Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP015031 Pseudomonas putida strain KF715 plasmid pKF715B, complete sequence 0 crisprs csa3,RT 0 0 0 0
NZ_AP015029 Pseudomonas putida strain KF715 chromosome 1 4 crisprs RT,WYL,DEDDh,cas3,csa3,DinG 0 0 10 0
NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 2 crisprs RT,Cas14u_CAS-V,csf3gr5,csf2gr7,csf1gr8,csf5gr6,DinG 0 11 1 0
NZ_AP015032 Pseudomonas putida strain KF715 plasmid pKF715C, complete sequence 0 crisprs NA 0 0 2 0
NZ_AP015033 Pseudomonas putida strain KF715 plasmid pKF715D, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_AP015029
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP015029_1 881153-881264 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP015029_2 3780144-3780284 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP015029_3 4328709-4328782 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP015029_4 5376662-5376757 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 268893 : 371801 107 Pseudomonas_virus(33.33%) plate,terminase,lysis,protease,tail,holin,capsid,portal,integrase,head attL 307724:307771|attR 341729:341776
DBSCAN-SWA_2 1204585 : 1212365 10 Thermobifida_phage(16.67%) NA NA
DBSCAN-SWA_3 1429990 : 1488684 50 Cafeteria_roenbergensis_virus(11.11%) tRNA,transposase,protease NA
DBSCAN-SWA_4 2220880 : 2282752 56 Bacillus_virus(10.0%) coat,protease NA
DBSCAN-SWA_5 3799855 : 3845729 66 Pseudomonas_phage(64.0%) terminase,integrase,transposase attL 3837916:3837930|attR 3851187:3851201
DBSCAN-SWA_6 4109970 : 4176013 78 Pseudomonas_phage(43.48%) tRNA,terminase,protease,tail,capsid,portal,integrase,head attL 4112524:4112538|attR 4177608:4177622
DBSCAN-SWA_7 4248638 : 4259614 13 uncultured_Caudovirales_phage(77.78%) tRNA NA
DBSCAN-SWA_8 5699704 : 5707688 9 uncultured_Caudovirales_phage(50.0%) transposase NA
DBSCAN-SWA_9 5928830 : 5939128 7 Agrobacterium_phage(16.67%) NA NA
DBSCAN-SWA_10 6529410 : 6538490 10 uncultured_Caudovirales_phage(75.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AP015030
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP015030_1 113395-113607 TypeIV-A NA
3 spacers
csf3gr5,csf2gr7,csf1gr8,csf5gr6,DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP015030_2 113760-114278 TypeIV-A NA
8 spacers
csf3gr5,csf2gr7,csf1gr8,csf5gr6,DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP015030_1 1.1|113424|32|NZ_AP015030|CRISPRCasFinder 113424-113455 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 113424-113455 0 1.0
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 113485-113516 0 1.0
NZ_AP015030_1 1.3|113546|32|NZ_AP015030|CRISPRCasFinder 113546-113577 32 NZ_CP018048 Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence 38022-38053 0 1.0
NZ_AP015030_1 1.3|113546|32|NZ_AP015030|CRISPRCasFinder 113546-113577 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 113546-113577 0 1.0
NZ_AP015030_2 2.1|113789|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 113789-113820 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 113789-113820 0 1.0
NZ_AP015030_2 2.2|113850|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 113850-113881 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 113850-113881 0 1.0
NZ_AP015030_2 2.3|113911|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 113911-113942 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 113911-113942 0 1.0
NZ_AP015030_2 2.4|113972|33|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 113972-114004 33 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 113972-114004 0 1.0
NZ_AP015030_2 2.5|114034|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 114034-114065 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 114034-114065 0 1.0
NZ_AP015030_2 2.6|114095|33|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 114095-114127 33 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 114095-114127 0 1.0
NZ_AP015030_2 2.7|114157|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 114157-114188 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 114157-114188 0 1.0
NZ_AP015030_2 2.8|114218|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 114218-114249 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 114218-114249 0 1.0
NZ_AP015030_1 1.1|113424|32|NZ_AP015030|CRISPRCasFinder 113424-113455 32 NZ_CP018048 Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence 38144-38175 1 0.969
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 NZ_CP042557 Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence 78512-78543 2 0.938
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 80030-80061 2 0.938
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 NZ_MH547561 Pseudomonas aeruginosa strain PA34 plasmid pMKPA34-2, complete sequence 22232-22263 2 0.938
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 300500-300531 3 0.906
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 NZ_CP026206 Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence 52232-52263 3 0.906
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 NZ_CP026404 Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence 126535-126566 3 0.906
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 NZ_CP030920 Escherichia coli strain KL53 plasmid pKL53-L, complete sequence 172544-172575 3 0.906
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 186127-186158 3 0.906
NZ_AP015030_2 2.5|114034|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 114034-114065 32 NZ_CP019084 Paludisphaera borealis strain PX4 plasmid PALBO2, complete sequence 7487-7518 7 0.781
NZ_AP015030_2 2.7|114157|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 114157-114188 32 MT586120 Synechococcus phage S-CAM7 isolate 0809CC03, complete genome 83845-83876 8 0.75
NZ_AP015030_2 2.7|114157|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 114157-114188 32 NC_031927 Synechococcus phage S-CAM7 isolate 0910CC49, complete genome 82766-82797 8 0.75
NZ_AP015030_2 2.7|114157|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 114157-114188 32 KU686213 Synechococcus phage S-CAM7 isolate 0910SB42, complete genome 84389-84420 8 0.75
NZ_AP015030_2 2.8|114218|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT 114218-114249 32 NZ_CP048879 Oceanospirillales bacterium S2-4-1H plasmid pA, complete sequence 70886-70917 8 0.75
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 NZ_CP050107 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b1, complete sequence 94550-94581 9 0.719
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 NZ_CP050112 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b5, complete sequence 94549-94580 9 0.719
NZ_AP015030_1 1.2|113485|32|NZ_AP015030|CRISPRCasFinder 113485-113516 32 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 11539-11570 9 0.719
NZ_AP015030_1 1.1|113424|32|NZ_AP015030|CRISPRCasFinder 113424-113455 32 NZ_CP031005 Lactobacillus curvatus strain TMW 1.1928 plasmid p-1.1928_2, complete sequence 16349-16380 11 0.656

1. spacer 1.1|113424|32|NZ_AP015030|CRISPRCasFinder matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

ttcgcgcttgctcatttctcatccccacagcc	CRISPR spacer
ttcgcgcttgctcatttctcatccccacagcc	Protospacer
********************************

2. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tgcggcctctgctgaaagcgagctgacgtgta	Protospacer
********************************

3. spacer 1.3|113546|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP018048 (Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aaccgtcaataccccttcaaatccccaaaata	CRISPR spacer
aaccgtcaataccccttcaaatccccaaaata	Protospacer
********************************

4. spacer 1.3|113546|32|NZ_AP015030|CRISPRCasFinder matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

aaccgtcaataccccttcaaatccccaaaata	CRISPR spacer
aaccgtcaataccccttcaaatccccaaaata	Protospacer
********************************

5. spacer 2.1|113789|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

ggattccggtgccggtgggaatccagggaacc	CRISPR spacer
ggattccggtgccggtgggaatccagggaacc	Protospacer
********************************

6. spacer 2.2|113850|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

cggggcaggttcattctgtcacccactggctg	CRISPR spacer
cggggcaggttcattctgtcacccactggctg	Protospacer
********************************

7. spacer 2.3|113911|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

tgtttcatgaccgatctcccttagttctcaaa	CRISPR spacer
tgtttcatgaccgatctcccttagttctcaaa	Protospacer
********************************

8. spacer 2.4|113972|33|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

gccctaggcagcctcgcgtgcagccagtccagt	CRISPR spacer
gccctaggcagcctcgcgtgcagccagtccagt	Protospacer
*********************************

9. spacer 2.5|114034|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

cgggcactgctcacccgcttgggcggtactta	CRISPR spacer
cgggcactgctcacccgcttgggcggtactta	Protospacer
********************************

10. spacer 2.6|114095|33|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

gctcttgcgcataacagaatgctcacgccggag	CRISPR spacer
gctcttgcgcataacagaatgctcacgccggag	Protospacer
*********************************

11. spacer 2.7|114157|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

atctggtaatcatgggtatttcaaggggcact	CRISPR spacer
atctggtaatcatgggtatttcaaggggcact	Protospacer
********************************

12. spacer 2.8|114218|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

ggattaatccccctgttttgctcgatagtcac	CRISPR spacer
ggattaatccccctgttttgctcgatagtcac	Protospacer
********************************

13. spacer 1.1|113424|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP018048 (Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ttcgcgcttgctcatttctcatccccacagcc	CRISPR spacer
ttcgcgcttgctcatttctcacccccacagcc	Protospacer
*********************.**********

14. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP042557 (Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence) position: , mismatch: 2, identity: 0.938

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tgcggcctctgctgagagcgagctaacgtgta	Protospacer
***************.********.*******

15. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 2, identity: 0.938

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tgcggcctctgctgagagcgagctaacgtgta	Protospacer
***************.********.*******

16. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to NZ_MH547561 (Pseudomonas aeruginosa strain PA34 plasmid pMKPA34-2, complete sequence) position: , mismatch: 2, identity: 0.938

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tgcggcctctgctgagagcgagctaacgtgta	Protospacer
***************.********.*******

17. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 3, identity: 0.906

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tacggcctctgctgagagcgagctgacatgta	Protospacer
*.*************.***********.****

18. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 3, identity: 0.906

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tacggcctctgctgagagcgagctgacatgta	Protospacer
*.*************.***********.****

19. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP026404 (Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence) position: , mismatch: 3, identity: 0.906

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tacggcctctgctgagagcgagctgacatgta	Protospacer
*.*************.***********.****

20. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 3, identity: 0.906

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tacggcctctgctgagagcgagctgacatgta	Protospacer
*.*************.***********.****

21. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 3, identity: 0.906

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tacggcctctgctgagagcgagctgacatgta	Protospacer
*.*************.***********.****

22. spacer 2.5|114034|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019084 (Paludisphaera borealis strain PX4 plasmid PALBO2, complete sequence) position: , mismatch: 7, identity: 0.781

cgggcactgctcacccgcttgggcg-gtactta	CRISPR spacer
caggcactgcttgcccgcttgggcgagcacgc-	Protospacer
*.*********..************ *.** . 

23. spacer 2.7|114157|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 8, identity: 0.75

atctggtaatcatgggtatttcaaggggcact----	CRISPR spacer
atctggtgatcttgggtatttca----gctttggtg	Protospacer
*******.*** ***********    ** .*    

24. spacer 2.7|114157|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 8, identity: 0.75

atctggtaatcatgggtatttcaaggggcact----	CRISPR spacer
atctggtgatcttgggtatttca----gctttggtg	Protospacer
*******.*** ***********    ** .*    

25. spacer 2.7|114157|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 8, identity: 0.75

atctggtaatcatgggtatttcaaggggcact----	CRISPR spacer
atctggtgatcttgggtatttca----gctttggtg	Protospacer
*******.*** ***********    ** .*    

26. spacer 2.8|114218|32|NZ_AP015030|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048879 (Oceanospirillales bacterium S2-4-1H plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.75

ggattaatccccctgttttgctcga-tagtcac	CRISPR spacer
tcattaatccccctgttttgtccgagtaggtt-	Protospacer
  ******************..*** *** .  

27. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP050107 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b1, complete sequence) position: , mismatch: 9, identity: 0.719

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tgcggcctctgctgaaagaaagcggggcggcg	Protospacer
****************** .*** *.   *..

28. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP050112 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b5, complete sequence) position: , mismatch: 9, identity: 0.719

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tgcggcctctgctgaaagaaagcggggcggcg	Protospacer
****************** .*** *.   *..

29. spacer 1.2|113485|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 9, identity: 0.719

tgcggcctctgctgaaagcgagctgacgtgta	CRISPR spacer
tgcggcctctgctgaaagaaagcggggcggcg	Protospacer
****************** .*** *.   *..

30. spacer 1.1|113424|32|NZ_AP015030|CRISPRCasFinder matches to NZ_CP031005 (Lactobacillus curvatus strain TMW 1.1928 plasmid p-1.1928_2, complete sequence) position: , mismatch: 11, identity: 0.656

ttcgcgcttgctcatttctcatccccacagcc	CRISPR spacer
agggcgcttgctcatttatcgtccccttcttt	Protospacer
   ************** **.***** .  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 271797 : 282538 14 Morganella_phage(20.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_AP015032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 66710 : 77112 12 Pseudomonas_phage(55.56%) terminase NA
DBSCAN-SWA_2 83041 : 93451 17 Pseudomonas_virus(20.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage