Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017473 Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP017475 Enterobacter cloacae strain M12X01451 chromosome complete genome 1 crisprs csa3,WYL,DEDDh,DinG,cas3 0 2 9 0

Results visualization

1. NZ_CP017473
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4926 : 87107 56 Shigella_phage(29.41%) transposase,lysis,coat,integrase attL 4909:4949|attR 18637:18677
DBSCAN-SWA_2 123516 : 153749 28 Shigella_phage(33.33%) transposase,integrase attL 121044:121064|attR 143711:143731
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP017475
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017475_1 692225-692356 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017475_1 1.1|692249|30|NZ_CP017475|CRISPRCasFinder 692249-692278 30 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 737346-737375 6 0.8
NZ_CP017475_1 1.1|692249|30|NZ_CP017475|CRISPRCasFinder 692249-692278 30 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 737376-737405 6 0.8
NZ_CP017475_1 1.1|692249|30|NZ_CP017475|CRISPRCasFinder 692249-692278 30 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 735787-735816 6 0.8
NZ_CP017475_1 1.1|692249|30|NZ_CP017475|CRISPRCasFinder 692249-692278 30 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 740034-740063 6 0.8
NZ_CP017475_1 1.1|692249|30|NZ_CP017475|CRISPRCasFinder 692249-692278 30 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 726935-726964 6 0.8
NZ_CP017475_1 1.1|692249|30|NZ_CP017475|CRISPRCasFinder 692249-692278 30 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 737376-737405 6 0.8
NZ_CP017475_1 1.1|692249|30|NZ_CP017475|CRISPRCasFinder 692249-692278 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1386373-1386402 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052797 Salmonella enterica subsp. enterica serovar Infantis strain CVM N18S2039 plasmid pN18S2039, complete sequence 63456-63485 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052804 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence 12622-12651 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP038508 Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence 129996-130025 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052788 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence 221022-221051 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052786 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence 232950-232979 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052838 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence 231525-231554 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 NZ_CP028316 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence 128630-128659 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP051676 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence 101317-101346 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 NZ_CP022063 Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence 84260-84289 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052781 Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence 187128-187157 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052834 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence 24105-24134 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052793 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence 43406-43435 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052832 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence 178361-178390 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052830 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence 211357-211386 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 NZ_CP022662 Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-2, complete sequence 73314-73343 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052812 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence 19319-19348 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052810 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence 230399-230428 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052808 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence 11111-11140 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052806 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence 182227-182256 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052791 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence 185722-185751 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052818 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence 208172-208201 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1688442-1688471 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052799 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence 24105-24134 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052795 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence 264943-264972 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 NZ_CP047882 Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence 77271-77300 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052802 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence 298048-298077 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052840 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence 110008-110037 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052783 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence 176473-176502 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052836 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence 764-793 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052779 Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence 122769-122798 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 NZ_CP031362 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p3, complete sequence 123173-123202 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052828 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence 109328-109357 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052826 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence 93338-93367 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 NZ_CP016409 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence 77270-77299 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052824 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence 73851-73880 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052822 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence 93338-93367 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 NZ_CP016407 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence 77270-77299 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052820 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence 77270-77299 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 NZ_CP016413 Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence 77270-77299 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 NZ_CP016411 Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence 77270-77299 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052816 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598 147671-147700 7 0.767
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 CP052814 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence 81463-81492 7 0.767
NZ_CP017475_1 1.1|692249|30|NZ_CP017475|CRISPRCasFinder 692249-692278 30 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 341179-341208 8 0.733
NZ_CP017475_1 1.2|692303|30|NZ_CP017475|CRISPRCasFinder 692303-692332 30 KP881232 Sinorhizobium phage phiM9, complete genome 86166-86195 8 0.733
NZ_CP017475_1 1.1|692249|30|NZ_CP017475|CRISPRCasFinder 692249-692278 30 MF417874 Uncultured Caudovirales phage clone 3S_14, partial genome 5991-6020 9 0.7
NZ_CP017475_1 1.1|692249|30|NZ_CP017475|CRISPRCasFinder 692249-692278 30 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 707379-707408 9 0.7

1. spacer 1.1|692249|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 6, identity: 0.8

caccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
*..* **********.*****.******* 

2. spacer 1.1|692249|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 6, identity: 0.8

caccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
*..* **********.*****.******* 

3. spacer 1.1|692249|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 6, identity: 0.8

caccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
*..* **********.*****.******* 

4. spacer 1.1|692249|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 6, identity: 0.8

caccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
*..* **********.*****.******* 

5. spacer 1.1|692249|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 6, identity: 0.8

caccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
*..* **********.*****.******* 

6. spacer 1.1|692249|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 6, identity: 0.8

caccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
*..* **********.*****.******* 

7. spacer 1.1|692249|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.767

caccaccgtcgccgttatcattgccgccgc	CRISPR spacer
tattgccaccgccgttaccattgccgccgc	Protospacer
.*...**..********.************

8. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052797 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N18S2039 plasmid pN18S2039, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

9. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

10. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP038508 (Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

11. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052788 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

12. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052786 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

13. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052838 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

14. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP028316 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

15. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP051676 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

16. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP022063 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

17. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052781 (Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

18. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052834 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

19. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052793 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

20. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052832 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

21. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052830 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

22. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP022662 (Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-2, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattccccc	Protospacer
.*******.***.************ .*  

23. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052812 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

24. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052810 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

25. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052808 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

26. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052806 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

27. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052791 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

28. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052818 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

29. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccactggtaccgccattcgacg	Protospacer
.*******.***** **********    *

30. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052799 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

31. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

32. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP047882 (Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

33. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052802 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

34. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052840 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

35. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052783 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

36. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052836 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

37. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052779 (Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

38. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP031362 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

39. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052828 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

40. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052826 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

41. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP016409 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

42. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052824 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

43. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052822 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

44. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP016407 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

45. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052820 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

46. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP016413 (Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

47. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP016411 (Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

48. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052816 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

49. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to CP052814 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence) position: , mismatch: 7, identity: 0.767

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*  

50. spacer 1.1|692249|30|NZ_CP017475|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 8, identity: 0.733

caccaccgtcgccgttatcattgccgccgc	CRISPR spacer
ggtttcggtcgccgatatcatggccgccgc	Protospacer
 ... * ******* ****** ********

51. spacer 1.2|692303|30|NZ_CP017475|CRISPRCasFinder matches to KP881232 (Sinorhizobium phage phiM9, complete genome) position: , mismatch: 8, identity: 0.733

tgccattgtcactgttaccgccattatcag	CRISPR spacer
tgccattgccaccgttaccgccagctccgc	Protospacer
********.***.********** . .*. 

52. spacer 1.1|692249|30|NZ_CP017475|CRISPRCasFinder matches to MF417874 (Uncultured Caudovirales phage clone 3S_14, partial genome) position: , mismatch: 9, identity: 0.7

caccaccgtcgccgttatcattgccgccgc	CRISPR spacer
gcccagcgtagccgttatcattgccaaacg	Protospacer
  *** *** ***************.    

53. spacer 1.1|692249|30|NZ_CP017475|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7

caccaccgtcgccgttatcattgccgccgc	CRISPR spacer
aaagcccgtcgccgttatcatcgccgaaat	Protospacer
 *   ****************.****  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 967923 : 1008814 38 Enterobacteria_phage(20.0%) capsid,transposase,integrase attL 962270:962287|attR 1000179:1000196
DBSCAN-SWA_2 1140681 : 1208175 74 Cronobacter_phage(58.82%) tail,holin,protease,tRNA,plate,portal,terminase,head,integrase,capsid attL 1135521:1135542|attR 1192668:1192689
DBSCAN-SWA_3 1653714 : 1751680 99 Enterobacteria_phage(26.19%) tail,protease,tRNA,plate,portal,terminase NA
DBSCAN-SWA_4 2991563 : 3032099 53 Cronobacter_phage(37.21%) tail,transposase,terminase,head NA
DBSCAN-SWA_5 3123911 : 3132173 8 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_6 3302792 : 3311875 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_7 3626368 : 3724753 101 Burkholderia_virus(34.09%) tail,holin,transposase,tRNA,plate,integrase,capsid attL 3694680:3694697|attR 3733897:3733914
DBSCAN-SWA_8 3997552 : 4054142 54 Faecalibacterium_phage(20.0%) transposase,protease,tRNA,plate,integrase attL 4010712:4010728|attR 4054220:4054236
DBSCAN-SWA_9 4126376 : 4183395 64 Salmonella_phage(66.67%) tail,lysis,transposase,protease,tRNA,plate,portal,terminase,head,integrase,capsid attL 4136941:4136959|attR 4170407:4170425
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage