1. spacer 1.1|1867355|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP032678 (Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence) position: , mismatch: 5, identity: 0.844
gcatccgtgagaatgagggggat-ggcaacggg CRISPR spacer
gcatccgtgagaatgagggagataagcgatgg- Protospacer
*******************.*** .**.*.**
2. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 5, identity: 0.844
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacagcacgac Protospacer
******** ************ * ******
3. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 5, identity: 0.844
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacagcacgac Protospacer
******** ************ * ******
4. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 5, identity: 0.844
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacagcacgac Protospacer
******** ************ * ******
5. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 5, identity: 0.844
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacagcacgac Protospacer
******** ************ * ******
6. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacagcacgac Protospacer
******** ************ * ******
7. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 5, identity: 0.844
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacagcacgac Protospacer
******** ************ * ******
8. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 5, identity: 0.844
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacagcacgac Protospacer
******** ************ * ******
9. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 5, identity: 0.844
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacagcacgac Protospacer
******** ************ * ******
10. spacer 1.24|1868758|32|NZ_AP014836|CRISPRCasFinder matches to NC_042091 (Pseudomonas phage nickie, complete genome) position: , mismatch: 6, identity: 0.812
--tgcaggatatctttaaaaaacgtttttactac CRISPR spacer
aaagcaga--atctttcaaaaacgtttttgctac Protospacer
****. ****** ************.****
11. spacer 1.38|1869612|32|NZ_AP014836|CRISPRCasFinder matches to MT108723 (Pseudomonas phage Epa1, complete genome) position: , mismatch: 6, identity: 0.812
acaaggagaaacaaaatggttaga--cgagtaaa CRISPR spacer
ccaaggagaaacaaaatggctcgactcaagta-- Protospacer
******************.* ** *.****
12. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.812
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacaacacgac Protospacer
******** ************ * **.***
13. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.812
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacaacacgac Protospacer
******** ************ * **.***
14. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.812
gcatcatcccccgcatcatcgcaccagcacct- CRISPR spacer
gcatcatcgcccgcatcatcg-aacaacacgac Protospacer
******** ************ * **.***
15. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacagcacgacc-- Protospacer
******** ************ ** ** ***
16. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacagcacgacc-- Protospacer
******** ************ ** ** ***
17. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacagcacgacc-- Protospacer
******** ************ ** ** ***
18. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacagcacgacc-- Protospacer
******** ************ ** ** ***
19. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacaacacgacc-- Protospacer
******** ************ ** ** ***
20. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacagcacgacc-- Protospacer
******** ************ ** ** ***
21. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacaacacgacc-- Protospacer
******** ************ ** ** ***
22. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacagcacgacc-- Protospacer
******** ************ ** ** ***
23. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacagcacgacc-- Protospacer
******** ************ ** ** ***
24. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacagcacgacc-- Protospacer
******** ************ ** ** ***
25. spacer 1.135|1871076|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.818
gcatcatcccccgcatcatcg--caccagcaccta CRISPR spacer
gcatcatcgcccgcatcatcgaacaacacgacc-- Protospacer
******** ************ ** ** ***
26. spacer 1.18|1868392|32|NZ_AP014836|CRISPRCasFinder matches to MG030346 (Proteus phage PM87, complete genome) position: , mismatch: 7, identity: 0.781
aaaaaaatgagcgtacaaaaatt----aaaaacttt CRISPR spacer
caaaaaatgagcgtacaaaatttatacagaaa---- Protospacer
******************* ** *.***
27. spacer 1.18|1868392|32|NZ_AP014836|CRISPRCasFinder matches to CP059058 (Proteus phage ASh-2020a, complete genome) position: , mismatch: 7, identity: 0.781
aaaaaaatgagcgtacaaaaatt----aaaaacttt CRISPR spacer
caaaaaatgagcgtacaaaatttatacagaaa---- Protospacer
******************* ** *.***
28. spacer 1.18|1868392|32|NZ_AP014836|CRISPRCasFinder matches to MN840486 (Proteus phage P16-2532, complete genome) position: , mismatch: 7, identity: 0.781
aaaaaaatgagcgtacaaaaatt----aaaaacttt CRISPR spacer
caaaaaatgagcgtacaaaatttatacagaaa---- Protospacer
******************* ** *.***
29. spacer 1.18|1868392|32|NZ_AP014836|CRISPRCasFinder matches to MN604053 (Escherichia phage E21, complete genome) position: , mismatch: 7, identity: 0.781
aaaaaaatgagcgtacaaaaatt----aaaaacttt CRISPR spacer
caaaaaatgagcgtacaaaatttatacagaaa---- Protospacer
******************* ** *.***
30. spacer 1.18|1868392|32|NZ_AP014836|CRISPRCasFinder matches to KP063118 (Proteus phage pPM_01, complete genome) position: , mismatch: 7, identity: 0.781
aaaaaaatgagcgtacaaaaatt----aaaaacttt CRISPR spacer
caaaaaatgagcgtacaaaatttatacagaaa---- Protospacer
******************* ** *.***
31. spacer 1.19|1868453|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP044300 (Escherichia coli strain P59A plasmid pP59A-2, complete sequence) position: , mismatch: 7, identity: 0.781
attcaagtcacctacctttacttcacagaaaa CRISPR spacer
actaatgtcacttacttttacttcacagatat Protospacer
*.* * *****.***.************* *
32. spacer 1.19|1868453|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP040928 (Escherichia coli strain YY76-1 plasmid pYY76-1-1, complete sequence) position: , mismatch: 7, identity: 0.781
attcaagtcacctacctttacttcacagaaaa CRISPR spacer
actaatgtcacttacttttacttcacagatat Protospacer
*.* * *****.***.************* *
33. spacer 1.19|1868453|32|NZ_AP014836|CRISPRCasFinder matches to MG516909 (Escherichia coli plasmid pEc1675, complete sequence) position: , mismatch: 7, identity: 0.781
attcaagtcacctacctttacttcacagaaaa CRISPR spacer
actaatgtcacttacttttacttcacagatat Protospacer
*.* * *****.***.************* *
34. spacer 1.19|1868453|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP010244 (Escherichia coli strain S56 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.781
attcaagtcacctacctttacttcacagaaaa CRISPR spacer
actaatgtcacttacttttacttcacagatat Protospacer
*.* * *****.***.************* *
35. spacer 1.19|1868453|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP033252 (Escherichia coli strain ECCHD184 plasmid pTB212, complete sequence) position: , mismatch: 7, identity: 0.781
attcaagtcacctacctttacttcacagaaaa CRISPR spacer
actaatgtcacttacttttacttcacagatat Protospacer
*.* * *****.***.************* *
36. spacer 1.58|1870832|32|NZ_AP014836|CRISPRCasFinder matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 7, identity: 0.781
ttgatggaacatgggaagacggcgctaaagac CRISPR spacer
ctgacggaagatgggaagacggcgctgcagga Protospacer
.***.**** ****************. **.
37. spacer 1.66|1871320|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP031070 (Bacillus sp. JAS24-2 plasmid pl278, complete sequence) position: , mismatch: 7, identity: 0.781
ctagatgttctcattatatgaaaaagtatatt CRISPR spacer
cttgatattctcattatatgaaaatattcctt Protospacer
** ***.***************** .* . **
38. spacer 1.66|1871320|32|NZ_AP014836|CRISPRCasFinder matches to KY794642 (Staphylococcus phage vB_Sau_Clo6, complete genome) position: , mismatch: 7, identity: 0.781
ctagatgt-tctcattatatgaaaaagtatatt CRISPR spacer
-gaaaggtaactctttatatgaaaaagaatatt Protospacer
*.* ** *** ************* *****
39. spacer 1.97|1868758|33|NZ_AP014836|CRT,PILER-CR matches to NC_042091 (Pseudomonas phage nickie, complete genome) position: , mismatch: 7, identity: 0.788
--tgcaggatatctttaaaaaacgtttttactaca CRISPR spacer
aaagcaga--atctttcaaaaacgtttttgctact Protospacer
****. ****** ************.****
40. spacer 1.111|1869612|33|NZ_AP014836|CRT,PILER-CR matches to MT108723 (Pseudomonas phage Epa1, complete genome) position: , mismatch: 7, identity: 0.788
acaaggagaaacaaaatggttaga--cgagtaaaa CRISPR spacer
ccaaggagaaacaaaatggctcgactcaagtac-- Protospacer
******************.* ** *.****
41. spacer 1.139|1871320|33|NZ_AP014836|CRT,PILER-CR matches to KY794642 (Staphylococcus phage vB_Sau_Clo6, complete genome) position: , mismatch: 7, identity: 0.788
ctagatgt-tctcattatatgaaaaagtatattg CRISPR spacer
-gaaaggtaactctttatatgaaaaagaatattg Protospacer
*.* ** *** ************* ******
42. spacer 1.34|1869368|32|NZ_AP014836|CRISPRCasFinder matches to NC_015063 (Rahnella sp. Y9602 plasmid pRAHAQ02, complete sequence) position: , mismatch: 8, identity: 0.75
ttttagagtatgtaaaagataaccctaaaccc CRISPR spacer
tttaagagtatgtaaaagataacgtgatgaca Protospacer
*** ******************* . * . *
43. spacer 1.50|1870344|32|NZ_AP014836|CRISPRCasFinder matches to NC_012529 (Deinococcus deserti VCD115 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75
agccg-tgccccttcaacgcgccctgaaacctt CRISPR spacer
-gctgctgcgccttgaacgcgccctgaaaaaag Protospacer
**.* *** **** **************
44. spacer 1.51|1870405|32|NZ_AP014836|CRISPRCasFinder matches to MK295204 (Shigella phage vB_SdyM_006, complete genome) position: , mismatch: 8, identity: 0.75
agcatacgatagaaaaagtaataataaagggg CRISPR spacer
aaaaatgtatagaaaaattaataataaatggg Protospacer
*. * ********* ********** ***
45. spacer 1.51|1870405|32|NZ_AP014836|CRISPRCasFinder matches to MG696114 (Proteus phage phiP4-3, complete genome) position: , mismatch: 8, identity: 0.75
agcatacgatagaaaaagtaataataaagggg CRISPR spacer
aaaaatgtatagaaaaattaataataaatggg Protospacer
*. * ********* ********** ***
46. spacer 1.62|1871076|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP038639 (Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
gcatcatc--ccccgcatcatcgcaccagcacct CRISPR spacer
--cttaccggccccgcgtcatcgcactagcaccg Protospacer
*.*.* ******.*********.******
47. spacer 1.63|1871137|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP041297 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence) position: , mismatch: 8, identity: 0.75
tataaaaaagtcatgagcagcgctaaaaataa CRISPR spacer
attcaacaagtaatgagcagcgctaaaaactg Protospacer
* ** **** *****************. .
48. spacer 1.69|1871503|32|NZ_AP014836|CRISPRCasFinder matches to MK448912 (Streptococcus phage Javan340, complete genome) position: , mismatch: 8, identity: 0.75
---tagcttcctctagaaccgtttgttttttattg CRISPR spacer
ttttaggatctt---gaacagtttgttttttatta Protospacer
*** **.* **** **************.
49. spacer 1.72|1871686|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
ccttggcaacagcagtccgatcttcttcctcg CRISPR spacer
ccgcttcgacagcggtccgaccttcttcctct Protospacer
** . *.*****.******.**********
50. spacer 1.72|1871686|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.75
ccttggcaacagcagtccgatcttcttcctcg CRISPR spacer
ccgcttcgacagcggtccgaccttcttcctct Protospacer
** . *.*****.******.**********
51. spacer 1.131|1870832|33|NZ_AP014836|CRT,PILER-CR matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 8, identity: 0.758
ttgatggaacatgggaagacggcgctaaagaca CRISPR spacer
ctgacggaagatgggaagacggcgctgcaggag Protospacer
.***.**** ****************. **. .
52. spacer 1.139|1871320|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP031070 (Bacillus sp. JAS24-2 plasmid pl278, complete sequence) position: , mismatch: 8, identity: 0.758
ctagatgttctcattatatgaaaaagtatattg CRISPR spacer
cttgatattctcattatatgaaaatattccttt Protospacer
** ***.***************** .* . **
53. spacer 1.16|1868270|32|NZ_AP014836|CRISPRCasFinder matches to NC_014563 (Pantoea vagans C9-1 plasmid pPag2, complete sequence) position: , mismatch: 9, identity: 0.719
ccggctctgtaccaagtcagtgaaagcgacca CRISPR spacer
caggctctgtaccagctcagtgaaaccacggg Protospacer
* ************. ********* *. .
54. spacer 1.38|1869612|32|NZ_AP014836|CRISPRCasFinder matches to MN694325 (Marine virus AFVG_250M692, complete genome) position: , mismatch: 9, identity: 0.719
acaaggagaaacaaaatggttagacgagtaaa CRISPR spacer
cgatggagaaacaaaatgggtagaagaaaagg Protospacer
* *************** **** **. *..
55. spacer 1.38|1869612|32|NZ_AP014836|CRISPRCasFinder matches to MN694691 (Marine virus AFVG_250M693, complete genome) position: , mismatch: 9, identity: 0.719
acaaggagaaacaaaatggttagacgagtaaa CRISPR spacer
cgatggagaaacaaaatgggtagaagaaaagg Protospacer
* *************** **** **. *..
56. spacer 1.44|1869978|32|NZ_AP014836|CRISPRCasFinder matches to NC_048639 (Pseudomonas phage ZC08, complete genome) position: , mismatch: 9, identity: 0.719
gcttggaacgcatcacagaactgaaaaaaagc CRISPR spacer
tccttatacacatcacagaactgaacaaaact Protospacer
*.* . **.*************** **** .
57. spacer 1.44|1869978|32|NZ_AP014836|CRISPRCasFinder matches to NC_048638 (Pseudomonas phage ZC03, complete genome) position: , mismatch: 9, identity: 0.719
gcttggaacgcatcacagaactgaaaaaaagc CRISPR spacer
tccttatacacatcacagaactgaacaaaact Protospacer
*.* . **.*************** **** .
58. spacer 1.51|1870405|32|NZ_AP014836|CRISPRCasFinder matches to MH616719 (Inoviridae sp. isolate ctbi9, complete genome) position: , mismatch: 9, identity: 0.719
agcatacgatagaaaaagtaataataaagggg CRISPR spacer
ttaaggtaatataaaaaggaataataaagggg Protospacer
* ...*** ****** *************
59. spacer 1.51|1870405|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP021745 (Agarilytica rhodophyticola strain 017 plasmid pSU1, complete sequence) position: , mismatch: 9, identity: 0.719
agcatacgatagaaaaagtaataataaagggg CRISPR spacer
tggataccatagaaaaagtaacaatagcaaag Protospacer
* **** *************.****. ...*
60. spacer 1.51|1870405|32|NZ_AP014836|CRISPRCasFinder matches to MT080592 (UNVERIFIED: Staphylococcus phage vB_SauM_EW3, complete genome) position: , mismatch: 9, identity: 0.719
agcatacgatagaaaaagtaataataaagggg CRISPR spacer
agcatacgacagaaaaggtaatatactagcta Protospacer
*********.******.****** ** .
61. spacer 1.51|1870405|32|NZ_AP014836|CRISPRCasFinder matches to MT080603 (UNVERIFIED: Staphylococcus phage vB_SauM_EW9, complete genome) position: , mismatch: 9, identity: 0.719
agcatacgatagaaaaagtaataataaagggg CRISPR spacer
agcatacgacagaaaaggtaatatactagcta Protospacer
*********.******.****** ** .
62. spacer 1.51|1870405|32|NZ_AP014836|CRISPRCasFinder matches to MT080597 (UNVERIFIED: Staphylococcus phage vB_SauM_EW5, complete genome) position: , mismatch: 9, identity: 0.719
agcatacgatagaaaaagtaataataaagggg CRISPR spacer
agcatacgacagaaaaggtaatatactagcta Protospacer
*********.******.****** ** .
63. spacer 1.51|1870405|32|NZ_AP014836|CRISPRCasFinder matches to MT080598 (UNVERIFIED: Staphylococcus phage vB_SauM_EW6, complete genome) position: , mismatch: 9, identity: 0.719
agcatacgatagaaaaagtaataataaagggg CRISPR spacer
agcatacgacagaaaaggtaatatactagcta Protospacer
*********.******.****** ** .
64. spacer 1.51|1870405|32|NZ_AP014836|CRISPRCasFinder matches to MT080599 (UNVERIFIED: Staphylococcus phage vB_SauM_EW7, complete genome) position: , mismatch: 9, identity: 0.719
agcatacgatagaaaaagtaataataaagggg CRISPR spacer
agcatacgacagaaaaggtaatatactagcta Protospacer
*********.******.****** ** .
65. spacer 1.52|1870466|32|NZ_AP014836|CRISPRCasFinder matches to NZ_AP019857 (Escherichia coli O8:H8 strain 16F5M1D1 plasmid p16F5M1D101, complete sequence) position: , mismatch: 9, identity: 0.719
aaaacaggagtacaaaaaatgagcatacaaaa CRISPR spacer
aaaaaaggagaacaaaaaatgagcgatctcgt Protospacer
**** ***** *************. * .
66. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP024037 (Bacillus aryabhattai strain K13 plasmid unnamed2) position: , mismatch: 9, identity: 0.719
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
aacaagttgcaaaggaaataaaagaacgctac Protospacer
****** **.*************.* *
67. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP026740 (Bacillus megaterium strain YC4-R4 plasmid unnamed4) position: , mismatch: 9, identity: 0.719
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
aacaagttgcaaaggaaataaaagaacgctac Protospacer
****** **.*************.* *
68. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP010587 (Bacillus megaterium Q3 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
aacaagttgcaaaggaaataaaagaacgctac Protospacer
****** **.*************.* *
69. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP023319 (Bacillus megaterium strain A plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
aacaagttgcaaaggaaataaaagaacgctac Protospacer
****** **.*************.* *
70. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP018062 (Enterococcus mundtii strain DSM 4838 plasmid pLDW-8, complete sequence) position: , mismatch: 9, identity: 0.719
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
aggaaggttcagaggaagtaaaagagtctgat Protospacer
*** **********.********.* * .
71. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to NC_017139 (Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence) position: , mismatch: 9, identity: 0.719
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
aacaagttgcaaaggaaataaaagaacgctac Protospacer
****** **.*************.* *
72. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 9, identity: 0.719
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
gcgtacttccagaggaaataaatgagccgtta Protospacer
* * **.************* ****** .
73. spacer 1.57|1870771|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP021117 (Rhodobacteraceae bacterium strain G7 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
catcatcaagatagctatttaacataatatac CRISPR spacer
ctagcgaaatatagctatttaatataatatat Protospacer
* ** ************.********.
74. spacer 1.57|1870771|32|NZ_AP014836|CRISPRCasFinder matches to NC_017974 (Cronobacter phage CR3, complete genome) position: , mismatch: 9, identity: 0.719
catcatcaagatagctatttaacataatatac CRISPR spacer
cacgccacggatacctatttaacataatacac Protospacer
**. . .**** ***************.**
75. spacer 1.66|1871320|32|NZ_AP014836|CRISPRCasFinder matches to KU594606 (Cyanophage S-RIM32 isolate RW_108_0702, complete genome) position: , mismatch: 9, identity: 0.719
ctagatgttctcattatatgaaaaagtatatt CRISPR spacer
atagatgtcctcataatatgaaaacataccaa Protospacer
*******.***** ********* .**.
76. spacer 1.68|1871442|32|NZ_AP014836|CRISPRCasFinder matches to MN694273 (Marine virus AFVG_250M205, complete genome) position: , mismatch: 9, identity: 0.719
tgaagataaaaacggggttatgatttcatctg CRISPR spacer
ggtacataaaaactgggttatgttttcagaat Protospacer
* * ******** ******** *****
77. spacer 1.72|1871686|32|NZ_AP014836|CRISPRCasFinder matches to FJ867914 (Roseobacter phage SIO1 strain mb genomic sequence) position: , mismatch: 9, identity: 0.719
ccttggcaacagcagtccgatcttcttcctcg CRISPR spacer
gccatgcaacagcagtccaatcttcttcgatt Protospacer
*. *************.********* .
78. spacer 1.124|1870405|33|NZ_AP014836|CRT,PILER-CR matches to MK295204 (Shigella phage vB_SdyM_006, complete genome) position: , mismatch: 9, identity: 0.727
agcatacgatagaaaaagtaataataaagggga CRISPR spacer
aaaaatgtatagaaaaattaataataaatgggt Protospacer
*. * ********* ********** ***
79. spacer 1.124|1870405|33|NZ_AP014836|CRT,PILER-CR matches to MG696114 (Proteus phage phiP4-3, complete genome) position: , mismatch: 9, identity: 0.727
agcatacgatagaaaaagtaataataaagggga CRISPR spacer
aaaaatgtatagaaaaattaataataaatgggt Protospacer
*. * ********* ********** ***
80. spacer 1.136|1871137|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP041297 (Acinetobacter indicus strain 80-1-2 plasmid p80-1-2-tetX3, complete sequence) position: , mismatch: 9, identity: 0.727
tataaaaaagtcatgagcagcgctaaaaataaa CRISPR spacer
attcaacaagtaatgagcagcgctaaaaactgg Protospacer
* ** **** *****************. ..
81. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to NC_015426 (Clostridium botulinum BKT015925 plasmid p2BKT015925, complete sequence) position: , mismatch: 10, identity: 0.688
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
aacaagtttcagatgaaataatagagtatttt Protospacer
*********** ******* ****. ..
82. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP004877 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence) position: , mismatch: 10, identity: 0.688
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
gagtacttccagaggaaataaacgagccgtta Protospacer
* **.************* ****** .
83. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP022446 (Bacillus cereus C1L plasmid pC1L1, complete sequence) position: , mismatch: 10, identity: 0.688
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
gagtacttccagaggaaataaacgagccgtta Protospacer
* **.************* ****** .
84. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 10, identity: 0.688
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
gagtacttccagaggaaataaatgagccgtta Protospacer
* **.************* ****** .
85. spacer 1.54|1870588|32|NZ_AP014836|CRISPRCasFinder matches to CP046512 (Bacillus cereus strain JHU plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
cccaagtttcagaggaaataaaagagccggcc CRISPR spacer
gagtacttccagaggaaataaacgagccgtta Protospacer
* **.************* ****** .
86. spacer 1.72|1871686|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ccttggcaacagcagtccgatcttcttcctcg CRISPR spacer
caccagcaccggcagtccgatcttcttcaggt Protospacer
* ...*** *.*****************
87. spacer 1.72|1871686|32|NZ_AP014836|CRISPRCasFinder matches to FJ867911 (Roseobacter phage SIO1 strain sio1 genomic sequence) position: , mismatch: 10, identity: 0.688
ccttggcaacagcagtccgatcttcttcctcg CRISPR spacer
gccatgcaacagctgtccaatcttcttcgatt Protospacer
*. ******** ****.********* .
88. spacer 1.72|1871686|32|NZ_AP014836|CRISPRCasFinder matches to FJ867912 (Roseobacter phage SIO1 strain sbrsio67 genomic sequence) position: , mismatch: 10, identity: 0.688
ccttggcaacagcagtccgatcttcttcctcg CRISPR spacer
gccatgcaacagctgtccaatcttcttcgatt Protospacer
*. ******** ****.********* .
89. spacer 1.72|1871686|32|NZ_AP014836|CRISPRCasFinder matches to FJ867913 (Roseobacter phage SIO1 strain os genomic sequence) position: , mismatch: 10, identity: 0.688
ccttggcaacagcagtccgatcttcttcctcg CRISPR spacer
gccatgcaacagctgtccaatcttcttcgatt Protospacer
*. ******** ****.********* .
90. spacer 1.124|1870405|33|NZ_AP014836|CRT,PILER-CR matches to MH616719 (Inoviridae sp. isolate ctbi9, complete genome) position: , mismatch: 10, identity: 0.697
agcatacgatagaaaaagtaataataaagggga CRISPR spacer
ttaaggtaatataaaaaggaataataaaggggt Protospacer
* ...*** ****** *************
91. spacer 1.125|1870466|33|NZ_AP014836|CRT,PILER-CR matches to NZ_AP019857 (Escherichia coli O8:H8 strain 16F5M1D1 plasmid p16F5M1D101, complete sequence) position: , mismatch: 10, identity: 0.697
aaaacaggagtacaaaaaatgagcatacaaaaa CRISPR spacer
aaaaaaggagaacaaaaaatgagcgatctcgtt Protospacer
**** ***** *************. * .
92. spacer 1.127|1870588|33|NZ_AP014836|CRT,PILER-CR matches to NC_015426 (Clostridium botulinum BKT015925 plasmid p2BKT015925, complete sequence) position: , mismatch: 10, identity: 0.697
cccaagtttcagaggaaataaaagagccggcca CRISPR spacer
aacaagtttcagatgaaataatagagtatttta Protospacer
*********** ******* ****. ..*
93. spacer 1.130|1870771|33|NZ_AP014836|CRT,PILER-CR matches to NZ_CP021117 (Rhodobacteraceae bacterium strain G7 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.697
catcatcaagatagctatttaacataatataca CRISPR spacer
ctagcgaaatatagctatttaatataatatatt Protospacer
* ** ************.********.
94. spacer 1.58|1870832|32|NZ_AP014836|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 11, identity: 0.656
ttgatggaacatgggaagacggcgctaaagac CRISPR spacer
ccaggagaacgtgggaagccggcgctaaatca Protospacer
.... .****.******* **********
95. spacer 1.58|1870832|32|NZ_AP014836|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 11, identity: 0.656
ttgatggaacatgggaagacggcgctaaagac CRISPR spacer
ccaggagaacgtgggaagccggcgctaaatca Protospacer
.... .****.******* **********
