Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP017622 Escherichia coli strain MRY15-131 plasmid pMRY15-131_2, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP017620 Escherichia coli strain MRY15-131 2 crisprs c2c9_V-U4,DinG,DEDDh,cas3,csa3,WYL,PD-DExK 0 2 8 0
NZ_AP017621 Escherichia coli strain MRY15-131 plasmid pMRY15-131_1, complete sequence 0 crisprs csa3 0 0 1 0

Results visualization

1. NZ_AP017620
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017620_1 1537771-1537894 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017620_2 2148008-2148099 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP017620_2 2.1|2148034|40|NZ_AP017620|CRISPRCasFinder 2148034-2148073 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_AP017620_1 1.1|1537814|38|NZ_AP017620|CRISPRCasFinder 1537814-1537851 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947

1. spacer 2.1|2148034|40|NZ_AP017620|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 1.1|1537814|38|NZ_AP017620|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 541206 : 599659 75 Enterobacteria_phage(47.27%) tail,tRNA,portal,head,capsid,integrase,holin,protease,terminase,lysis attL 551357:551403|attR 600082:600128
DBSCAN-SWA_2 953689 : 963131 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 1066237 : 1074954 8 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_4 1128721 : 1240383 88 uncultured_Caudovirales_phage(33.33%) transposase,plate,integrase attL 1124320:1124379|attR 1242200:1242215
DBSCAN-SWA_5 2537188 : 2550116 6 Escherichia_phage(83.33%) integrase attL 2542691:2542704|attR 2551161:2551174
DBSCAN-SWA_6 3193807 : 3260791 59 Enterobacteria_phage(33.33%) transposase,integrase attL 3199432:3199463|attR 3261732:3261763
DBSCAN-SWA_7 4069300 : 4073954 6 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_8 4576477 : 4622938 48 Burkholderia_phage(28.57%) transposase,tail,tRNA,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AP017621
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6769 : 43165 43 Escherichia_phage(36.36%) transposase,integrase attL 6718:6777|attR 19193:20012
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage