWA_80 1103630 : 1106825 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_81 1124244 : 1124991 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_82 1129788 : 1130388 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_83 1142729 : 1150724 9 Hokovirus(33.33%) lysis NA
DBSCAN-SWA_84 1153870 : 1161315 7 Cafeteria_roenbergensis_virus(33.33%) NA NA
DBSCAN-SWA_85 1179463 : 1185431 4 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_86 1192609 : 1199593 5 Planktothrix_phage(20.0%) tRNA NA
DBSCAN-SWA_87 1203230 : 1206561 4 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_88 1213496 : 1214606 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_89 1219125 : 1222609 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_90 1230586 : 1232222 2 Apis_mellifera_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_91 1236790 : 1237660 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_92 1256228 : 1256675 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_93 1264573 : 1267114 3 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_94 1276784 : 1278113 1 Phaeocystis_globosa_virus(100.0%) NA NA
DBSCAN-SWA_95 1283178 : 1283709 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_96 1293340 : 1305220 9 Bacillus_phage(40.0%) tRNA NA
DBSCAN-SWA_97 1310285 : 1321188 9 Agrobacterium_phage(25.0%) tRNA NA
DBSCAN-SWA_98 1340506 : 1348342 10 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_99 1358644 : 1362174 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_100 1376092 : 1376764 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_101 1380740 : 1393686 10 Tupanvirus(20.0%) NA NA
DBSCAN-SWA_102 1406227 : 1407598 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_103 1424797 : 1426096 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_104 1433515 : 1436386 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_105 1448477 : 1452754 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_106 1460611 : 1461298 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_107 1467110 : 1468691 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_108 1476028 : 1476967 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_109 1489364 : 1496265 5 Bodo_saltans_virus(33.33%) NA NA
DBSCAN-SWA_110 1500944 : 1508489 9 Bacillus_virus(25.0%) NA NA
DBSCAN-SWA_111 1518480 : 1526843 8 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_112 1532575 : 1533868 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_113 1538768 : 1545178 5 Lactococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_114 1548607 : 1550668 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_115 1554029 : 1558479 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_116 1564640 : 1569640 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_117 1573700 : 1575693 3 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_118 1590800 : 1592234 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_119 1596190 : 1598221 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_120 1601445 : 1602132 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_121 1626814 : 1676953 56 Enterococcus_phage(30.43%) integrase,portal,tRNA,capsid,terminase,tail attL 1635891:1635912|attR 1682366:1682387
DBSCAN-SWA_122 1687094 : 1689586 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_123 1693351 : 1701835 8 Oenococcus_phage(40.0%) NA NA
DBSCAN-SWA_124 1711039 : 1717419 7 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_125 1721106 : 1725827 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_126 1730916 : 1732608 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_127 1737120 : 1753822 13 Flavobacterium_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_128 1756912 : 1757698 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_129 1773086 : 1774604 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_130 1784898 : 1785960 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_131 1793600 : 1804672 7 Chrysochromulina_ericina_virus(40.0%) integrase attL 1781895:1781912|attR 1799568:1799585
DBSCAN-SWA_132 1808561 : 1816628 6 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_133 1828530 : 1835841 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_134 1839165 : 1840416 1 Bacillus_virus(100.0%) protease NA
DBSCAN-SWA_135 1852887 : 1857172 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_136 1860494 : 1863241 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_137 1869904 : 1873428 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_138 1880866 : 1882579 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_139 1897966 : 1899331 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_140 1910979 : 1911711 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_141 1918458 : 1922010 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_142 1925360 : 1926287 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_143 1933013 : 1940475 5 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_144 1953210 : 1957618 6 Listeria_phage(33.33%) NA NA
DBSCAN-SWA_145 1963495 : 1964389 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_146 1980056 : 1980803 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_147 1998112 : 1999651 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_148 2003537 : 2004515 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_149 2009500 : 2011027 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_150 2023024 : 2024191 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_151 2034643 : 2036539 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_152 2040732 : 2049325 9 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_153 2059366 : 2064625 4 Staphylococcus_phage(33.33%) transposase NA
DBSCAN-SWA_154 2074278 : 2074968 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_155 2091047 : 2096717 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_156 2099841 : 2101551 1 Micromonas_pusilla_virus(100.0%) NA NA
DBSCAN-SWA_157 2106306 : 2107029 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_158 2119800 : 2124404 4 Halovirus(33.33%) NA NA
DBSCAN-SWA_159 2131232 : 2131439 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_160 2136266 : 2141184 3 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_161 2145531 : 2147897 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_162 2152348 : 2152996 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_163 2156076 : 2156778 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_164 2161513 : 2170657 8 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_165 2181719 : 2182478 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_166 2187774 : 2189124 1 Cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_167 2201123 : 2203622 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_168 2213096 : 2213834 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_169 2217583 : 2223050 3 Orpheovirus(50.0%) tRNA NA
DBSCAN-SWA_170 2226987 : 2228454 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_171 2240155 : 2240773 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_172 2248679 : 2253137 4 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_173 2256419 : 2259165 2 Geobacillus_phage(50.0%) NA NA
DBSCAN-SWA_174 2262360 : 2262852 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_175 2270525 : 2272277 1 Acanthamoeba_polyphaga_lentillevirus(100.0%) NA NA
DBSCAN-SWA_176 2287000 : 2288407 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_177 2294170 : 2295148 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_178 2298315 : 2310522 12 Prochlorococcus_phage(37.5%) NA NA
DBSCAN-SWA_179 2316546 : 2317164 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_180 2323733 : 2326337 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_181 2339343 : 2339961 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_182 2348390 : 2349356 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_183 2378953 : 2385946 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_184 2389370 : 2397781 7 Erwinia_phage(25.0%) protease,tRNA NA
DBSCAN-SWA_185 2405427 : 2409869 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_186 2415791 : 2418415 3 unidentified_phage(50.0%) tRNA NA
DBSCAN-SWA_187 2423856 : 2428142 4 Streptococcus_phage(33.33%) integrase attL 2417028:2417042|attR 2429396:2429410
DBSCAN-SWA_188 2435911 : 2437303 1 Acanthamoeba_polyphaga_lentillevirus(100.0%) NA NA
DBSCAN-SWA_189 2445218 : 2447819 4 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_190 2452247 : 2459457 5 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_191 2463097 : 2467747 4 Aureococcus_anophage(33.33%) NA NA
DBSCAN-SWA_192 2475835 : 2482479 3 Lonomia_obliqua_multiple_nucleopolyhedrovirus(50.0%) NA NA
DBSCAN-SWA_193 2525185 : 2526181 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_194 2544211 : 2548003 3 Ectocarpus_siliculosus_virus(33.33%) NA NA
DBSCAN-SWA_195 2553716 : 2560702 4 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_196 2566645 : 2570999 3 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_197 2581651 : 2582374 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_198 2595115 : 2595853 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_199 2603885 : 2612379 7 Hokovirus(25.0%) protease NA
DBSCAN-SWA_200 2623748 : 2628586 4 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_201 2639129 : 2640062 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_202 2649947 : 2650892 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_203 2656142 : 2663985 6 uncultured_marine_virus(33.33%) NA NA
DBSCAN-SWA_204 2669351 : 2670572 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_205 2675181 : 2678715 4 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_206 2695642 : 2696932 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_207 2700155 : 2704697 2 Cyanophage(50.0%) tRNA NA
DBSCAN-SWA_208 2725937 : 2728124 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_209 2741739 : 2743359 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_210 2753509 : 2776434 16 Tupanvirus(22.22%) NA NA
DBSCAN-SWA_211 2781660 : 2786736 6 Mycoplasma_phage(66.67%) NA NA
DBSCAN-SWA_212 2790228 : 2791740 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_213 2796343 : 2797821 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_214 2801593 : 2802274 1 Elephant_endotheliotropic_herpesvirus(100.0%) NA NA
DBSCAN-SWA_215 2808362 : 2809121 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_216 2822581 : 2825549 2 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_217 2840203 : 2841277 1 Planktothrix_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage