Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP017976 Microbacterium sp. TPU 3598 plasmid MST3P, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP017975 Microbacterium sp. TPU 3598 3 crisprs RT,csa3,WYL,DEDDh,cas3 1 3 0 0

Results visualization

1. NZ_AP017975
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017975_1 649668-649772 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017975_2 1505833-1505999 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017975_3 2164084-2164172 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_AP017975.1 2969806-2969830 1 0.96

1. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to position: 2969806-2969830, mismatch: 1, identity: 0.96 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagccggccgccaagaaggct	Protospacer
********* ***************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH015258 Ruegeria phage vB_RpoS-V16, complete genome 56989-57013 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH015249 Ruegeria phage vB_RpoS-V7, complete genome 54768-54792 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 KM581061 Ruegeria phage DSS3-P1, complete genome 54791-54815 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 HQ632855 Silicibacter phage DSS3-P1, *** SEQUENCING IN PROGRESS ***, 6 unordered pieces 21082-21106 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH015254 Ruegeria phage vB_RpoS-V11, complete genome 54328-54352 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH015252 Ruegeria phage vB_RpoS-V18, complete genome 54452-54476 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1563269-1563293 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4864910-4864934 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT657343 Microbacterium phage GaeCeo, complete genome 29494-29518 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN310543 Microbacterium phage ChickenKing, complete genome 29261-29285 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_LR134458 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence 33743-33767 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH669016 Streptomyces phage TrvxScott, complete genome 23110-23134 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK392363 Streptomyces phage Bowden, complete genome 23128-23152 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK392365 Streptomyces phage TinaBelcher, complete genome 23064-23088 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH651190 Streptomyces phage Thestral, complete genome 23117-23141 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NC_014030 Salinibacter ruber M8 plasmid pSR61, complete sequence 14698-14722 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 10785-10809 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 10800-10824 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 10815-10839 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 10830-10854 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 10845-10869 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 10860-10884 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 10875-10899 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 10920-10944 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 10965-10989 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 11115-11139 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 11370-11394 2 0.92
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_AP018826 Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence 11655-11679 2 0.92
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_003085 Myxococcus phage Mx8, complete genome 331-355 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 AF396866 Bacteriophage Mx8, complete genome 331-355 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 U64984 Bacteriophage Mx8 imm, DNA adenine methyltransferase (mox), uoi, and integrase (int) genes, complete cds 331-355 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3004784-3004808 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3005081-3005105 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH536815 Streptomyces phage Crosby, complete genome 13150-13174 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT936332 Streptomyces phage phiRKBJ001, complete genome 48155-48179 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 225575-225599 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK864266 Gordonia phage Arri, complete genome 19281-19305 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN284907 Gordonia phage Fireball, complete genome 18717-18741 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH884648 Caulobacter phage Kronos, complete genome 1160-1184 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN119376 Streptomyces phage Geostin, complete genome 27435-27459 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK864264 Gordonia phage VanDeWege, complete genome 19391-19415 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 AY576796 Actinoplanes phage phiAsp2, complete genome 14499-14523 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH479910 Gordonia phage Danyall, complete genome 19099-19123 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT639651 Gordonia phage Portcullis, complete genome 18627-18651 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH479917 Gordonia phage KimmyK, complete genome 19299-19323 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH669015 Gordonia phage TillyBobJoe, complete genome 18382-18406 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MG962366 Rhodococcus phage Finch, complete genome 68676-68700 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK814761 Gordonia phage SmokingBunny, complete genome 18583-18607 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 KX557286 Gordonia phage Twister6, complete genome 19010-19034 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK864267 Gordonia phage Valary, complete genome 19516-19540 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH155868 Streptomyces phage FlowerPower, complete genome 27435-27459 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK967381 Gordonia phage RogerDodger, complete genome 19477-19501 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT310872 Gordonia phage Evamon, complete genome 18585-18609 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT521998 Gordonia phage Jambalaya, complete genome 18364-18388 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK864265 Gordonia phage Barb, complete genome 19299-19323 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_030913 Gordonia phage Wizard, complete genome 18717-18741 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK305889 Gordonia phage Mutzi, complete genome 19029-19053 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN284894 Streptomyces phage Fabian, complete genome 27435-27459 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN010760 Gordonia phage Nubi, complete genome 18605-18629 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP031358 Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence 389519-389543 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 KC170282 Uncultured bacterium plasmid pMBUI6, complete sequence 3105-3129 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH047632 Mycobacterium phage Puppy, complete genome 33203-33227 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH047633 Mycobacterium phage Pistachio, complete genome 33131-33155 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH051259 Mycobacterium phage TNguyen7, complete genome 33550-33574 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 KY464936 Mycobacterium phage Idleandcovert, complete genome 33584-33608 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT536174 Stenotrophomonas phage vB_SmaS-AXL_3, complete genome 33461-33485 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 69827-69851 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN994275 Streptomyces phage JXY1, complete genome 40589-40613 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH019216 Streptomyces phage Wentworth, complete genome 47834-47858 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 KY940711 Bradyrhizobium phage BDU-MI-1, complete genome 73641-73665 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 KY940711 Bradyrhizobium phage BDU-MI-1, complete genome 73809-73833 3 0.88
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NC_014030 Salinibacter ruber M8 plasmid pSR61, complete sequence 14683-14707 3 0.88
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 796128-796152 3 0.88
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 252482-252506 3 0.88
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3004913-3004937 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4378228-4378252 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5661502-5661526 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH669016 Streptomyces phage TrvxScott, complete genome 23125-23149 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK392363 Streptomyces phage Bowden, complete genome 23143-23167 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK392365 Streptomyces phage TinaBelcher, complete genome 23079-23103 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH651190 Streptomyces phage Thestral, complete genome 23132-23156 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT708548 Streptomyces phage Salutena, complete genome 37004-37028 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK838113 Aeromonas phage LAh_7, complete genome 43175-43199 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP033968 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence 299530-299554 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_006466 Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence 211167-211191 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP043439 Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence 300415-300439 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN224564 Streptomyces phage Araceli, complete genome 5147-5171 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MG189906 Stenotrophomonas phage vB_SmaS_DLP_5, complete genome 33526-33550 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 KF614509 Rhizobium phage vB_RleS_L338C, complete genome 9000-9024 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH229863 Streptomyces phage JackieB, complete genome 5023-5047 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH229862 Streptomyces phage Henoccus, complete genome 5147-5171 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_042345 Phage Salvo, complete genome 11897-11921 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP033467 Enterobacter cloacae strain E3442 plasmid p3442-FRI-1, complete sequence 20090-20114 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 180970-180994 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 187034-187058 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP037902 Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence 53120-53144 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP046332 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2 211584-211608 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP021119 Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence 61023-61047 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_AP019635 Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence 93147-93171 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_AP019635 Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence 96516-96540 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT778840 Rhizobium phage P11VFA, complete genome 82367-82391 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT310878 Mycobacterium phage MK4, complete genome 33009-33033 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 KT281796 Mycobacterium phage Zakhe101, complete genome 53326-53350 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MH744424 Gordonia phage Turuncu, complete genome 50187-50211 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT310881 Mycobacterium phage JF2, complete genome 31725-31749 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 LR743524 Xylella phage Bacata genome assembly, chromosome: 1 32808-32832 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_042036 Mycobacterium phage Rockstar, complete genome 33018-33042 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN586063 Mycobacterium phage Isca, complete genome 33024-33048 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 JN698993 Mycobacterium phage Firecracker, complete genome 54960-54984 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MK494093 Mycobacterium phage Phighter1804, complete genome 33329-33353 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT024862 Microbacterium phage Alakazam, complete genome 23920-23944 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 KC172839 Mycobacterium phage BTCU-1, complete genome 33170-33194 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT451984 Microbacterium phage Nebulous, complete genome 25279-25303 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 AP018485 Mycobacterium phage B1 DNA, complete genome 31725-31749 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 AP017924 Ralstonia phage RP12 DNA, complete genome 257496-257520 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 AP017925 Ralstonia phage RP31 DNA, complete genome 254248-254272 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_022325 Mycobacterium phage Dylan, complete genome 53322-53346 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN428052 Mycobacterium phage Smooch, complete genome 54805-54829 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MT310880 Mycobacterium phage JF4, complete genome 31725-31749 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 JF923796 Gordonia phage GTE5, complete genome 43375-43399 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_016435 Gordonia phage GRU1, complete genome 42349-42373 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 796113-796137 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 252497-252521 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 KY083059 Mycobacterium phage Achebe, complete genome 33239-33263 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 KX550442 Mycobacterium phage Badger, complete genome 33240-33264 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 MN284905 Mycobacterium phage AbbysRanger, complete genome 33256-33280 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 MN096378 Microbacterium phage MCubed, complete genome 29082-29106 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 MK359310 Mycobacterium phage Katalie136, complete genome 33242-33266 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 MK279898 Mycobacterium phage Cici, complete genome 33257-33281 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 MK875799 Mycobacterium phage Xena, complete genome 33239-33263 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 MK494115 Mycobacterium phage Bumblebee11, complete genome 33242-33266 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NC_042308 Mycobacterium virus Backyardigan, complete genome 33272-33296 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 MF668278 Mycobacterium phage Morpher26, complete genome 33263-33287 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NC_023709 Mycobacterium phage Wile, complete genome 33273-33297 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 477877-477901 4 0.84
NZ_AP017975_2 2.3|1505955|25|NZ_AP017975|CRT 1505955-1505979 25 MK937603 Gordonia phage Bakery, complete genome 18525-18549 4 0.84
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_014818 Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence 162046-162070 5 0.8
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 343800-343824 5 0.8
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 87174-87198 5 0.8
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 90435-90459 5 0.8
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN586015 Gordonia phage Lauer, complete genome 28563-28587 5 0.8
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 MN693668 Marine virus AFVG_250M1112, complete genome 19630-19654 5 0.8
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 KR063280 Gordonia phage GMA6, complete genome 46817-46841 5 0.8
NZ_AP017975_2 2.1|1505853|25|NZ_AP017975|CRT 1505853-1505877 25 NC_048144 Microbacterium phage Schubert, complete genome 28597-28621 5 0.8
NZ_AP017975_2 2.2|1505898|37|NZ_AP017975|CRT 1505898-1505934 37 CP054917 Streptomyces sp. NA02950 plasmid unnamed, complete sequence 142891-142927 8 0.784
NZ_AP017975_2 2.2|1505898|37|NZ_AP017975|CRT 1505898-1505934 37 NZ_CP031358 Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence 389534-389570 10 0.73

1. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH015258 (Ruegeria phage vB_RpoS-V16, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccgccaagaaggtc	Protospacer
***********************..

2. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH015249 (Ruegeria phage vB_RpoS-V7, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccgccaagaaggtc	Protospacer
***********************..

3. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to KM581061 (Ruegeria phage DSS3-P1, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccgccaagaaggtc	Protospacer
***********************..

4. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to HQ632855 (Silicibacter phage DSS3-P1, *** SEQUENCING IN PROGRESS ***, 6 unordered pieces) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccgccaagaaggtc	Protospacer
***********************..

5. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH015254 (Ruegeria phage vB_RpoS-V11, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccgccaagaaggtc	Protospacer
***********************..

6. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH015252 (Ruegeria phage vB_RpoS-V18, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccgccaagaaggtc	Protospacer
***********************..

7. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggccgccgccaagaaggct	Protospacer
 ****** *****************

8. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagaccgccgcgaagaaggct	Protospacer
******* ******* *********

9. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT657343 (Microbacterium phage GaeCeo, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgcgaagcccgccgccaagaaggct	Protospacer
*. **********************

10. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN310543 (Microbacterium phage ChickenKing, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgcgaagcccgccgccaagaaggct	Protospacer
*. **********************

11. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_LR134458 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagaccaccgccaagaaggct	Protospacer
******* **.**************

12. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH669016 (Streptomyces phage TrvxScott, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggcccccgccaagaaggct	Protospacer
******* ** **************

13. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK392363 (Streptomyces phage Bowden, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggcccccgccaagaaggct	Protospacer
******* ** **************

14. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK392365 (Streptomyces phage TinaBelcher, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggcccccgccaagaaggct	Protospacer
******* ** **************

15. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH651190 (Streptomyces phage Thestral, complete genome) position: , mismatch: 2, identity: 0.92 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggcccccgccaagaaggct	Protospacer
******* ** **************

16. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NC_014030 (Salinibacter ruber M8 plasmid pSR61, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggcttctgctgagaaggct	Protospacer
**********.* ************

17. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgctgctgagaaggct	Protospacer
********** * ************

18. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgctgctgagaaggct	Protospacer
********** * ************

19. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgccgctgagaaggct	Protospacer
********** * ************

20. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgctgctgagaaggct	Protospacer
********** * ************

21. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgccgctgagaaggct	Protospacer
********** * ************

22. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgctgctgagaaggct	Protospacer
********** * ************

23. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgctgctgagaaggct	Protospacer
********** * ************

24. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgctgctgagaaggct	Protospacer
********** * ************

25. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgctgctgagaaggct	Protospacer
********** * ************

26. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgctgctgagaaggct	Protospacer
********** * ************

27. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgccgctgagaaggct	Protospacer
********** * ************

28. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_AP018826 (Acinetobacter ursingii strain M3 plasmid pAURM-2, complete sequence) position: , mismatch: 2, identity: 0.92 

tgagaaggctccggctgagaaggct	CRISPR spacer
tgagaaggctgctgctgagaaggct	Protospacer
********** * ************

29. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_003085 (Myxococcus phage Mx8, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagcccgccgccaagaagggc	Protospacer
 ********************** .

30. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to AF396866 (Bacteriophage Mx8, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagcccgccgccaagaagggc	Protospacer
 ********************** .

31. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to U64984 (Bacteriophage Mx8 imm, DNA adenine methyltransferase (mox), uoi, and integrase (int) genes, complete cds) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagcccgccgccaagaagggc	Protospacer
 ********************** .

32. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccggtgccaagaaggcc	Protospacer
*********** .***********.

33. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagccaggcgccaagaaggcc	Protospacer
********* * ************.

34. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH536815 (Streptomyces phage Crosby, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgcgaagcccgccgccaagaaggcc	Protospacer
*. *********************.

35. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT936332 (Streptomyces phage phiRKBJ001, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggccgccgccaagaaggcg	Protospacer
 ****** ****************

36. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggcagccgccaagaaggcc	Protospacer
******* * **************.

37. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK864266 (Gordonia phage Arri, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

38. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN284907 (Gordonia phage Fireball, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

39. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH884648 (Caulobacter phage Kronos, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcgcgccgccacgaaggcg	Protospacer
******** ******** ******

40. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN119376 (Streptomyces phage Geostin, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggccgctgccaagaaggca	Protospacer
******* ****.***********

41. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK864264 (Gordonia phage VanDeWege, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

42. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to AY576796 (Actinoplanes phage phiAsp2, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggcccccgccaagaaggcc	Protospacer
******* ** *************.

43. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH479910 (Gordonia phage Danyall, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

44. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT639651 (Gordonia phage Portcullis, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

45. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH479917 (Gordonia phage KimmyK, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

46. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH669015 (Gordonia phage TillyBobJoe, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

47. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MG962366 (Rhodococcus phage Finch, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggccgctgccaagaaggct	Protospacer
 ****** ****.************

48. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK814761 (Gordonia phage SmokingBunny, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

49. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to KX557286 (Gordonia phage Twister6, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

50. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK864267 (Gordonia phage Valary, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

51. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH155868 (Streptomyces phage FlowerPower, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggccgctgccaagaaggca	Protospacer
******* ****.***********

52. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK967381 (Gordonia phage RogerDodger, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

53. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT310872 (Gordonia phage Evamon, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

54. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT521998 (Gordonia phage Jambalaya, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

55. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK864265 (Gordonia phage Barb, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

56. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_030913 (Gordonia phage Wizard, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

57. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK305889 (Gordonia phage Mutzi, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

58. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN284894 (Streptomyces phage Fabian, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggccgctgccaagaaggca	Protospacer
******* ****.***********

59. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN010760 (Gordonia phage Nubi, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgcgaagaaggct	Protospacer
 ****** ******* *********

60. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP031358 (Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcctgccgccaaaaaggcc	Protospacer
*********.********.*****.

61. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to KC170282 (Uncultured bacterium plasmid pMBUI6, complete sequence) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgcagccaagaagccg	Protospacer
************ ********* *

62. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH047632 (Mycobacterium phage Puppy, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcagccgccaagaaggct	Protospacer
 ****** * ***************

63. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH047633 (Mycobacterium phage Pistachio, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcagccgccaagaaggct	Protospacer
 ****** * ***************

64. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH051259 (Mycobacterium phage TNguyen7, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcagccgccaagaaggct	Protospacer
 ****** * ***************

65. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to KY464936 (Mycobacterium phage Idleandcovert, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcagccgccaagaaggct	Protospacer
 ****** * ***************

66. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT536174 (Stenotrophomonas phage vB_SmaS-AXL_3, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgctgcaaagaaggcg	Protospacer
************.** ********

67. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caccaagcccgccgccaagaaggcc	Protospacer
**  ********************.

68. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN994275 (Streptomyces phage JXY1, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggcagccgccaagaaggcg	Protospacer
******* * **************

69. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH019216 (Streptomyces phage Wentworth, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggccgccgcgaagaaggcg	Protospacer
******* ******* ********

70. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to KY940711 (Bradyrhizobium phage BDU-MI-1, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgagaaggccgccgccgagaaggct	Protospacer
*.***** ********.********

71. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to KY940711 (Bradyrhizobium phage BDU-MI-1, complete genome) position: , mismatch: 3, identity: 0.88 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgagaaggccgccgccgagaaggct	Protospacer
*.***** ********.********

72. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NC_014030 (Salinibacter ruber M8 plasmid pSR61, complete sequence) position: , mismatch: 3, identity: 0.88 

tgagaaggctccggctgagaaggct	CRISPR spacer
cgaggaggctcctgctgagaaggct	Protospacer
.***.******* ************

73. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.88 

tgagaaggctccggctgagaaggct	CRISPR spacer
ggagaaggctccgggggagaaggct	Protospacer
 *************  *********

74. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 3, identity: 0.88 

tgagaaggctccggctgagaaggct	CRISPR spacer
ggagaaggctccgggggagaaggct	Protospacer
 *************  *********

75. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagccgggcgccaagaaggcc	Protospacer
 ******** * ************.

76. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggccgccgcgaagaaggca	Protospacer
 ****** ******* ********

77. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagtccgctgccaagaaggcg	Protospacer
 ******.****.***********

78. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH669016 (Streptomyces phage TrvxScott, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggtcgccgccaagaaggcc	Protospacer
 ****** .***************.

79. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK392363 (Streptomyces phage Bowden, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
aaagaaggtcgccgccaagaaggcc	Protospacer
 ****** .***************.

80. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK392365 (Streptomyces phage TinaBelcher, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
aaagaaggtcgccgccaagaaggcc	Protospacer
 ****** .***************.

81. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH651190 (Streptomyces phage Thestral, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggtcgccgccaagaaggcc	Protospacer
 ****** .***************.

82. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT708548 (Streptomyces phage Salutena, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgccgccaagaagggc	Protospacer
 ****** *************** .

83. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK838113 (Aeromonas phage LAh_7, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgcsrccaagaagccc	Protospacer
************  ******** *.

84. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgccaagcccgcggccaagaaggct	Protospacer
*.  ******** ************

85. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_006466 (Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgccaagcccgcggccaagaaggct	Protospacer
*.  ******** ************

86. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP043439 (Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgccaagcccgcggccaagaaggct	Protospacer
*.  ******** ************

87. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN224564 (Streptomyces phage Araceli, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggcccccgccaagaagggc	Protospacer
******* ** ************ .

88. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MG189906 (Stenotrophomonas phage vB_SmaS_DLP_5, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggccgccgacaagaaggca	Protospacer
 ****** ****** *********

89. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to KF614509 (Rhizobium phage vB_RleS_L338C, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagcccgccacccagaaggca	Protospacer
 ************.** *******

90. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH229863 (Streptomyces phage JackieB, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggcccccgccaagaagggc	Protospacer
******* ** ************ .

91. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH229862 (Streptomyces phage Henoccus, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaaggcccccgccaagaagggc	Protospacer
******* ** ************ .

92. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_042345 (Phage Salvo, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagcgccccgccaagaaggcc	Protospacer
 ******* * *************.

93. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP033467 (Enterobacter cloacae strain E3442 plasmid p3442-FRI-1, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccaccaagaacttt	Protospacer
*************.*******  .*

94. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccgccaaggctgcg	Protospacer
*******************.  **

95. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgccaagcccgccgccaagaagact	Protospacer
*.  ******************.**

96. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgccaagcccgcggccaagaaggct	Protospacer
*.  ******** ************

97. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP046332 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
cgccaagcccgcggccaagaaggct	Protospacer
*.  ******** ************

98. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagaccgcggccaagaaggcg	Protospacer
 ****** **** ***********

99. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_AP019635 (Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccaccaagaacttt	Protospacer
*************.*******  .*

100. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_AP019635 (Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccaccaagaacttt	Protospacer
*************.*******  .*

101. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT778840 (Rhizobium phage P11VFA, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagcccgccacccagaaggca	Protospacer
 ************.** *******

102. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT310878 (Mycobacterium phage MK4, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagccagcccccaagaaggcc	Protospacer
 ******** *** **********.

103. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to KT281796 (Mycobacterium phage Zakhe101, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcccccgccaagaaggcc	Protospacer
 ****** ** *************.

104. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MH744424 (Gordonia phage Turuncu, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcccccgccaagaaggcc	Protospacer
 ****** ** *************.

105. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT310881 (Mycobacterium phage JF2, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagccagcccccaagaaggcc	Protospacer
 ******** *** **********.

106. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to LR743524 (Xylella phage Bacata genome assembly, chromosome: 1) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagcgccccgccaagaaggcc	Protospacer
 ******* * *************.

107. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_042036 (Mycobacterium phage Rockstar, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagccagcccccaagaaggcc	Protospacer
 ******** *** **********.

108. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN586063 (Mycobacterium phage Isca, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagccagcccccaagaaggcc	Protospacer
 ******** *** **********.

109. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcccccgccaagaaggcc	Protospacer
 ****** ** *************.

110. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MK494093 (Mycobacterium phage Phighter1804, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcccccgccaagaaggcg	Protospacer
 ****** ** *************

111. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT024862 (Microbacterium phage Alakazam, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccgccaagcctgcc	Protospacer
*******************   **.

112. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to KC172839 (Mycobacterium phage BTCU-1, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagccagcccccaagaaggcc	Protospacer
 ******** *** **********.

113. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT451984 (Microbacterium phage Nebulous, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccgccaagcctgcc	Protospacer
*******************   **.

114. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to AP018485 (Mycobacterium phage B1 DNA, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagccagcccccaagaaggcc	Protospacer
 ******** *** **********.

115. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to AP017924 (Ralstonia phage RP12 DNA, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaacccgccgccaagaagccg	Protospacer
 *****.*************** *

116. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to AP017925 (Ralstonia phage RP31 DNA, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaacccgccgccaagaagccg	Protospacer
 *****.*************** *

117. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_022325 (Mycobacterium phage Dylan, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcccccgccaagaaggcc	Protospacer
 ****** ** *************.

118. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcccccgccaagaaggcc	Protospacer
 ****** ** *************.

119. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MT310880 (Mycobacterium phage JF4, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaagccagcccccaagaaggcc	Protospacer
 ******** *** **********.

120. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to JF923796 (Gordonia phage GTE5, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcccccgccaagaaggcc	Protospacer
 ****** ** *************.

121. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_016435 (Gordonia phage GRU1, complete genome) position: , mismatch: 4, identity: 0.84 

caagaagcccgccgccaagaaggct	CRISPR spacer
gaagaaggcccccgccaagaaggcc	Protospacer
 ****** ** *************.

122. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
ggagaaggctccggttgaaaaggcg	Protospacer
 *************.***.*****

123. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
ggagaaggctccggttgaaaaggcg	Protospacer
 *************.***.*****

124. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to KY083059 (Mycobacterium phage Achebe, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
caagaaggctccggccaagaaggct	Protospacer
..*************..********

125. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to KX550442 (Mycobacterium phage Badger, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
caagaaggctccggccaagaaggct	Protospacer
..*************..********

126. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to MN284905 (Mycobacterium phage AbbysRanger, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
caagaaggctccggccaagaaggct	Protospacer
..*************..********

127. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to MN096378 (Microbacterium phage MCubed, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
gaagaaggctccggcgaagaaggct	Protospacer
 .************* .********

128. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to MK359310 (Mycobacterium phage Katalie136, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
caagaaggctccggccaagaaggct	Protospacer
..*************..********

129. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to MK279898 (Mycobacterium phage Cici, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
caagaaggctccggccaagaaggct	Protospacer
..*************..********

130. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to MK875799 (Mycobacterium phage Xena, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
caagaaggctccggccaagaaggct	Protospacer
..*************..********

131. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to MK494115 (Mycobacterium phage Bumblebee11, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
caagaaggctccggccaagaaggct	Protospacer
..*************..********

132. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NC_042308 (Mycobacterium virus Backyardigan, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
caagaaggctccggccaagaaggct	Protospacer
..*************..********

133. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to MF668278 (Mycobacterium phage Morpher26, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
caagaaggctccggccaagaaggct	Protospacer
..*************..********

134. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NC_023709 (Mycobacterium phage Wile, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
caagaaggctccggccaagaaggct	Protospacer
..*************..********

135. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
ggagaaggctccggcgaagaaggcg	Protospacer
 ************** .*******

136. spacer 2.3|1505955|25|NZ_AP017975|CRT matches to MK937603 (Gordonia phage Bakery, complete genome) position: , mismatch: 4, identity: 0.84 

tgagaaggctccggctgagaaggct	CRISPR spacer
gaagaaggctccggcgaagaaggct	Protospacer
 .************* .********

137. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_014818 (Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence) position: , mismatch: 5, identity: 0.8 

caagaagcccgccgccaagaaggct	CRISPR spacer
tgtgaagcccgccgccaggaaggcg	Protospacer
.. **************.******

138. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 5, identity: 0.8 

caagaagcccgccgccaagaaggct	CRISPR spacer
tccgaagaccgccgccaagaaggcg	Protospacer
.  **** ****************

139. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.8 

caagaagcccgccgccaagaaggct	CRISPR spacer
atagaagcccgccgcaaagaagggc	Protospacer
  ************* ******* .

140. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 5, identity: 0.8 

caagaagcccgccgccaagaaggct	CRISPR spacer
atagaagcccgccgcaaagaagggc	Protospacer
  ************* ******* .

141. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN586015 (Gordonia phage Lauer, complete genome) position: , mismatch: 5, identity: 0.8 

caagaagcccgccgccaagaaggct	CRISPR spacer
gcccaagcccgctgccaagaaggct	Protospacer
    ********.************

142. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to MN693668 (Marine virus AFVG_250M1112, complete genome) position: , mismatch: 5, identity: 0.8 

caagaagcccgccgccaagaaggct	CRISPR spacer
caagaagcccgccgccaagcccacc	Protospacer
*******************   .*.

143. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to KR063280 (Gordonia phage GMA6, complete genome) position: , mismatch: 5, identity: 0.8 

caagaagcccgccgccaagaaggct	CRISPR spacer
tcggaagcccgccgccaagaagacg	Protospacer
. .*******************.*

144. spacer 2.1|1505853|25|NZ_AP017975|CRT matches to NC_048144 (Microbacterium phage Schubert, complete genome) position: , mismatch: 5, identity: 0.8 

caagaagcccgccgccaagaaggct	CRISPR spacer
ggccaagcctgccgccaagaaggct	Protospacer
 .  *****.***************

145. spacer 2.2|1505898|37|NZ_AP017975|CRT matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.784 

cgctg-acgaggccgagaagccggctgccaagaagccc	CRISPR spacer
-gctgaacgaggccgagaagctggcagccaagctcagc	Protospacer
 **** ***************.*** ******     *

146. spacer 2.2|1505898|37|NZ_AP017975|CRT matches to NZ_CP031358 (Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.73 

------cgctgacgaggccgagaagccggctgccaagaagccc	CRISPR spacer
gaagcctgct------gccaagaagcctgctgccaagaagcct	Protospacer
      .***      ***.******* **************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage