Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023149 Mycobacterium intracellulare strain FLAC0181 chromosome, complete genome 7 crisprs DEDDh,cas3,csa3,DinG,cas4,WYL,RT 2 4 3 0
NZ_CP023150 Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP023149
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023149_1 27125-27210 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023149_2 354365-354445 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023149_3 1541082-1541164 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023149_4 1599031-1599107 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023149_5 3161033-3161107 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023149_6 4044330-4044418 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023149_7 5158117-5158244 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023149_2 2.1|354389|33|NZ_CP023149|CRISPRCasFinder 354389-354421 33 NZ_CP023149.1 354332-354364 0 1.0
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NZ_CP023149.1 506477-506503 2 0.926

1. spacer 2.1|354389|33|NZ_CP023149|CRISPRCasFinder matches to position: 354332-354364, mismatch: 0, identity: 1.0 

gatccgatgggtgccgacccgcttcgcccggct	CRISPR spacer
gatccgatgggtgccgacccgcttcgcccggct	Protospacer
*********************************

2. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to position: 506477-506503, mismatch: 2, identity: 0.926 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
cgccgcgacgatgcagagcgtagcgat	Protospacer
**.*****************.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 45022-45048 4 0.852
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NZ_CP018865 Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence 129-155 4 0.852
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NZ_CP018865 Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence 226960-226986 4 0.852
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NC_019202 Pseudomonas aeruginosa plasmid pKLC102, complete sequence 59209-59235 5 0.815
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 815866-815892 5 0.815
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NC_016138 Pseudomonas aeruginosa plasmid pUM505, complete sequence 39611-39637 5 0.815
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1335242-1335268 5 0.815
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 651550-651576 5 0.815
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 332446-332472 5 0.815
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1916973-1916999 5 0.815
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 831030-831056 5 0.815
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 MN175604 Gordonia phage PhorbesPhlower, complete genome 9916-9942 5 0.815
NZ_CP023149_4 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder 1599056-1599082 27 NC_031267 Gordonia phage Lucky10, complete genome 9951-9977 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 1438511-1438537 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP025081 Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence 68200-68226 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP031258 Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence 186331-186357 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052163 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence 82806-82832 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP030924 Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence 177734-177760 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP037743 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence 68189-68215 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 137083-137109 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 246902-246928 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026733 Shigella boydii strain ATCC 8700 plasmid unnamed2, complete sequence 31107-31133 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP033961 Klebsiella pneumoniae strain L482 plasmid p2_L382, complete sequence 39819-39845 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026833 Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence 11852-11878 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026833 Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence 152974-153000 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026833 Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence 196007-196033 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026833 Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence 200891-200917 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026833 Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence 203012-203038 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052432 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence 67135-67161 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 55150-55176 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026763 Shigella boydii strain NCTC 9850 plasmid unnamed 92371-92397 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026763 Shigella boydii strain NCTC 9850 plasmid unnamed 126964-126990 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026763 Shigella boydii strain NCTC 9850 plasmid unnamed 131934-131960 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347226 Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence 71989-72015 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347227 Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence 72271-72297 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347228 Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence 71961-71987 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347229 Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence 71617-71643 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 71153-71179 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347231 Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence 70759-70785 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347232 Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence 72121-72147 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347232 Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence 169554-169580 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347233 Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence 71211-71237 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347234 Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence 70977-71003 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347235 Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence 71437-71463 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347236 Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence 72281-72307 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347237 Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence 71151-71177 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 72005-72031 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 169099-169125 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP034776 Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence 105594-105620 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 125182-125208 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP014009 Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence 176650-176676 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026796 Shigella boydii strain ATCC BAA-1247 plasmid unnamed 26655-26681 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026796 Shigella boydii strain ATCC BAA-1247 plasmid unnamed 145706-145732 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026796 Shigella boydii strain ATCC BAA-1247 plasmid unnamed 181174-181200 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026796 Shigella boydii strain ATCC BAA-1247 plasmid unnamed 186143-186169 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052232 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence 64947-64973 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP040546 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence 90933-90959 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 76082-76108 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 86010-86036 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052563 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence 67123-67149 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 95770-95796 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 47950-47976 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP029779 Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence 1131-1157 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026841 Shigella dysenteriae strain ATCC 9753 plasmid unnamed, complete sequence 126781-126807 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 31376-31402 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 2842-2868 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP034416 Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence 67329-67355 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 66503-66529 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 199548-199574 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 54536-54562 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP040540 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence 71918-71944 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 62623-62649 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026166 Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence 59468-59494 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 149246-149272 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP052037 Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence 96572-96598 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP041512 Shigella boydii strain KCCM 41690 plasmid unnamed, complete sequence 3531-3557 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP041512 Shigella boydii strain KCCM 41690 plasmid unnamed, complete sequence 8500-8526 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP041512 Shigella boydii strain KCCM 41690 plasmid unnamed, complete sequence 77386-77412 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP023135 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence 189049-189075 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 252638-252664 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052178 Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence 102303-102329 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 196333-196359 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 217399-217425 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 54074-54100 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP018338 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence 91244-91270 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 164404-164430 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP034083 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence 67131-67157 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026012 Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence 157439-157465 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 197857-197883 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 245900-245926 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 180025-180051 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 291511-291537 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 60083-60109 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 101943-101969 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054064 Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence 52064-52090 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052495 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence 67128-67154 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026835 Shigella dysenteriae strain ATCC 49347 plasmid unnamed, complete sequence 40776-40802 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026835 Shigella dysenteriae strain ATCC 49347 plasmid unnamed, complete sequence 6727-6753 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 189572-189598 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 189084-189110 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 239046-239072 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 80678-80704 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 67329-67355 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_MF398271 Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence 62418-62444 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP016815 Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence 47649-47675 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP035203 Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence 127744-127770 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MT090958 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence 56584-56610 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP040534 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-VIR, complete sequence 71898-71924 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 180318-180344 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 220606-220632 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP026798 Shigella boydii strain NCTC 9353 plasmid unnamed, complete sequence 11716-11742 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP026798 Shigella boydii strain NCTC 9353 plasmid unnamed, complete sequence 69506-69532 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP026798 Shigella boydii strain NCTC 9353 plasmid unnamed, complete sequence 118428-118454 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP026798 Shigella boydii strain NCTC 9353 plasmid unnamed, complete sequence 119760-119786 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052159 Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence 96029-96055 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026732 Shigella boydii strain ATCC 8700 plasmid unnamed1 35341-35367 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 108224-108250 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026767 Shigella boydii strain 59-248 plasmid unnamed 115077-115103 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026767 Shigella boydii strain 59-248 plasmid unnamed 187640-187666 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026813 Shigella boydii strain 83-578 plasmid unnamed, complete sequence 47941-47967 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026813 Shigella boydii strain 83-578 plasmid unnamed, complete sequence 52910-52936 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026813 Shigella boydii strain 83-578 plasmid unnamed, complete sequence 88953-88979 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026813 Shigella boydii strain 83-578 plasmid unnamed, complete sequence 121059-121085 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MN200128 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence 142004-142030 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 141987-142013 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 90082-90108 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026806 Shigella dysenteriae strain 2017C-4522 plasmid unnamed, complete sequence 22293-22319 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026812 Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence 522-548 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026812 Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence 6707-6733 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026812 Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence 66540-66566 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 78160-78186 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052144 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence 95253-95279 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP019049 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence 47006-47032 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP024708 Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence 119561-119587 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052357 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence 96029-96055 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_LR134257 Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence 221623-221649 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052445 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence 85279-85305 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 56364-56390 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NC_005249 Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence 145368-145394 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP041374 Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence 78160-78186 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 116112-116138 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP036191 Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence 57416-57442 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP034934 Shigella dysenteriae strain 79-8006 plasmid p79-8006, complete sequence 54810-54836 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP034934 Shigella dysenteriae strain 79-8006 plasmid p79-8006, complete sequence 61479-61505 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NC_006625 Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence 66688-66714 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 41228-41254 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 249075-249101 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 29945-29971 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 61783-61809 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP035906 Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence 208880-208906 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 79012-79038 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NC_007608 Shigella boydii Sb227 plasmid pSB4_227, complete sequence 6483-6509 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NC_007608 Shigella boydii Sb227 plasmid pSB4_227, complete sequence 81885-81911 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052190 Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence 95253-95279 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP047678 Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence 66664-66690 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP042546 Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence 124359-124385 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP047676 Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence 66664-66690 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052304 Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence 96580-96606 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052204 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence 95253-95279 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP034124 Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence 78160-78186 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054751 Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence 73863-73889 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054781 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence 73866-73892 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP050281 Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence 20999-21025 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP042975 Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence 143274-143300 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054763 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence 73871-73897 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 97148-97174 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_AP019549 Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence 140966-140992 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054745 Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence 73865-73891 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054727 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence 73863-73889 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054739 Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence 73869-73895 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054775 Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence 73866-73892 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054733 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence 73864-73890 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054721 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence 73865-73891 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054757 Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence 73861-73887 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP054769 Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence 73869-73895 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 CP052259 Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence 95707-95733 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NC_010660 Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence 540-566 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NC_010660 Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence 5506-5532 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NC_010660 Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence 45872-45898 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NC_010660 Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence 162533-162559 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 134729-134755 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP026587 Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence 41104-41130 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_LR745046 Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166 86651-86677 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_LR745043 Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154 105322-105348 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_MK715436 Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence 170418-170444 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 130655-130681 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_MH255828 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence 100635-100661 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 131742-131768 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_MG053312 Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence 46703-46729 5 0.815
NZ_CP023149_5 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder 3161057-3161083 27 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 245924-245950 5 0.815
NZ_CP023149_2 2.1|354389|33|NZ_CP023149|CRISPRCasFinder 354389-354421 33 NZ_CP011667 Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence 96870-96902 7 0.788
NZ_CP023149_1 1.1|27151|34|NZ_CP023149|CRISPRCasFinder 27151-27184 34 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 555402-555435 8 0.765
NZ_CP023149_1 1.1|27151|34|NZ_CP023149|CRISPRCasFinder 27151-27184 34 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 549521-549554 8 0.765
NZ_CP023149_1 1.1|27151|34|NZ_CP023149|CRISPRCasFinder 27151-27184 34 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 187854-187887 9 0.735
NZ_CP023149_1 1.1|27151|34|NZ_CP023149|CRISPRCasFinder 27151-27184 34 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 283810-283843 9 0.735
NZ_CP023149_1 1.1|27151|34|NZ_CP023149|CRISPRCasFinder 27151-27184 34 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 52186-52219 9 0.735
NZ_CP023149_1 1.1|27151|34|NZ_CP023149|CRISPRCasFinder 27151-27184 34 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 570738-570771 9 0.735
NZ_CP023149_1 1.1|27151|34|NZ_CP023149|CRISPRCasFinder 27151-27184 34 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1389609-1389642 9 0.735
NZ_CP023149_1 1.1|27151|34|NZ_CP023149|CRISPRCasFinder 27151-27184 34 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 143016-143049 9 0.735
NZ_CP023149_1 1.1|27151|34|NZ_CP023149|CRISPRCasFinder 27151-27184 34 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 279122-279155 9 0.735
NZ_CP023149_1 1.1|27151|34|NZ_CP023149|CRISPRCasFinder 27151-27184 34 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1561646-1561679 9 0.735

1. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 4, identity: 0.852 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
ccccggaacgatgcagagcgcagcgat	Protospacer
* .** .********************

2. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 4, identity: 0.852 

-cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
acggt-cgacgaagcagagcgcagcgat	Protospacer
 ** . ****** ***************

3. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 4, identity: 0.852 

-cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
acggt-cgacgaagcagagcgcagcgat	Protospacer
 ** . ****** ***************

4. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NC_019202 (Pseudomonas aeruginosa plasmid pKLC102, complete sequence) position: , mismatch: 5, identity: 0.815 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
cggcgcgacgatgcagagcgcggccgc	Protospacer
** ******************.** ..

5. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 5, identity: 0.815 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
ggtcgggacgatgccgagcgcagcgca	Protospacer
 **** ******** **********

6. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NC_016138 (Pseudomonas aeruginosa plasmid pUM505, complete sequence) position: , mismatch: 5, identity: 0.815 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
cggcgcgacgatgcagagcgcggccgc	Protospacer
** ******************.** ..

7. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
agccgcgacgaggcagtgcgcagcgac	Protospacer
 *.******** **** *********.

8. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 5, identity: 0.815 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
tgccgcgatgatgccgagcgcagcgac	Protospacer
.*.*****.***** ***********.

9. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 5, identity: 0.815 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
ggccgcgacgatgccgatcgcagcgag	Protospacer
 *.*********** ** ********

10. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
agccgcgacgaggcagtgcgcagcgac	Protospacer
 *.******** **** *********.

11. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
cttcgcgccgatgcggagcgcagcgcc	Protospacer
* ***** ******.********** .

12. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to MN175604 (Gordonia phage PhorbesPhlower, complete genome) position: , mismatch: 5, identity: 0.815 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
cctcgcgacggtgcagaccgcagcggg	Protospacer
* ********.****** *******.

13. spacer 4.1|1599056|27|NZ_CP023149|CRISPRCasFinder matches to NC_031267 (Gordonia phage Lucky10, complete genome) position: , mismatch: 5, identity: 0.815 

cgtcgcgacgatgcagagcgcagcgat	CRISPR spacer
cctcgcgacggtgcagaccgcagcggg	Protospacer
* ********.****** *******.

14. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
aagccgcagcgcggttcctccgcatcc	Protospacer
. **** ***** *************

15. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

16. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

17. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

18. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

19. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

20. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

21. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

22. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026733 (Shigella boydii strain ATCC 8700 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

23. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP033961 (Klebsiella pneumoniae strain L482 plasmid p2_L382, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

24. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026833 (Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

25. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026833 (Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

26. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026833 (Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

27. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026833 (Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

28. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026833 (Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

29. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

30. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

31. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026763 (Shigella boydii strain NCTC 9850 plasmid unnamed) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

32. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026763 (Shigella boydii strain NCTC 9850 plasmid unnamed) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

33. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026763 (Shigella boydii strain NCTC 9850 plasmid unnamed) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

34. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

35. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

36. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

37. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

38. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

39. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

40. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

41. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

42. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

43. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

44. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

45. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

46. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

47. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

48. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

49. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

50. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

51. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

52. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026796 (Shigella boydii strain ATCC BAA-1247 plasmid unnamed) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

53. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026796 (Shigella boydii strain ATCC BAA-1247 plasmid unnamed) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

54. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026796 (Shigella boydii strain ATCC BAA-1247 plasmid unnamed) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

55. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026796 (Shigella boydii strain ATCC BAA-1247 plasmid unnamed) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

56. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

57. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

58. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

59. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

60. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

61. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

62. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

63. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP029779 (Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

64. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026841 (Shigella dysenteriae strain ATCC 9753 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

65. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

66. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

67. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

68. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

69. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

70. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

71. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

72. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

73. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

74. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

75. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

76. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP041512 (Shigella boydii strain KCCM 41690 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

77. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP041512 (Shigella boydii strain KCCM 41690 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

78. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP041512 (Shigella boydii strain KCCM 41690 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

79. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

80. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

81. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

82. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

83. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

84. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

85. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

86. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

87. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

88. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

89. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

90. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

91. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

92. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

93. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

94. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

95. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

96. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052495 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

97. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026835 (Shigella dysenteriae strain ATCC 49347 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

98. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026835 (Shigella dysenteriae strain ATCC 49347 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

99. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

100. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

101. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

102. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

103. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

104. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_MF398271 (Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

105. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

106. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

107. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

108. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP040534 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-VIR, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

109. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

110. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

111. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP026798 (Shigella boydii strain NCTC 9353 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

112. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP026798 (Shigella boydii strain NCTC 9353 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

113. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP026798 (Shigella boydii strain NCTC 9353 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

114. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP026798 (Shigella boydii strain NCTC 9353 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

115. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

116. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026732 (Shigella boydii strain ATCC 8700 plasmid unnamed1) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

117. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

118. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026767 (Shigella boydii strain 59-248 plasmid unnamed) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

119. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026767 (Shigella boydii strain 59-248 plasmid unnamed) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

120. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026813 (Shigella boydii strain 83-578 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

121. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026813 (Shigella boydii strain 83-578 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

122. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026813 (Shigella boydii strain 83-578 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

123. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026813 (Shigella boydii strain 83-578 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

124. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

125. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

126. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

127. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026806 (Shigella dysenteriae strain 2017C-4522 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

128. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026812 (Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

129. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026812 (Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

130. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026812 (Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

131. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

132. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

133. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

134. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

135. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

136. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

137. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052445 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

138. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

139. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

140. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP041374 (Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

141. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

142. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP036191 (Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

143. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP034934 (Shigella dysenteriae strain 79-8006 plasmid p79-8006, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

144. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP034934 (Shigella dysenteriae strain 79-8006 plasmid p79-8006, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

145. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

146. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

147. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

148. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

149. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

150. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP035906 (Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

151. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

152. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NC_007608 (Shigella boydii Sb227 plasmid pSB4_227, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

153. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NC_007608 (Shigella boydii Sb227 plasmid pSB4_227, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

154. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

155. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

156. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

157. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

158. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

159. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

160. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

161. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054751 (Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

162. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054781 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

163. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

164. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

165. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

166. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

167. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

168. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054745 (Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

169. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054727 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

170. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054739 (Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

171. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054775 (Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

172. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054733 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

173. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054721 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

174. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054757 (Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

175. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP054769 (Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

176. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to CP052259 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

177. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NC_010660 (Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

178. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NC_010660 (Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

179. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NC_010660 (Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

180. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NC_010660 (Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ttgccgaagcggcgttccaccgcaccc	Protospacer
 ********** ****** *****.*

181. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

182. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

183. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

184. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

185. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_MK715436 (Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

186. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

187. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

188. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

189. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

190. spacer 5.1|3161057|27|NZ_CP023149|CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gtgccgaagcgccgttcctccgcatcg	CRISPR spacer
ctgccgaagcgtcgttccaccgcaccc	Protospacer
 **********.****** *****.*

191. spacer 2.1|354389|33|NZ_CP023149|CRISPRCasFinder matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 7, identity: 0.788 

gatccgatgggtgccgacccgcttcgcccggct	CRISPR spacer
gctgccgcgggtgctgacccgcttcccccggct	Protospacer
* * * ..******.********** *******

192. spacer 1.1|27151|34|NZ_CP023149|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.765 

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
gaactggtgcaggtagcccggctgcggcgacaca	Protospacer
* .***** * ******************.   *

193. spacer 1.1|27151|34|NZ_CP023149|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.765 

gcgctggtcctggtagcccggctgcggcgggtaa-	CRISPR spacer
gaactggtgcaggtagcccggctgcgg-ggacacc	Protospacer
* .***** * **************** **..*

194. spacer 1.1|27151|34|NZ_CP023149|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
gaactggtgcaggtagcccggctgcggcgacacc	Protospacer
* .***** * ******************.

195. spacer 1.1|27151|34|NZ_CP023149|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
gaactggtgcaggtagcccggctgcggcgacacc	Protospacer
* .***** * ******************.

196. spacer 1.1|27151|34|NZ_CP023149|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
gaactggtgcaggtagcccggctgcggcgacacc	Protospacer
* .***** * ******************.

197. spacer 1.1|27151|34|NZ_CP023149|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
ctgatcgtcctgatcgcccggctgcggcgggagg	Protospacer
 .* * ******.* **************** ..

198. spacer 1.1|27151|34|NZ_CP023149|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
ctgatcgtcctgatcgcccggctgcggcgggagg	Protospacer
 .* * ******.* **************** ..

199. spacer 1.1|27151|34|NZ_CP023149|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
ctgatcgtcctgatcgcccggctgcggcgggagg	Protospacer
 .* * ******.* **************** ..

200. spacer 1.1|27151|34|NZ_CP023149|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
ctgatcgtcctgatcgcccggctgcggcgggagg	Protospacer
 .* * ******.* **************** ..

201. spacer 1.1|27151|34|NZ_CP023149|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
ctgatcgtcctgatcgcccggctgcggcgggagg	Protospacer
 .* * ******.* **************** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3453506 : 3462596 8 Shahe_endorna-like_virus(50.0%) NA NA
DBSCAN-SWA_2 4138639 : 4145215 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 4730214 : 4738897 8 Burkholderia_phage(50.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage