Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP017368 Candidatus Desulfovibrio trichonymphae strain Rs-N31 2 crisprs csx1,csx16,cas3-cas2,cas3f,csa3 0 2 2 0

Results visualization

1. NZ_AP017368
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017368_1 287684-289028 Orphan I-C
20 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017368_2 1072019-1072107 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP017368_1 1.19|288896|35|NZ_AP017368|PILER-CR,CRISPRCasFinder,CRT 288896-288930 35 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 400048-400082 7 0.8
NZ_AP017368_1 1.4|287911|34|NZ_AP017368|PILER-CR,CRISPRCasFinder,CRT 287911-287944 34 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 231222-231255 9 0.735

1. spacer 1.19|288896|35|NZ_AP017368|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.8

aatgtcctcgtcgtcgaaccgattgacagccgcga	CRISPR spacer
aatggcctcgtcgtcgaaacgattgacttgctgga	Protospacer
**** ************* ********   *  **

2. spacer 1.4|287911|34|NZ_AP017368|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.735

ggcttcgaggacgtgcgcctgctggtacgctcac	CRISPR spacer
ggcttcgacgacgtgcgcatgctgctccaggtgc	Protospacer
******** ********* ***** * *.  ..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1119269 : 1129282 10 Staphylococcus_phage(37.5%) tRNA NA
DBSCAN-SWA_2 1266449 : 1280968 10 Tupanvirus(22.22%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage