1. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_002638 (Salmonella enterica enterica sv Choleraesuis RF-1 plasmid pKDSC50, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
2. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_KY401053 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE380 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
3. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_KX807610 (Salmonella enterica subsp. enterica serovar Enteritidis strain CNM4839/03 plasmid pUO-SeVR1, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
4. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_KT317612 (Salmonella enterica subsp. enterica serovar Enteritidis strain EC20120002 plasmid pSE12-2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
5. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP018663 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
6. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP033089 (Salmonella enterica subsp. enterica serovar Enteritidis strain SEO plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
7. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP026054 (Salmonella enterica strain FDAARGOS_70 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
8. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP023437 (Salmonella enterica strain FORC_074 plasmid pFORC74_2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
9. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP040645 (Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 plasmid pCFSAN074386, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
10. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP043774 (Salmonella enterica strain QH plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
11. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP018639 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
12. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP025553 (Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 plasmid pPIR00558, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
13. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_010119 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pOU7519, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
14. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP018653 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
15. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to HG970000 (Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 PT4 plasmid pSEN complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
16. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP026570 (Salmonella enterica strain MFDS1004839 plasmid pSE1004839, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
17. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP017233 (Salmonella enterica strain FORC_051 plasmid pFORC51, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
18. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP009767 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 plasmid pFORC7, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
19. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to KT317611 (Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 plasmid pSE9-641, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
20. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to KT317613 (Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 plasmid pSE12-5, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
21. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP012397 (Salmonella enterica strain FORC_019 plasmid pFORC19, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
22. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP015525 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 plasmid pSJTUF10978, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
23. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_012124 (Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 plasmid pSPCV, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
24. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP022004 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 plasmid pCFSAN051873, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
25. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP007508 (Salmonella enterica subsp. enterica serovar Enteritidis strain Durban plasmid, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
26. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP008927 (Salmonella enterica subsp. enterica serovar Enteritidis strain SEJ plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
27. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP041178 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367B, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
28. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP050708 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
29. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP015527 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 plasmid pSJTUF10984, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
30. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP011395 (Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 plasmid pCFSAN000006, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
31. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP007529 (Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
32. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_006855 (Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSCV50, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
33. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP012345 (Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 plasmid pCFSAN000679_01, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
34. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP041972 (Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
35. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to MN125607 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.1-2C7 plasmid p1.1-2C7, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
36. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to MN125608 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.05-1C8 plasmid p1.05-1C8, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
37. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to MN125609 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.15-2E5 plasmid p1.15-2E5, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
38. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP011943 (Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-00D989 87-1 plasmid virulence, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
39. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to CP053399 (Salmonella enterica subsp. enterica serovar Paratyphi C strain 07-0715 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
40. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP020824 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 plasmid pCFSAN033541, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
41. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP020826 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
42. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP013098 (Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 plasmid pCMCC50041, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
43. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP032850 (Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 plasmid pM0061, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
44. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP050711 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
45. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to LN879484 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSEN-BT, strain D7795) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
46. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP018660 (Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 plasmid pSE93-0639, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
47. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP018641 (Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605 plasmid pSE70-1605, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
48. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP050725 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
49. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_019120 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSENV, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
50. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP018636 (Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991 plasmid pSE56-3991, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
51. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP018634 (Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 plasmid pSE49-2444, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
52. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP026714 (Salmonella enterica strain FORC_078 plasmid pFORC_078_2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
53. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP018650 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
54. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP030796 (Salmonella enterica strain 2017K-0021 plasmid p2017K-0021, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
55. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
56. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP050722 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE81 plasmid pSE81-1, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
57. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP050718 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE95 plasmid pSE95-2, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
58. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP040647 (Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
59. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP043434 (Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
60. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP025557 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p1PIR00532, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
61. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP017178 (Salmonella enterica strain FORC_056 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacgctgccgtccccccgctcgacgctga Protospacer
*******************************
62. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_002638 (Salmonella enterica enterica sv Choleraesuis RF-1 plasmid pKDSC50, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
63. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_KY401053 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE380 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
64. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_KX807610 (Salmonella enterica subsp. enterica serovar Enteritidis strain CNM4839/03 plasmid pUO-SeVR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
65. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_KT317612 (Salmonella enterica subsp. enterica serovar Enteritidis strain EC20120002 plasmid pSE12-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
66. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP018663 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
67. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP033089 (Salmonella enterica subsp. enterica serovar Enteritidis strain SEO plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
68. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP026054 (Salmonella enterica strain FDAARGOS_70 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
69. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP023437 (Salmonella enterica strain FORC_074 plasmid pFORC74_2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
70. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP040645 (Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-0432 plasmid pCFSAN074386, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
71. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP043774 (Salmonella enterica strain QH plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
72. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP018639 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
73. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP025553 (Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 plasmid pPIR00558, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
74. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_010119 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pOU7519, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
75. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP018653 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
76. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to HG970000 (Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 PT4 plasmid pSEN complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
77. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP026570 (Salmonella enterica strain MFDS1004839 plasmid pSE1004839, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
78. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP017233 (Salmonella enterica strain FORC_051 plasmid pFORC51, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
79. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP009767 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 plasmid pFORC7, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
80. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to KT317611 (Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 plasmid pSE9-641, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
81. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to KT317613 (Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 plasmid pSE12-5, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
82. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP012397 (Salmonella enterica strain FORC_019 plasmid pFORC19, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
83. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP015525 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10978 plasmid pSJTUF10978, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
84. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_012124 (Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 plasmid pSPCV, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
85. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP022004 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051873 plasmid pCFSAN051873, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
86. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP007508 (Salmonella enterica subsp. enterica serovar Enteritidis strain Durban plasmid, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
87. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP008927 (Salmonella enterica subsp. enterica serovar Enteritidis strain SEJ plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
88. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP041178 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367B, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
89. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP050708 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
90. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP015527 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 plasmid pSJTUF10984, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
91. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP011395 (Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 plasmid pCFSAN000006, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
92. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP007529 (Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 isolate CDC_2010K-0968 plasmid p00, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
93. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_006855 (Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSCV50, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
94. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP012345 (Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 plasmid pCFSAN000679_01, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
95. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP041972 (Salmonella enterica subsp. enterica serovar Enteritidis strain NCCP 16206 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
96. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to MN125607 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.1-2C7 plasmid p1.1-2C7, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
97. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to MN125608 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.05-1C8 plasmid p1.05-1C8, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
98. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to MN125609 (Salmonella enterica subsp. enterica serovar Enteritidis strain 1.15-2E5 plasmid p1.15-2E5, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
99. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP011943 (Salmonella enterica subsp. enterica serovar Enteritidis strain OLF-00D989 87-1 plasmid virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
100. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to CP053399 (Salmonella enterica subsp. enterica serovar Paratyphi C strain 07-0715 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
101. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP020824 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033541 plasmid pCFSAN033541, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
102. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP020826 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN033543 plasmid pCFSAN033543, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
103. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP013098 (Salmonella enterica subsp. enterica serovar Enteritidis strain CMCC50041 plasmid pCMCC50041, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
104. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP032850 (Salmonella enterica subsp. enterica serovar Enteritidis strain NCM 61 plasmid pM0061, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
105. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP050711 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
106. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to LN879484 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSEN-BT, strain D7795) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
107. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP018660 (Salmonella enterica subsp. enterica serovar Enteritidis strain 93-0639 plasmid pSE93-0639, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
108. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP018641 (Salmonella enterica subsp. enterica serovar Enteritidis strain 70-1605 plasmid pSE70-1605, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
109. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP050725 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
110. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_019120 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSENV, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
111. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP018636 (Salmonella enterica subsp. enterica serovar Enteritidis strain 56-3991 plasmid pSE56-3991, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
112. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP018634 (Salmonella enterica subsp. enterica serovar Enteritidis strain 49-2444 plasmid pSE49-2444, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
113. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP026714 (Salmonella enterica strain FORC_078 plasmid pFORC_078_2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
114. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP018650 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1607 plasmid pSE81-1607-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
115. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP030796 (Salmonella enterica strain 2017K-0021 plasmid p2017K-0021, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
116. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
117. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP050722 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE81 plasmid pSE81-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
118. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP050718 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE95 plasmid pSE95-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
119. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP040647 (Salmonella enterica subsp. enterica serovar Enteritidis strain SAP18-H9654 plasmid pCFSAN074385, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
120. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP043434 (Salmonella enterica subsp. enterica serovar Enteritidis strain PT1 plasmid pPT1-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
121. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP025557 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p1PIR00532, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
122. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP017178 (Salmonella enterica strain FORC_056 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacgctgccgtccccccgctcgacgctga Protospacer
********************************
123. spacer 3.11|1055240|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgcacaacgcctggatatccgcccatcggcc Protospacer
********************************
124. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP017620 (Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
125. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP046282 (Salmonella enterica strain FDAARGOS_687 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
126. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP017618 (Salmonella enterica subsp. enterica serovar Typhimurium strain 22495 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
127. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP035302 (Salmonella enterica subsp. enterica strain ST1539 plasmid pST1539, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
128. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP040569 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 plasmid pCFSAN059542, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
129. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP014980 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 plasmid pSTY1-H2662, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
130. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP014970 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 isolate ST1126-1 plasmid pSTY1-1808, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
131. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP014968 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 plasmid pSTY1-2011K-1702, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
132. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP037873 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 plasmid pPNCS014854_S1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
133. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP037876 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
134. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP020923 (Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
135. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP014973 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY2-1898, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
136. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to CP038435 (Salmonella enterica subsp. enterica serovar Typhimurium strain E40V plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
137. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP014976 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 plasmid pSTY1-2009K-1640, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
138. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_017054 (Salmonella enterica subsp. enterica serovar Typhimurium str. 798 plasmid p798_93, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
139. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP047324 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM13672 plasmid pRM13672, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
140. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP014537 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 plasmid pSO3_STV, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
141. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_022570 (Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 unnamed plasmid, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
142. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP039560 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.2, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
143. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
144. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP039586 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
145. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_LN999012 (Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 plasmid pSLT, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
146. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP034480 (Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
147. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to CP038433 (Salmonella enterica subsp. enterica serovar Typhimurium strain E40 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
148. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP016390 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pSLT931, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
149. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP025556 (Salmonella enterica subsp. enterica serovar Typhimurium strain PIR00538 plasmid pPIR00538, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
150. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP050746 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
151. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP053871 (Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 plasmid pSS2017-1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
152. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP053866 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
153. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP041006 (Salmonella enterica strain FDAARGOS_768 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
154. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP039855 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014864 plasmid p11-0972.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
155. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP034231 (Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 plasmid pATCC14028, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
156. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP029594 (Salmonella enterica strain DA34827 plasmid pDA34827-94, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
157. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to CP051287 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Gull_ST-29 plasmid pST29-94038, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
158. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP017729 (Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 plasmid pSARA13, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
159. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP008745 (Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 plasmid pSLT_VNP20009, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
160. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP007582 (Salmonella enterica subsp. enterica serovar Typhimurium strain 138736 plasmid, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
161. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP039566 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014849 plasmid p08-7727.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
162. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_013437 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSLT-BT, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
163. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP034720 (Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
164. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to CP051281 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-99574.1A, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
165. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP029596 (Salmonella enterica strain DA34833 plasmid pDA34833-94, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
166. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to CP051277 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Sparrow_ST-87 plasmid pST87-92921, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
167. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_LS997974 (Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pSLT-BT) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
168. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to LN794247 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSBLT, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
169. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP041974 (Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
170. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP039580 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014857 plasmid p10-3881.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
171. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP039583 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014858 plasmid p10-8609.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
172. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP044969 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS007087.2, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
173. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP044959 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
174. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP039596 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014865 plasmid p12-4331.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
175. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP039592 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014862 plasmid p11-0500.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
176. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP039568 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014850 plasmid p08-8136.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
177. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to CP014577 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437 plasmid pRM9437, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
178. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to CP013721 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607 plasmid pRM10607, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
179. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_016864 (Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 plasmid pSTUK-100, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
180. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP014962 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 plasmid pSTY1-1899, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
181. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_016861 (Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 plasmid pSTMDT12_L, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
182. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP021464 (Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_2, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
183. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP029838 (Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093B, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
184. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP014050 (Salmonella enterica strain FDAARGOS_94 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
185. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP038848 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014851 plasmid p09-0499.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
186. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP050736 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
187. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP040565 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 plasmid pCFSAN059544, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
188. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_003277 (Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 plasmid pSLT, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
189. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP022071 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
190. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP051268 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 plasmid pST33-93798, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
191. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
192. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_016855 (Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
193. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_LT855377 (Salmonella enterica subsp. enterica serovar Typhimurium isolate STMU2UK plasmid 2) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
194. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP027413 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
195. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
196. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP014359 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 plasmid pYU15_94, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
197. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP015158 (Salmonella enterica subsp. enterica serovar Typhimurium strain NC983 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
198. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP018658 (Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 plasmid pSE92-0392, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
199. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP028200 (Salmonella enterica subsp. enterica serovar Typhimurium strain CFSAN018746 plasmid pGMI14-001, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
200. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NC_021155 (Salmonella enterica subsp. enterica serovar Typhimurium str. U288 plasmid pSTU288-1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
201. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP014357 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 plasmid pSO2_STV, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
202. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP028319 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 plasmid pSC-09-1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
203. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP050741 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
204. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP040901 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 plasmid pCFSAN074387, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
205. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP040322 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 plasmid p16-6397.1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
206. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP045950 (Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_01, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
207. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP015599 (Salmonella enterica strain FORC_030 plasmid pFORC_030, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
208. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP026701 (Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
209. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to KX777254 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTV-Mu1, complete sequence) position: , mismatch: 1, identity: 0.968
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
cagacactgccgtccccccgctcgacgctga Protospacer
*****.*************************
210. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP017620 (Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
211. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP046282 (Salmonella enterica strain FDAARGOS_687 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
212. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP017618 (Salmonella enterica subsp. enterica serovar Typhimurium strain 22495 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
213. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP035302 (Salmonella enterica subsp. enterica strain ST1539 plasmid pST1539, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
214. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP040569 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-8290 plasmid pCFSAN059542, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
215. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014980 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 plasmid pSTY1-H2662, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
216. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014970 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 isolate ST1126-1 plasmid pSTY1-1808, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
217. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014968 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 plasmid pSTY1-2011K-1702, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
218. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP037873 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 plasmid pPNCS014854_S1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
219. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP037876 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
220. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP020923 (Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
221. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014973 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY2-1898, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
222. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to CP038435 (Salmonella enterica subsp. enterica serovar Typhimurium strain E40V plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
223. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014976 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 plasmid pSTY1-2009K-1640, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
224. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_017054 (Salmonella enterica subsp. enterica serovar Typhimurium str. 798 plasmid p798_93, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
225. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP047324 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM13672 plasmid pRM13672, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
226. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014537 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO3 isolate SOHS 02-68 plasmid pSO3_STV, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
227. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_022570 (Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 unnamed plasmid, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
228. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP039560 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.2, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
229. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
230. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP039586 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
231. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_LN999012 (Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 plasmid pSLT, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
232. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP034480 (Salmonella enterica subsp. enterica serovar Typhimurium strain 14028 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
233. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to CP038433 (Salmonella enterica subsp. enterica serovar Typhimurium strain E40 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
234. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP016390 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pSLT931, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
235. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP025556 (Salmonella enterica subsp. enterica serovar Typhimurium strain PIR00538 plasmid pPIR00538, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
236. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP050746 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
237. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP053871 (Salmonella enterica subsp. enterica serovar Typhimurium strain SS2017 plasmid pSS2017-1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
238. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP053866 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
239. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP041006 (Salmonella enterica strain FDAARGOS_768 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
240. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP039855 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014864 plasmid p11-0972.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
241. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP034231 (Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 plasmid pATCC14028, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
242. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP029594 (Salmonella enterica strain DA34827 plasmid pDA34827-94, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
243. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to CP051287 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Gull_ST-29 plasmid pST29-94038, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
244. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP017729 (Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 plasmid pSARA13, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
245. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP008745 (Salmonella enterica subsp. enterica serovar Typhimurium strain VNP20009 plasmid pSLT_VNP20009, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
246. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP007582 (Salmonella enterica subsp. enterica serovar Typhimurium strain 138736 plasmid, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
247. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP039566 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014849 plasmid p08-7727.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
248. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_013437 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSLT-BT, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
249. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP034720 (Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
250. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to CP051281 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-99574.1A, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
251. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP029596 (Salmonella enterica strain DA34833 plasmid pDA34833-94, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
252. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to CP051277 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Sparrow_ST-87 plasmid pST87-92921, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
253. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_LS997974 (Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 isolate D23580_liv plasmid D23580_liv_pSLT-BT) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
254. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to LN794247 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSBLT, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
255. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP041974 (Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
256. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP039580 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014857 plasmid p10-3881.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
257. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP039583 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014858 plasmid p10-8609.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
258. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP044969 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS007087.2, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
259. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP044959 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
260. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP039596 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014865 plasmid p12-4331.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
261. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP039592 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014862 plasmid p11-0500.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
262. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP039568 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014850 plasmid p08-8136.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
263. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to CP014577 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437 plasmid pRM9437, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
264. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to CP013721 (Salmonella enterica subsp. enterica serovar Typhimurium strain RM10607 plasmid pRM10607, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
265. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_016864 (Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 plasmid pSTUK-100, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
266. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014962 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 plasmid pSTY1-1899, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
267. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_016861 (Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 plasmid pSTMDT12_L, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
268. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP021464 (Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_2, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
269. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP029838 (Salmonella enterica subsp. enterica serovar Typhimurium strain 10ST07093 plasmid p10ST07093B, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
270. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014050 (Salmonella enterica strain FDAARGOS_94 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
271. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP038848 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014851 plasmid p09-0499.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
272. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP050736 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-2, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
273. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP040565 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7699 plasmid pCFSAN059544, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
274. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_003277 (Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 plasmid pSLT, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
275. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP022071 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
276. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP051268 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Hawk_ST-33 plasmid pST33-93798, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
277. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
278. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_016855 (Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
279. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_LT855377 (Salmonella enterica subsp. enterica serovar Typhimurium isolate STMU2UK plasmid 2) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
280. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP027413 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
281. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
282. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014359 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 plasmid pYU15_94, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
283. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP015158 (Salmonella enterica subsp. enterica serovar Typhimurium strain NC983 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
284. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP018658 (Salmonella enterica subsp. enterica serovar Enteritidis strain 92-0392 plasmid pSE92-0392, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
285. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP028200 (Salmonella enterica subsp. enterica serovar Typhimurium strain CFSAN018746 plasmid pGMI14-001, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
286. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_021155 (Salmonella enterica subsp. enterica serovar Typhimurium str. U288 plasmid pSTU288-1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
287. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014357 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 plasmid pSO2_STV, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
288. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP028319 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 plasmid pSC-09-1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
289. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP050741 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-2, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
290. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP040901 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP18-6199 plasmid pCFSAN074387, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
291. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP040322 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 plasmid p16-6397.1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
292. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP045950 (Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00010529 plasmid pAUSMDU00010529_01, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
293. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP015599 (Salmonella enterica strain FORC_030 plasmid pFORC_030, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
294. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP026701 (Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
295. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to KX777254 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTV-Mu1, complete sequence) position: , mismatch: 1, identity: 0.969
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gcagacactgccgtccccccgctcgacgctga Protospacer
******.*************************
296. spacer 3.11|1055240|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP029990 (Salmonella enterica subsp. diarizonae serovar 48:i:z strain SA20121591 plasmid pSA20121591.1, complete sequence) position: , mismatch: 1, identity: 0.969
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc Protospacer
*******************.************
297. spacer 3.11|1055240|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc Protospacer
*******************.************
298. spacer 3.11|1055240|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc Protospacer
*******************.************
299. spacer 3.11|1055240|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgcacaacgcctggatattcgcccatcggcc Protospacer
*******************.************
300. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
caatcgctgcggtcccaccgctcgacgatca Protospacer
**. ****** ***** ********** * *
301. spacer 2.19|1037793|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 6, identity: 0.812
cgataatttataaattttcgtccactcatcaa CRISPR spacer
cgctgcgttataaatcatcgtccactcatcaa Protospacer
** *. ********. ***************
302. spacer 2.22|1037976|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 6, identity: 0.812
tgccggtttatctgctccggaccaa--tcgacta CRISPR spacer
tgccggtctatctgctcctgaccaaggccgat-- Protospacer
*******.********** ****** .***.
303. spacer 2.22|1037976|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 6, identity: 0.812
tgccggtttatctgctccggaccaa--tcgacta CRISPR spacer
tgccggtctatctgctcctgaccaaggccgat-- Protospacer
*******.********** ****** .***.
304. spacer 2.22|1037976|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 6, identity: 0.812
tgccggtttatctgctccggaccaa--tcgacta CRISPR spacer
tgccggtctatctgctcctgaccaaggccgat-- Protospacer
*******.********** ****** .***.
305. spacer 2.22|1037976|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 6, identity: 0.812
tgccggtttatctgctccggaccaa--tcgacta CRISPR spacer
tgccggtctatctgctcctgaccaaggccgat-- Protospacer
*******.********** ****** .***.
306. spacer 2.22|1037976|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 6, identity: 0.812
tgccggtttatctgctccggaccaa--tcgacta CRISPR spacer
tgccggtctatctgctcctgaccaaggccgat-- Protospacer
*******.********** ****** .***.
307. spacer 2.22|1037976|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 6, identity: 0.812
tgccggtttatctgctccggaccaa--tcgacta CRISPR spacer
tgccggtctatctgctcctgaccaaggccgat-- Protospacer
*******.********** ****** .***.
308. spacer 2.1|1037001|31|NZ_CP023166|PILER-CR matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 7, identity: 0.774
aacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
gtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
309. spacer 2.1|1037001|31|NZ_CP023166|PILER-CR matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 7, identity: 0.774
aacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
gtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
310. spacer 2.1|1037001|31|NZ_CP023166|PILER-CR matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 7, identity: 0.774
aacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
gtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
311. spacer 2.1|1037001|31|NZ_CP023166|PILER-CR matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 7, identity: 0.774
aacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
gtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
312. spacer 2.1|1037001|31|NZ_CP023166|PILER-CR matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 7, identity: 0.774
aacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
gtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
313. spacer 2.1|1037001|31|NZ_CP023166|PILER-CR matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 7, identity: 0.774
aacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
gtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
314. spacer 2.1|1037001|31|NZ_CP023166|PILER-CR matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 7, identity: 0.774
aacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
gtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
315. spacer 2.1|1037001|31|NZ_CP023166|PILER-CR matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 7, identity: 0.774
aacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
gtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
316. spacer 2.1|1037001|31|NZ_CP023166|PILER-CR matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 7, identity: 0.774
aacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
gtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
317. spacer 2.1|1037001|31|NZ_CP023166|PILER-CR matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.774
aacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
gtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
318. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 7, identity: 0.774
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
acgtcgctgccgtccgcccgctccacggaga Protospacer
* *********** ******* *** **
319. spacer 2.21|1037915|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to KX657793 (Mycobacterium phage DarthPhader, complete genome) position: , mismatch: 7, identity: 0.781
ccgcagaacgccgcatcgccgaactggacaaa CRISPR spacer
cgttcgaccgccgcatagccgaactggacaag Protospacer
* . ** ******** **************.
320. spacer 2.26|1038220|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcccaactcgtcagggcggttatccagcgcca CRISPR spacer
ttcccgatcgtcagggcggtgattcagcgcga Protospacer
*.** . ************* **.****** *
321. spacer 3.11|1055240|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcacaacgcctggatatccgcccatcggcc CRISPR spacer
tcgagaaacgcctggatctccgcccaccgccg Protospacer
*** . *********** ********.** *
322. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP022317 (Brachybacterium avium strain VR2415 plasmid unnamed1) position: , mismatch: 8, identity: 0.742
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
tcagcgctgccgtcctcccggtcgacgagga Protospacer
. ..***********.**** ****** **
323. spacer 2.3|1037123|31|NZ_CP023166|PILER-CR matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 8, identity: 0.742
cagacgctgccgtccccccgctcgacgctga CRISPR spacer
tagccgctgccgtcccaccgctcgtggtggc Protospacer
.** ************ ******* *. *
324. spacer 2.6|1037000|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.75
caacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
ggtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
325. spacer 2.6|1037000|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 8, identity: 0.75
caacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
ggtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
326. spacer 2.6|1037000|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.75
caacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
ggtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
327. spacer 2.6|1037000|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.75
caacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
ggtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
328. spacer 2.6|1037000|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.75
caacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
ggtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
329. spacer 2.6|1037000|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.75
caacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
ggtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
330. spacer 2.6|1037000|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.75
caacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
ggtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
331. spacer 2.6|1037000|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 8, identity: 0.75
caacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
ggtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
332. spacer 2.6|1037000|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.75
caacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
ggtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
333. spacer 2.6|1037000|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.75
caacagcgtcccgtattctgtatcgttgacgg CRISPR spacer
ggtcagcgtgccgtattcggtatcgttcttgg Protospacer
. ****** ******** ******** .**
334. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 8, identity: 0.75
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
cacgtcgctgccgtccgcccgctccacggaga Protospacer
* *********** ******* *** **
335. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 8, identity: 0.75
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
gtagccgctgccgtcccaccgctcgtggtggc Protospacer
*.** ************ ******* *. *
336. spacer 2.12|1037366|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.75
accacatcaatgaccacatca-----cgcagatatta CRISPR spacer
accacatcaacgaccacatcaagcaccgcgaa----- Protospacer
**********.********** ***..*
337. spacer 2.20|1037854|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 8, identity: 0.75
accgttatctgctggttgatacttccccgagc--- CRISPR spacer
gccgttatcggctggtttatactt---aaagcaaa Protospacer
.******** ******* ****** .***
338. spacer 2.20|1037854|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to MT773554 (Myoviridae sp. isolate BML_2 genomic sequence) position: , mismatch: 8, identity: 0.75
accgttatctgctggttgatacttccccgagc CRISPR spacer
aacattatctgctggttgatagtttccataat Protospacer
* *.***************** **.** *..
339. spacer 2.27|1038281|32|NZ_CP023166|CRISPRCasFinder,CRT matches to JX434031 (Pseudomonas phage JBD24, complete genome) position: , mismatch: 8, identity: 0.75
gtcacgaggtctgacgcggatgtgatg--agtta CRISPR spacer
tcggcgaggtctgccgcgaatgtgatggcagt-- Protospacer
. .********* ****.******** ***
340. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP043846 (Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gttattcagtttattaaatttttccgccaagt CRISPR spacer
tttattcagtatatttaatttttctctcgaat Protospacer
********* **** ********. .*.*.*
341. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP030248 (Staphylococcus epidermidis strain CSF41498 plasmid pCSF41498_2, complete sequence) position: , mismatch: 8, identity: 0.75
gttattcagtttattaaatttttccgccaagt CRISPR spacer
tttattcagtatatttaatttttctctcgaat Protospacer
********* **** ********. .*.*.*
342. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP009047 (Staphylococcus epidermidis strain SEI plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gttattcagtttattaaatttttccgccaagt CRISPR spacer
tttattcagtatatttaatttttctctcgaat Protospacer
********* **** ********. .*.*.*
343. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_HG813244 (Staphylococcus epidermidis PM221 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
gttattcagtttattaaatttttccgccaagt CRISPR spacer
tttattcagtatatttaatttttctctcgaat Protospacer
********* **** ********. .*.*.*
344. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP023971 (Staphylococcus lugdunensis strain FDAARGOS_381 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gttattcagtttattaaatttttccgccaagt CRISPR spacer
tttattcagtatatttaatttttctctcgaat Protospacer
********* **** ********. .*.*.*
345. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014116 (Staphylococcus epidermidis strain FDAARGOS_153 plasmid unnamed4) position: , mismatch: 8, identity: 0.75
gttattcagtttattaaatttttccgccaagt CRISPR spacer
tttattcagtatatttaatttttctctcgaat Protospacer
********* **** ********. .*.*.*
346. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014117 (Staphylococcus epidermidis strain FDAARGOS_153 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
gttattcagtttattaaatttttccgccaagt CRISPR spacer
tttattcagtatatttaatttttctctcgaat Protospacer
********* **** ********. .*.*.*
347. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP014120 (Staphylococcus epidermidis strain FDAARGOS_153 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gttattcagtttattaaatttttccgccaagt CRISPR spacer
tttattcagtatatttaatttttctctcgaat Protospacer
********* **** ********. .*.*.*
348. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP034116 (Staphylococcus epidermidis strain CDC121 plasmid pSTA481, complete sequence) position: , mismatch: 8, identity: 0.75
gttattcagtttattaaatttttccgccaagt CRISPR spacer
tttattcagtatatttaatttttctctcgaat Protospacer
********* **** ********. .*.*.*
349. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP034113 (Staphylococcus epidermidis strain CDC120 plasmid pSTA492, complete sequence) position: , mismatch: 8, identity: 0.75
gttattcagtttattaaatttttccgccaagt CRISPR spacer
tttattcagtatatttaatttttctctcgaat Protospacer
********* **** ********. .*.*.*
350. spacer 3.5|1054874|32|NZ_CP023166|CRISPRCasFinder,CRT matches to FQ857195 (Erwinia phage phiEa116, WORKING DRAFT SEQUENCE, 6 unordered pieces) position: , mismatch: 8, identity: 0.75
tgcaacagcaacaggagagaatgcggcagcgt CRISPR spacer
tgattcagcaacagcagagaatggggcaaagc Protospacer
** ********* ******** ****. *.
351. spacer 3.5|1054874|32|NZ_CP023166|CRISPRCasFinder,CRT matches to HQ728263 (Erwinia phage vB_EamM-M7, complete genome) position: , mismatch: 8, identity: 0.75
tgcaacagcaacaggagagaatgcggcagcgt CRISPR spacer
tgattcagcaacagcagagaatggggcaaagc Protospacer
** ********* ******** ****. *.
352. spacer 3.6|1054935|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP050100 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence) position: , mismatch: 8, identity: 0.75
cgtcagttgctggaactggggcacgatctggt CRISPR spacer
cgtcagttgctcgagctggggcagcgacatgt Protospacer
*********** **.******** . * **
353. spacer 2.8|1037122|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP022317 (Brachybacterium avium strain VR2415 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
gcagacgctgccgtccccccgctcgacgctga CRISPR spacer
ctcagcgctgccgtcctcccggtcgacgagga Protospacer
. ..***********.**** ****** **
354. spacer 2.13|1037427|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 9, identity: 0.719
cgccgtgtttacttcaatagcgacgttgtgag CRISPR spacer
gaactcggttgcttcaacagcgacgttgtgac Protospacer
. * .* **.******.*************
355. spacer 2.14|1037488|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to MN855642 (Bacteriophage sp. isolate 132, complete genome) position: , mismatch: 9, identity: 0.719
aggttgaccatcgtcagcttcataaagattta CRISPR spacer
tacataaagatcgtcaccttcacaaagattta Protospacer
. *.* ******* *****.*********
356. spacer 2.21|1037915|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ccgcagaacgccgcatcgccgaactggacaaa CRISPR spacer
ccgcagaacgccgcattgccggacctcattcc Protospacer
****************.****.**. *.
357. spacer 3.3|1054752|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP021438 (Bacillus thuringiensis strain C15 plasmid pBMB172, complete sequence) position: , mismatch: 9, identity: 0.719
caactgtattttgcgttattacgctgaaccag CRISPR spacer
aatacatattttccgttattaccctgaacaaa Protospacer
* ..****** ********* ****** *.
358. spacer 3.5|1054874|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP009827 (Xylella fastidiosa strain Pr8x plasmid pXF39, complete sequence) position: , mismatch: 9, identity: 0.719
tgcaacagcaacaggagagaatgcggcagcgt CRISPR spacer
gaagaaagcaacaggaaagaaggcggcagtga Protospacer
. .* **********.**** *******.*
359. spacer 3.5|1054874|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP009825 (Xylella fastidiosa strain J1a12 plasmid pXF51-J1, complete sequence) position: , mismatch: 9, identity: 0.719
tgcaacagcaacaggagagaatgcggcagcgt CRISPR spacer
gaagaaagcaacaggaaagaaggcggcagtga Protospacer
. .* **********.**** *******.*
360. spacer 3.5|1054874|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_002490 (Xylella fastidiosa 9a5c plasmid pXF51, complete sequence) position: , mismatch: 9, identity: 0.719
tgcaacagcaacaggagagaatgcggcagcgt CRISPR spacer
gaagaaagcaacaggaaagaaggcggcagtga Protospacer
. .* **********.**** *******.*
361. spacer 3.5|1054874|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP009791 (Xylella fastidiosa strain U24d plasmid pXF51ud, complete sequence) position: , mismatch: 9, identity: 0.719
tgcaacagcaacaggagagaatgcggcagcgt CRISPR spacer
gaagaaagcaacaggaaagaaggcggcagtga Protospacer
. .* **********.**** *******.*
362. spacer 3.6|1054935|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NZ_CP034911 (Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcagttgctggaactggggcacgatctggt CRISPR spacer
ttccgtccgctggaactgggggccgatctggt Protospacer
. .*. ..************* *********
363. spacer 2.12|1037366|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_008208 (Aeromonas phage 25, complete genome) position: , mismatch: 10, identity: 0.688
accacatcaatgaccacatcacgcagatatta CRISPR spacer
ttcacatcaatgacgacatcacccacactggt Protospacer
.************ ******* ** *.
364. spacer 2.12|1037366|32|NZ_CP023166|CRISPRCasFinder,CRT matches to DQ529280 (Aeromonas salmonicida bacteriophage 25, complete genome) position: , mismatch: 10, identity: 0.688
accacatcaatgaccacatcacgcagatatta CRISPR spacer
ttcacatcaatgacgacatcacccacactggt Protospacer
.************ ******* ** *.
365. spacer 2.18|1037732|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to MN694012 (Marine virus AFVG_250M887, complete genome) position: , mismatch: 10, identity: 0.688
cttgtcggcgttgctcacgtgactatttcgca CRISPR spacer
ggtacttacgttgctcacgtaactattacgcc Protospacer
*... .************.****** ***
366. spacer 2.21|1037915|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU140623 (Sinorhizobium sp. M14 plasmid pSinB, complete sequence) position: , mismatch: 10, identity: 0.688
ccgcagaacgccgcatcgccgaactggacaaa CRISPR spacer
cgatcgaacagcgcatcgccgaactggaagcg Protospacer
* .. ****. ***************** . .
367. spacer 2.23|1038037|32|NZ_CP023166|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 10, identity: 0.688
cgccgccagctggaaaaatgccgcctgttaat CRISPR spacer
atccgcaagctggaaaaataccgccgcatgca Protospacer
**** ************.***** *.
368. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to LR135896 (uncultured phage genomic DNA containing rbcL region region) position: , mismatch: 10, identity: 0.688
gttattcagtttattaaatttttccgccaagt CRISPR spacer
attattcggtctattaaatttttcaaatatac Protospacer
.******.**.************* . .* ..
369. spacer 3.2|1054691|32|NZ_CP023166|CRISPRCasFinder,CRT matches to NC_049387 (Escherichia virus P2_4B2 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688
gttattcagtttattaaatttttccgccaagt CRISPR spacer
ttggcacattttatgaaatttttccgccagca Protospacer
* .. ** ***** **************.