Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016304 Candidatus Portiera aleyrodidarum MED (Bemisia tabaci) strain MEAM1 chromosome, complete genome 3 crisprs NA 0 1 0 0

Results visualization

1. NZ_CP016304
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016304_1 176972-177058 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016304_2 215927-216020 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016304_3 236344-236436 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016304_3 3.1|236375|31|NZ_CP016304|CRISPRCasFinder 236375-236405 31 MN693898 Marine virus AFVG_250M937, complete genome 33384-33414 6 0.806
NZ_CP016304_3 3.1|236375|31|NZ_CP016304|CRISPRCasFinder 236375-236405 31 NC_009726 Coxiella burnetii Dugway 5J108-111 plasmid pQpDG, complete sequence 35207-35237 7 0.774
NZ_CP016304_3 3.1|236375|31|NZ_CP016304|CRISPRCasFinder 236375-236405 31 NZ_CP045273 Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence 304976-305006 7 0.774
NZ_CP016304_3 3.1|236375|31|NZ_CP016304|CRISPRCasFinder 236375-236405 31 NC_017412 Borreliella burgdorferi JD1 plasmid JD1 lp28-7, complete sequence 7277-7307 8 0.742

1. spacer 3.1|236375|31|NZ_CP016304|CRISPRCasFinder matches to MN693898 (Marine virus AFVG_250M937, complete genome) position: , mismatch: 6, identity: 0.806

atttttttatcttatataatatgacggtaat	CRISPR spacer
atttttttatcatatataatatcatagaaag	Protospacer
*********** ********** *..* ** 

2. spacer 3.1|236375|31|NZ_CP016304|CRISPRCasFinder matches to NC_009726 (Coxiella burnetii Dugway 5J108-111 plasmid pQpDG, complete sequence) position: , mismatch: 7, identity: 0.774

atttttttatcttatataatatgacggtaat--	CRISPR spacer
atttttttatattatataatat--tttttatta	Protospacer
********** ***********  .  * **  

3. spacer 3.1|236375|31|NZ_CP016304|CRISPRCasFinder matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 7, identity: 0.774

atttttttatcttatataatatgacggtaat	CRISPR spacer
ctgatgtaatcttatataatatgactttaat	Protospacer
 *  * * *****************  ****

4. spacer 3.1|236375|31|NZ_CP016304|CRISPRCasFinder matches to NC_017412 (Borreliella burgdorferi JD1 plasmid JD1 lp28-7, complete sequence) position: , mismatch: 8, identity: 0.742

atttttttatcttatataatatgacggtaat	CRISPR spacer
tattttttattttttataatatgacttacat	Protospacer
  ********.** ***********    **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage