Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018630 Clostridium chauvoei strain 12S0467 chromosome, complete genome 4 crisprs cas3,DinG,csa3,DEDDh,WYL,cas6,cas8b1,cas7b,cas5,cas4,cas1,cas2,cas3HD 0 5 6 0
NZ_CP018631 Clostridium chauvoei strain 12S0467 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP018630
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018630_1 589021-589096 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018630_2 1310877-1312942 TypeI-B II-B
31 spacers
cas2,cas1,cas4,cas5,cas7b,cas8b1,cas6,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018630_3 1314506-1315196 TypeI-B II-B
10 spacers
cas2,cas1,cas4,cas5,cas7b,cas8b1,cas6,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018630_4 2613525-2613619 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018630_1 1.1|589045|28|NZ_CP018630|CRISPRCasFinder 589045-589072 28 AP014333 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S36-C55, *** SEQUENCING IN PROGRESS *** 176-203 6 0.786
NZ_CP018630_1 1.1|589045|28|NZ_CP018630|CRISPRCasFinder 589045-589072 28 NZ_AP018256 Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome 20366-20393 6 0.786
NZ_CP018630_2 2.3|1311039|37|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1311039-1311075 37 GU233956 Bacillus phage 11143, partial sequence 909-945 6 0.838
NZ_CP018630_1 1.1|589045|28|NZ_CP018630|CRISPRCasFinder 589045-589072 28 CAJDKA010000002 Enterococcus phage 163 genome assembly, contig: phage163-genome, whole genome shotgun sequence 140826-140853 7 0.75
NZ_CP018630_1 1.1|589045|28|NZ_CP018630|CRISPRCasFinder 589045-589072 28 MN241318 Enterococcus phage PEf771, complete genome 76284-76311 7 0.75
NZ_CP018630_1 1.1|589045|28|NZ_CP018630|CRISPRCasFinder 589045-589072 28 NZ_CP006904 Clostridium botulinum 202F plasmid pCBI, complete sequence 23073-23100 7 0.75
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 208366-208400 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NZ_CP004872 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB64, complete sequence 49358-49392 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NC_017205 Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT72, complete sequence 52490-52524 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NZ_CP010581 Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB68, complete sequence 60071-60105 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NZ_CP015179 Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB57, complete sequence 44583-44617 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NZ_CP015156 Bacillus thuringiensis strain Bc601 plasmid pBTBC6, complete sequence 57641-57675 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NZ_CP004869 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB67, complete sequence 13874-13908 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NZ_CP010093 Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB71, complete sequence 44424-44458 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NZ_CP021065 Bacillus thuringiensis strain ATCC 10792 plasmid poh4, complete sequence 21905-21939 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NC_018488 Bacillus thuringiensis HD-771 plasmid p04, complete sequence 34185-34219 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NZ_CP011358 Bacillus thuringiensis strain YC-10 plasmid pYC2226, complete sequence 45960-45994 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NC_018879 Bacillus thuringiensis Bt407 plasmid BTB_78p, complete sequence 9313-9347 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NZ_CP013057 Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-2, complete sequence 45135-45169 7 0.8
NZ_CP018630_2 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312550-1312584 35 NC_020382 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-68, complete sequence 15049-15083 7 0.8
NZ_CP018630_2 2.3|1311039|37|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1311039-1311075 37 NZ_CP026602 Clostridiaceae bacterium 14S0207 plasmid unnamed2, complete sequence 9474-9510 8 0.784
NZ_CP018630_2 2.10|1311500|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1311500-1311534 35 NZ_CP042875 Bacillus cereus strain 09 plasmid unnamed1, complete sequence 367216-367250 8 0.771
NZ_CP018630_2 2.10|1311500|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1311500-1311534 35 NC_010858 Campylobacter fetus subsp. venerealis plasmid pCFV108, complete sequence 1505-1539 9 0.743
NZ_CP018630_2 2.29|1312747|34|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312747-1312780 34 MG788324 Lactobacillus phage PM411, complete genome 33624-33657 10 0.706
NZ_CP018630_2 2.29|1312747|34|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312747-1312780 34 NZ_CP024415 Lactobacillus plantarum strain ATCC 8014 plasmid pLP39, complete sequence 15902-15935 11 0.676
NZ_CP018630_2 2.29|1312747|34|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT 1312747-1312780 34 NZ_CP018210 Lactobacillus plantarum strain BLS41 plasmid pLPBLS41_1, complete sequence 34470-34503 11 0.676

1. spacer 1.1|589045|28|NZ_CP018630|CRISPRCasFinder matches to AP014333 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S36-C55, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.786

taggcaacagaaaaacctaaaagatttg	CRISPR spacer
gatttaacagaaaaacctaaaagttttt	Protospacer
 *  .****************** *** 

2. spacer 1.1|589045|28|NZ_CP018630|CRISPRCasFinder matches to NZ_AP018256 (Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome) position: , mismatch: 6, identity: 0.786

taggcaacagaaaaacctaaaagatttg	CRISPR spacer
caaccaacagaacaacctaaaatatttc	Protospacer
.*. ******** ********* **** 

3. spacer 2.3|1311039|37|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to GU233956 (Bacillus phage 11143, partial sequence) position: , mismatch: 6, identity: 0.838

caggagtcgttgtatttgatgaaatacatgaatatga	CRISPR spacer
atggtgcagttgtatttgatgaaatacatcaatatga	Protospacer
  ** *. ********************* *******

4. spacer 1.1|589045|28|NZ_CP018630|CRISPRCasFinder matches to CAJDKA010000002 (Enterococcus phage 163 genome assembly, contig: phage163-genome, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.75

taggcaacagaaaaacctaaaagatttg	CRISPR spacer
taggcaacagaaaaacctaatattcaaa	Protospacer
******************** *  .  .

5. spacer 1.1|589045|28|NZ_CP018630|CRISPRCasFinder matches to MN241318 (Enterococcus phage PEf771, complete genome) position: , mismatch: 7, identity: 0.75

taggcaacagaaaaacctaaaagatttg	CRISPR spacer
taggcaacagaaaaacctaatattcaaa	Protospacer
******************** *  .  .

6. spacer 1.1|589045|28|NZ_CP018630|CRISPRCasFinder matches to NZ_CP006904 (Clostridium botulinum 202F plasmid pCBI, complete sequence) position: , mismatch: 7, identity: 0.75

taggcaacagaaaaacctaaaagatttg	CRISPR spacer
atggcaagagaaaaacctgaaagatcat	Protospacer
  ***** **********.******.  

7. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 7, identity: 0.8

attctttg-----cttttatctctatatttaactatctct	CRISPR spacer
-----ttgaaatttttttatctctatatttaaatatctct	Protospacer
     ***     .****************** *******

8. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP004872 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB64, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

9. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NC_017205 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT72, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

10. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010581 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB68, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

11. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015179 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB57, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

12. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015156 (Bacillus thuringiensis strain Bc601 plasmid pBTBC6, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

13. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP004869 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB67, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

14. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010093 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB71, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

15. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021065 (Bacillus thuringiensis strain ATCC 10792 plasmid poh4, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

16. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NC_018488 (Bacillus thuringiensis HD-771 plasmid p04, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

17. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011358 (Bacillus thuringiensis strain YC-10 plasmid pYC2226, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

18. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NC_018879 (Bacillus thuringiensis Bt407 plasmid BTB_78p, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

19. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013057 (Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-2, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

20. spacer 2.26|1312550|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NC_020382 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-68, complete sequence) position: , mismatch: 7, identity: 0.8

attctttgcttttatctctatatttaactatctct	CRISPR spacer
tttgttattttttatctctatatttatctatatct	Protospacer
 ** **  .***************** **** ***

21. spacer 2.3|1311039|37|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026602 (Clostridiaceae bacterium 14S0207 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.784

caggagt-----cgttgtatttgatgaaatacatgaatatga	CRISPR spacer
-----gtgcttgccttatttttgatgaaatacatgaatatga	Protospacer
     **     * **.* ***********************

22. spacer 2.10|1311500|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042875 (Bacillus cereus strain 09 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.771

agtgaaaaagaaaaggaaattagaaagaaaataag	CRISPR spacer
acagattttgaagaggaaattaaaaagaaaataag	Protospacer
*  **    ***.*********.************

23. spacer 2.10|1311500|35|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NC_010858 (Campylobacter fetus subsp. venerealis plasmid pCFV108, complete sequence) position: , mismatch: 9, identity: 0.743

agtgaaaaagaaaaggaaattagaaagaaaataag	CRISPR spacer
agacaaaaataaaagaaaattagaaagaactatac	Protospacer
**  ***** *****.*************    * 

24. spacer 2.29|1312747|34|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to MG788324 (Lactobacillus phage PM411, complete genome) position: , mismatch: 10, identity: 0.706

aaaaggagctgatgggaatcaaggaccaattgga	CRISPR spacer
cttaactggtgatgggaatcaaaaaccaattggc	Protospacer
   *.  * *************..********* 

25. spacer 2.29|1312747|34|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024415 (Lactobacillus plantarum strain ATCC 8014 plasmid pLP39, complete sequence) position: , mismatch: 11, identity: 0.676

aaaaggagctgatgggaatcaaggaccaattgga	CRISPR spacer
cttgactggtgatgggaatcaaaaaccaattggc	Protospacer
   ..  * *************..********* 

26. spacer 2.29|1312747|34|NZ_CP018630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018210 (Lactobacillus plantarum strain BLS41 plasmid pLPBLS41_1, complete sequence) position: , mismatch: 11, identity: 0.676

aaaaggagctgatgggaatcaaggaccaattgga	CRISPR spacer
cttgactggtgatgggaatcaaaaaccaattggc	Protospacer
   ..  * *************..********* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 522509 : 585073 48 Planktothrix_phage(25.0%) integrase,transposase attL 524208:524224|attR 586917:586933
DBSCAN-SWA_2 707972 : 739957 29 Synechococcus_phage(25.0%) holin,transposase NA
DBSCAN-SWA_3 1270705 : 1283786 12 Cyanophage(25.0%) NA NA
DBSCAN-SWA_4 1727053 : 1735770 9 uncultured_Mediterranean_phage(33.33%) integrase attL 1733675:1733690|attR 1738175:1738190
DBSCAN-SWA_5 1991782 : 2018613 34 Clostridium_phage(42.11%) tail,capsid,integrase,coat,portal,terminase attL 1996478:1996496|attR 2024772:2024790
DBSCAN-SWA_6 2627723 : 2675763 47 Clostridium_phage(25.0%) protease,transposase,coat,integrase attL 2647300:2647359|attR 2669313:2669472
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage