Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP018034 Mycobacterium tuberculosis strain HN-205 12 crisprs csa3,c2c9_V-U4,cas3,DinG,WYL,cas4,DEDDh,csm3gr7,csm2gr11,cas10,cas6 7 21 3 0

Results visualization

1. NZ_AP018034
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_1 330767-330877 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_2 362546-363244 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_3 688079-688155 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_4 958452-958703 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_5 1568948-1570020 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_6 2067558-2067812 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_7 2150433-2150652 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_8 3106394-3107541 TypeIII II-B,III-A
15 spacers
csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_9 3650399-3650517 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_10 3735816-3736392 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_11 3845264-3845353 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP018034_12 4109784-4109872 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP018034_9 9.1|3650429|59|NZ_AP018034|CRISPRCasFinder 3650429-3650487 59 NZ_AP018034.1 3650492-3650550 0 1.0
NZ_AP018034_4 4.2|958625|56|NZ_AP018034|PILER-CR 958625-958680 56 NZ_AP018034.1 958753-958808 1 0.982
NZ_AP018034_6 6.2|2067639|18|NZ_AP018034|CRT 2067639-2067656 18 NZ_AP018034.1 397129-397146 1 0.944
NZ_AP018034_6 6.2|2067639|18|NZ_AP018034|CRT 2067639-2067656 18 NZ_AP018034.1 603396-603413 1 0.944
NZ_AP018034_6 6.4|2067729|18|NZ_AP018034|CRT 2067729-2067746 18 NZ_AP018034.1 3433002-3433019 1 0.944
NZ_AP018034_2 2.5|362834|42|NZ_AP018034|CRISPRCasFinder 362834-362875 42 NZ_AP018034.1 370850-370891 2 0.952
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_AP018034.1 369665-369697 2 0.939
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_AP018034.1 1206099-1206120 2 0.909

1. spacer 9.1|3650429|59|NZ_AP018034|CRISPRCasFinder matches to position: 3650492-3650550, mismatch: 0, identity: 1.0

ctgtgagtcgagtgagcggaacgaacgaagtgagtgacgggaacgagacgaacaatccg	CRISPR spacer
ctgtgagtcgagtgagcggaacgaacgaagtgagtgacgggaacgagacgaacaatccg	Protospacer
***********************************************************

2. spacer 4.2|958625|56|NZ_AP018034|PILER-CR matches to position: 958753-958808, mismatch: 1, identity: 0.982

agctgccgggaggggttcacccagcggcgcgggcaggtcgtttacggcaagttcca	CRISPR spacer
agctgccgggaggggttcacccagcggtgcgggcaggtcgtttacggcaagttcca	Protospacer
***************************.****************************

3. spacer 6.2|2067639|18|NZ_AP018034|CRT matches to position: 397129-397146, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

4. spacer 6.2|2067639|18|NZ_AP018034|CRT matches to position: 603396-603413, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

5. spacer 6.4|2067729|18|NZ_AP018034|CRT matches to position: 3433002-3433019, mismatch: 1, identity: 0.944

gatcagcgtcccgccggt	CRISPR spacer
gatcagcgtcccgctggt	Protospacer
**************.***

6. spacer 2.5|362834|42|NZ_AP018034|CRISPRCasFinder matches to position: 370850-370891, mismatch: 2, identity: 0.952

ccggtgcccgagttgaagaacccgatgtttccgctgccggag	CRISPR spacer
ccggtgcccgagttgaacaacccgacgtttccgctgccggag	Protospacer
***************** *******.****************

7. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to position: 369665-369697, mismatch: 2, identity: 0.939

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
aggctgccgaacccgatctggccgctgccggtg	Protospacer
********** *************.********

8. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to position: 1206099-1206120, mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gttgccgatcagcccggcggca	Protospacer
**.********* *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1975819-1975840 1 0.955
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1109892-1109913 1 0.955
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP016457 Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence 87869-87890 1 0.955
NZ_AP018034_5 5.15|1569967|22|NZ_AP018034|CRISPRCasFinder 1569967-1569988 22 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 362668-362689 1 0.955
NZ_AP018034_5 5.15|1569967|22|NZ_AP018034|CRISPRCasFinder 1569967-1569988 22 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2289382-2289403 1 0.955
NZ_AP018034_5 5.15|1569967|22|NZ_AP018034|CRISPRCasFinder 1569967-1569988 22 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 81656-81677 1 0.955
NZ_AP018034_5 5.15|1569967|22|NZ_AP018034|CRISPRCasFinder 1569967-1569988 22 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 56160-56181 1 0.955
NZ_AP018034_1 1.2|330836|21|NZ_AP018034|PILER-CR 330836-330856 21 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 9334-9354 2 0.905
NZ_AP018034_5 5.2|1569040|22|NZ_AP018034|CRISPRCasFinder 1569040-1569061 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 881140-881161 2 0.909
NZ_AP018034_5 5.2|1569040|22|NZ_AP018034|CRISPRCasFinder 1569040-1569061 22 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 225972-225993 2 0.909
NZ_AP018034_5 5.2|1569040|22|NZ_AP018034|CRISPRCasFinder 1569040-1569061 22 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 451168-451189 2 0.909
NZ_AP018034_5 5.2|1569040|22|NZ_AP018034|CRISPRCasFinder 1569040-1569061 22 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 234992-235013 2 0.909
NZ_AP018034_5 5.2|1569040|22|NZ_AP018034|CRISPRCasFinder 1569040-1569061 22 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 597449-597470 2 0.909
NZ_AP018034_5 5.3|1569094|22|NZ_AP018034|CRISPRCasFinder 1569094-1569115 22 NZ_CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 117076-117097 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 448838-448859 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 160471-160492 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 175264-175285 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 457593-457614 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 166709-166730 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 166709-166730 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 166709-166730 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 166709-166730 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 164465-164486 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 97458-97479 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP012698 Microbacterium sp. No. 7 plasmid A, complete sequence 53118-53139 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 100830-100851 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 307854-307875 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 23841-23862 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 279961-279982 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 359201-359222 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 606826-606847 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 411558-411579 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 300111-300132 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 483830-483851 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 68146-68167 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 175112-175133 2 0.909
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 314082-314103 2 0.909
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 402883-402907 2 0.92
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 416172-416196 2 0.92
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 472935-472959 2 0.92
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 9264-9285 3 0.864
NZ_AP018034_5 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder 1569148-1569169 22 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 13233-13254 3 0.864
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 937294-937318 3 0.88
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1470762-1470786 3 0.88
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 MN586053 Arthrobacter phage BeatusComedenti, complete genome 26689-26713 3 0.88
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NC_031254 Arthrobacter phage Kitkat, complete genome 26809-26833 3 0.88
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NC_031231 Arthrobacter phage KellEzio, complete genome 26691-26715 3 0.88
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 633177-633201 3 0.88
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 74124-74148 3 0.88
NZ_AP018034_5 5.15|1569967|22|NZ_AP018034|CRISPRCasFinder 1569967-1569988 22 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 380879-380900 3 0.864
NZ_AP018034_6 6.5|2067768|24|NZ_AP018034|CRT 2067768-2067791 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1555522-1555545 3 0.875
NZ_AP018034_6 6.5|2067768|24|NZ_AP018034|CRT 2067768-2067791 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1560190-1560213 3 0.875
NZ_AP018034_2 2.1|362579|27|NZ_AP018034|CRISPRCasFinder 362579-362605 27 NC_023591 Mycobacterium phage Adler, complete genome 61249-61275 4 0.852
NZ_AP018034_2 2.1|362579|27|NZ_AP018034|CRISPRCasFinder 362579-362605 27 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 61247-61273 4 0.852
NZ_AP018034_2 2.7|362975|27|NZ_AP018034|CRISPRCasFinder 362975-363001 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 10066-10092 4 0.852
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 460464-460490 4 0.852
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NC_016652 Rhodococcus phage REQ2, complete genome 36035-36061 4 0.852
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 818773-818800 4 0.857
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 420542-420569 4 0.857
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 77799-77826 4 0.857
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 176640-176664 4 0.84
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 29428-29452 4 0.84
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 38191-38215 4 0.84
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 MT553342 Microbacterium phage Kelcole, complete genome 51573-51597 4 0.84
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NC_048068 Microbacterium phage OneinaGillian, complete genome 50894-50918 4 0.84
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 MT310894 Microbacterium phage Tempo, complete genome 51697-51721 4 0.84
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_CP047175 Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence 42080-42104 4 0.84
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 67777-67801 4 0.84
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 MN034284 Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence 624-648 4 0.84
NZ_AP018034_5 5.14|1569910|25|NZ_AP018034|CRISPRCasFinder 1569910-1569934 25 MN582064 Podoviridae sp. ctka020, complete genome 29274-29298 4 0.84
NZ_AP018034_6 6.5|2067768|24|NZ_AP018034|CRT 2067768-2067791 24 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 680430-680453 4 0.833
NZ_AP018034_6 6.5|2067768|24|NZ_AP018034|CRT 2067768-2067791 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5913119-5913142 4 0.833
NZ_AP018034_6 6.5|2067768|24|NZ_AP018034|CRT 2067768-2067791 24 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 143186-143209 4 0.833
NZ_AP018034_2 2.1|362579|27|NZ_AP018034|CRISPRCasFinder 362579-362605 27 LR794124 Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1 34861-34887 5 0.815
NZ_AP018034_2 2.1|362579|27|NZ_AP018034|CRISPRCasFinder 362579-362605 27 NC_012662 Vibrio phage VP93, complete genome 35301-35327 5 0.815
NZ_AP018034_2 2.7|362975|27|NZ_AP018034|CRISPRCasFinder 362975-363001 27 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 2189-2215 5 0.815
NZ_AP018034_2 2.7|362975|27|NZ_AP018034|CRISPRCasFinder 362975-363001 27 MN693945 Marine virus AFVG_250M952, complete genome 34909-34935 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 369429-369455 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 338832-338858 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 363377-363403 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 104717-104743 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 338543-338569 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 340811-340837 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 342690-342716 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 343060-343086 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 355714-355740 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 343060-343086 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 348335-348361 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 343052-343078 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 69464-69490 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 363377-363403 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 355714-355740 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 342690-342716 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 10340-10366 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 19365-19391 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 MN586031 Gordonia phage Gambino, complete genome 3053-3079 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 KU998236 Gordonia phage Blueberry, complete genome 3053-3079 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 MN062704 Gordonia phage JuJu, complete genome 3063-3089 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 MK501729 Gordonia phage Walrus, complete genome 3053-3079 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NC_031226 Gordonia phage BaxterFox, complete genome 2982-3008 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 MK967393 Rhodococcus phage Whack, complete genome 3063-3089 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 MT723935 Gordonia phage Azula, complete genome 3053-3079 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 KU963249 Gordonia phage Yeezy, complete genome 2982-3008 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 MH153808 Gordonia phage Petra, complete genome 3053-3079 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 MT639650 Gordonia phage Ohgeesy, complete genome 2982-3008 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 MH536818 Gordonia phage Frokostdame, complete genome 3055-3081 5 0.815
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 KX557275 Gordonia phage CarolAnn, complete genome 3052-3078 5 0.815
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 94483-94510 5 0.821
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 KU728633 Mycobacterium phage Bipper, complete genome 41992-42019 5 0.821
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 MK977701 Mycobacterium phage Cracklewink, complete genome 41985-42012 5 0.821
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 100320-100347 5 0.821
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 614111-614135 5 0.8
NZ_AP018034_5 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder 1569202-1569226 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 92705-92729 5 0.8
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 45440-45470 5 0.839
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 123562-123592 5 0.839
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 72551-72581 5 0.839
NZ_AP018034_5 5.13|1569844|34|NZ_AP018034|CRISPRCasFinder 1569844-1569877 34 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 89410-89443 5 0.853
NZ_AP018034_2 2.1|362579|27|NZ_AP018034|CRISPRCasFinder 362579-362605 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 207335-207361 6 0.778
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 435770-435802 6 0.818
NZ_AP018034_2 2.7|362975|27|NZ_AP018034|CRISPRCasFinder 362975-363001 27 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 32942-32968 6 0.778
NZ_AP018034_2 2.9|363125|27|NZ_AP018034|CRISPRCasFinder 363125-363151 27 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 50750-50776 6 0.778
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 179708-179734 6 0.778
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4846911-4846937 6 0.778
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 78863-78889 6 0.778
NZ_AP018034_2 2.10|363185|27|NZ_AP018034|CRISPRCasFinder 363185-363211 27 MK494099 Mycobacterium phage Typha, complete genome 33831-33857 6 0.778
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 39276-39303 6 0.786
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 76834-76861 6 0.786
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 NZ_LR594663 Variovorax sp. RA8 plasmid 2 131793-131820 6 0.786
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 27764-27794 6 0.806
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 438646-438676 6 0.806
NZ_AP018034_5 5.13|1569844|34|NZ_AP018034|CRISPRCasFinder 1569844-1569877 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 28989-29022 6 0.824
NZ_AP018034_2 2.4|362774|27|NZ_AP018034|CRISPRCasFinder 362774-362800 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 48081-48107 7 0.741
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NZ_AP018034_5 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder 1568980-1569007 28 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 259627-259654 7 0.75
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 281800-281830 7 0.774
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 CP017041 Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence 68407-68437 7 0.774
NZ_AP018034_6 6.3|2067678|30|NZ_AP018034|CRT 2067678-2067707 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 52187-52216 7 0.767
NZ_AP018034_6 6.3|2067678|30|NZ_AP018034|CRT 2067678-2067707 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 75140-75169 7 0.767
NZ_AP018034_6 6.3|2067678|30|NZ_AP018034|CRT 2067678-2067707 30 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 376489-376518 7 0.767
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 922291-922322 7 0.781
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 68176-68207 7 0.781
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1386736-1386768 8 0.758
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 35126-35158 8 0.758
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1241611-1241643 8 0.758
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 275839-275871 8 0.758
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 310597-310629 8 0.758
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 349053-349083 8 0.742
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 336247-336277 8 0.742
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP039913 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence 262996-263026 8 0.742
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 336247-336277 8 0.742
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP018001 Rhizobium sp. Y9 plasmid pY9, complete sequence 264529-264559 8 0.742
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NC_022536 Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence 458177-458207 8 0.742
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 311056-311086 8 0.742
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 88587-88617 8 0.742
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 284157-284187 8 0.742
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 300067-300097 8 0.742
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1510497-1510527 8 0.742
NZ_AP018034_6 6.3|2067678|30|NZ_AP018034|CRT 2067678-2067707 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 9194-9223 8 0.733
NZ_AP018034_6 6.3|2067678|30|NZ_AP018034|CRT 2067678-2067707 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 983284-983313 8 0.733
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 470080-470111 8 0.75
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 MG812496 Gordonia phage SallySpecial, complete genome 7676-7707 8 0.75
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 91175-91207 9 0.727
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 668963-668995 9 0.727
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 789706-789738 9 0.727
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 625853-625885 9 0.727
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NZ_AP018034_3 3.1|688102|31|NZ_AP018034|CRISPRCasFinder 688102-688132 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 345043-345073 9 0.71
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 245050-245080 9 0.71
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 194387-194417 9 0.71
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 MN234199 Mycobacterium phage Ekdilam, complete genome 24235-24265 9 0.71
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1145162-1145192 9 0.71
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 453136-453166 9 0.71
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP013740 Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence 2806-2836 9 0.71
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1908459-1908489 9 0.71
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 172271-172302 9 0.719
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 172271-172302 9 0.719
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 326579-326610 9 0.719
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 68775-68806 9 0.719
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_LN868942 Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence 1614-1645 9 0.719
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP031420 Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence 7035-7066 9 0.719
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 113326-113357 9 0.719
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP024681 Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence 124358-124389 9 0.719
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP005086 Sphingobium sp. TKS plasmid pTK2, complete sequence 67698-67729 9 0.719
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 MH271296 Gordonia phage Emperor, complete genome 8733-8764 9 0.719
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 91179-91211 10 0.697
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 90245-90277 10 0.697
NZ_AP018034_2 2.6|362909|33|NZ_AP018034|CRISPRCasFinder 362909-362941 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 99166-99198 10 0.697
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 425898-425928 10 0.677
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 344090-344120 10 0.677
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 68383-68413 10 0.677
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 16322-16352 10 0.677
NZ_AP018034_5 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder 1569595-1569625 31 NZ_AP014581 Burkholderia sp. RPE67 plasmid p3, complete sequence 131907-131937 10 0.677
NZ_AP018034_5 5.13|1569844|34|NZ_AP018034|CRISPRCasFinder 1569844-1569877 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1081518-1081551 10 0.706
NZ_AP018034_8 8.9|3107022|35|NZ_AP018034|PILER-CR,CRISPRCasFinder,CRT 3107022-3107056 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 1025-1056 10 0.688
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 89525-89556 10 0.688
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 684081-684112 10 0.688
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 399128-399159 10 0.688
NZ_AP018034_10 10.6|3736252|32|NZ_AP018034|CRT 3736252-3736283 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 301548-301579 11 0.656

1. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

2. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

3. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcgggccggcggca	Protospacer
**********.***********

4. spacer 5.15|1569967|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

5. spacer 5.15|1569967|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

6. spacer 5.15|1569967|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

7. spacer 5.15|1569967|22|NZ_AP018034|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

8. spacer 1.2|330836|21|NZ_AP018034|PILER-CR matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 2, identity: 0.905

gtcacgctggcgccgccgtca	CRISPR spacer
ctcacgctggcgccgccgtcc	Protospacer
 ******************* 

9. spacer 5.2|1569040|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

10. spacer 5.2|1569040|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

11. spacer 5.2|1569040|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

12. spacer 5.2|1569040|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

13. spacer 5.2|1569040|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

14. spacer 5.3|1569094|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909

ggtaccgtcctcgccggcggtg	CRISPR spacer
ggcaccgtcctcgccggcggtt	Protospacer
**.****************** 

15. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

16. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

17. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

18. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

19. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

20. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

21. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

22. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

23. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

24. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgggg	Protospacer
******************** .

25. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
accgccgatcaggccggcggca	Protospacer
..********************

26. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ctcggcgatcaggccggcggca	Protospacer
 *** *****************

27. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

28. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

29. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

30. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

31. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcg	Protospacer
***************** ***.

32. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ggcgccgatcaggccggcggcc	Protospacer
* ******************* 

33. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggcctgcggcg	Protospacer
*************** *****.

34. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

35. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgccg	Protospacer
******************* *.

36. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgagcaggccggcggcc	Protospacer
******** ************ 

37. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

38. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

39. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

40. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

41. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgcgg	Protospacer
*******************  .

42. spacer 5.4|1569148|22|NZ_AP018034|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
ttcgccgatcaggccggcggtg	Protospacer
 *******************..

43. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
ctcgccgaacacgcggaagccgtct	Protospacer
**.*********** ********* 

44. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
attgtcgaacacgcggaagccgtcg	Protospacer
 ***.********* **********

45. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

46. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

47. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

48. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
catgcggaacacgccgaatccgtcg	Protospacer
* *** ************ ******

49. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgatcacgccgtagccgttg	Protospacer
******** ******* ******.*

50. spacer 5.15|1569967|22|NZ_AP018034|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864

caatccggcggcgccgccggca	CRISPR spacer
gaatccggcggcgccgccgggc	Protospacer
 *******************  

51. spacer 6.5|2067768|24|NZ_AP018034|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

52. spacer 6.5|2067768|24|NZ_AP018034|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

53. spacer 2.1|362579|27|NZ_AP018034|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

54. spacer 2.1|362579|27|NZ_AP018034|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

55. spacer 2.7|362975|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ccgaagccgatgtcgtagcggccggcg	Protospacer
 ************.***** *****.*

56. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg	Protospacer
.* ********* ***********.**

57. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
acggcgccgaagttgaggccgccgacg	Protospacer
**  **************.****** *

58. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

59. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

60. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

61. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
tccgccgaacgcgccgaagccgtcg	Protospacer
...*******.**************

62. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

63. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

64. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

65. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

66. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

67. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacacgccgatgccctgc	Protospacer
***************** *** *  

68. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
aatgccgaattcgccgaagccgtcg	Protospacer
  *******. **************

69. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cccgtagaacacgccgaagccgtcg	Protospacer
*..*. *******************

70. spacer 5.14|1569910|25|NZ_AP018034|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgccaccgacccccccttgc	CRISPR spacer
ttttccgacaccgacccccccttga	Protospacer
.** *** **************** 

71. spacer 6.5|2067768|24|NZ_AP018034|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcgaagaagctgaacacgcccgc	Protospacer
**************** ****  .

72. spacer 6.5|2067768|24|NZ_AP018034|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
gtcgatgaagctgaacccgccgaa	Protospacer
.**** ****************  

73. spacer 6.5|2067768|24|NZ_AP018034|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcggagaagctgaacccgcccgg	Protospacer
****.****************   

74. spacer 2.1|362579|27|NZ_AP018034|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

75. spacer 2.1|362579|27|NZ_AP018034|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

76. spacer 2.7|362975|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
gcgaagccgaagttgtagctgcgctcg	Protospacer
********** ***********   .*

77. spacer 2.7|362975|27|NZ_AP018034|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
atgaagccgatgttgtcgctaccgggg	Protospacer
..************** ***.**** *

78. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

79. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

80. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

81. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccccgcggaagttgaggtcgcgggtg	Protospacer
 ****** ************** *. *

82. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

83. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

84. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

85. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

86. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

87. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

88. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

89. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

90. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

91. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

92. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

93. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

94. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

95. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

96. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

97. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

98. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

99. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

100. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

101. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccttaccgaagttgaggtcgacgagg	Protospacer
 **...*************** *****

102. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

103. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

104. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

105. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

106. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

107. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

108. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gctgccgtgggtgccatcgttgccgagt	Protospacer
*.***** *****************. .

109. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

110. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

111. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gttgccgcgggtgccctcgttgcggacg	Protospacer
******* ******* ******* *.* 

112. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gccgccgaacacgccgaagccgttt	Protospacer
 ..********************. 

113. spacer 5.5|1569202|25|NZ_AP018034|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaacacgccgacgccgcgc	Protospacer
 **************** ****.  

114. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

115. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

116. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

117. spacer 5.13|1569844|34|NZ_AP018034|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853

gtcgccgtgcagccagccaccaccgcca-ccggcg	CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc-	Protospacer
 *************.********* *** ** ** 

118. spacer 2.1|362579|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
agttcactggtgtccacatcgcccgaa	Protospacer
*.. ***.***************** .

119. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg	Protospacer
**   *.***** ******************.*

120. spacer 2.7|362975|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ggataggcgatgttgtagctgccggaa	Protospacer
* . ** ****************** .

121. spacer 2.9|363125|27|NZ_AP018034|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778

gccaagccgatatcgaagatcccggtg	CRISPR spacer
accatgccgatatcgacgatcccgtcc	Protospacer
.*** *********** ******* . 

122. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tagacgccgaagtcgaggtcggcgagg	Protospacer
    *********.******* *****

123. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
ctcccgccgaagttgagggtgccgaac	Protospacer
 .**************** .*****. 

124. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
aagaagccgaagttgaggtcgccgtag	Protospacer
*    ******************* .*

125. spacer 2.10|363185|27|NZ_AP018034|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg	Protospacer
   .******.**.*************

126. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

127. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

128. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

129. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccggcggtgccatcggtgccgagg	Protospacer
* ****** ********** *****.  

130. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

131. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

132. spacer 5.13|1569844|34|NZ_AP018034|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824

--gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca	Protospacer
  ****.*  *****  ******************.

133. spacer 2.4|362774|27|NZ_AP018034|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

aagccgcccgagttcgcgagaccgaag	CRISPR spacer
tgaccgcccgagttcgcgagacgttgg	Protospacer
 ..*******************   .*

134. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

135. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

136. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

137. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

138. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

139. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

140. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

141. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

142. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

143. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

144. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

145. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

146. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

147. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

148. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

149. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

150. spacer 5.1|1568980|28|NZ_AP018034|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
agcacccggggtgccgtcgttgccggcg	Protospacer
. ..** ********.*********** 

151. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc	Protospacer
. *  **** *********.********** 

152. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg	Protospacer
**. ***.************ ******. *.

153. spacer 6.3|2067678|30|NZ_AP018034|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

154. spacer 6.3|2067678|30|NZ_AP018034|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

155. spacer 6.3|2067678|30|NZ_AP018034|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

156. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
ttgagatccgcgacgatgggtgtggcgccggc	Protospacer
**    .********.**** ***********

157. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
ttcccgcaggcgacggtgcgggcggcgccggc	Protospacer
**..* *  ********* ***.*********

158. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca	Protospacer
  * **.*****.**************** *..

159. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

160. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact	Protospacer
* ********.**********.**** .**.. 

161. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc	Protospacer
 ***************** ** ***.* *  * 

162. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

163. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc	Protospacer
.   ********.******.*********  

164. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

165. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

166. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

167. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

168. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

169. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

170. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc	Protospacer
.   **************** *.***** * 

171. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

172. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgc--gccttgcccgccgttgccgccggca	CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg	Protospacer
  ..**  **********  *********** .

173. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
attgccgccctggccgccgttgccgccgatc	Protospacer
* *  ****.** ***************.. 

174. spacer 6.3|2067678|30|NZ_AP018034|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

175. spacer 6.3|2067678|30|NZ_AP018034|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

176. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agcgcggccgcgtcggtgggggtggcgcccgc	Protospacer
  . *  ***** **************** **

177. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 8, identity: 0.75

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cgcaccaccgcggcggtgcgggtggcgccggc	Protospacer
. . *. *****.***** *************

178. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc	Protospacer
  *.  .******************.*****. 

179. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

180. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

181. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

182. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

183. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

184. spacer 3.1|688102|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

185. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg	Protospacer
.... ****.***************** .*.

186. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
tggcccgccttgccctccattgccgccggac	Protospacer
 . . ********** **.**********  

187. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
atccttgccttgaccgccgttgccgccgctg	Protospacer
* .. .****** *************** ..

188. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accccagccctgcccgccgttgccgccgctc	Protospacer
* ..  ***.****************** . 

189. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc	Protospacer
. ******** ********* ****   .* 

190. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accggcaccttgcccgccattgccgccatgt	Protospacer
* . **.***********.********.   

191. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc	Protospacer
 .   *******.******* *******.* 

192. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
agcgtggccttggccgccgttgccggcggtc	Protospacer
*..   ****** ************ ***. 

193. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag	Protospacer
   .* *******.** *************. 

194. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag	Protospacer
   .* *******.** *************. 

195. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
gcccccggcgtgacggtggaggtggcgccggc	Protospacer
 ...*.  **.********.************

196. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag	Protospacer
   .* *******.** *************. 

197. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc	Protospacer
... *. * ******* ** ************

198. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc	Protospacer
... *. * ******* ** ************

199. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
gtggcggtggcggcggtgggggtggcggcggc	Protospacer
 *  *  . ***.************** ****

200. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
tgcgaccgggcgacggtggaggtggcgccagc	Protospacer
* .  .*  **********.*********.**

201. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
caacattcagcgacggtgggtgtggcggcggc	Protospacer
.  . *.* *********** ****** ****

202. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cgcacgacggcggcggtgcgggtggcgccggc	Protospacer
. . *  * ***.***** *************

203. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

204. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

205. spacer 2.6|362909|33|NZ_AP018034|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

206. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

207. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg	Protospacer
  .. ****** *******.********  .

208. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggccagaacttccccgctgttgccgccggca	Protospacer
..... . *** *****.*************

209. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

210. spacer 5.10|1569595|31|NZ_AP018034|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc	Protospacer
...   ****** ************ ***. 

211. spacer 5.13|1569844|34|NZ_AP018034|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706

gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca	Protospacer
 . .. .*******.***************.**.

212. spacer 8.9|3107022|35|NZ_AP018034|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

acttgcgcgcacaacgcatccgccatccacggggc	CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt	Protospacer
...  **********.***.**********. **.

213. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
aggacggccgcggcggtggcggtggcgccgta	Protospacer
    *  *****.****** **********  

214. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
ctgctggccgcgacggtgctggtggcgccgat	Protospacer
.* ..  ***********  **********..

215. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
tcgcggatcgggatggtgggggtggcgccgga	Protospacer
*. .   .** **.***************** 

216. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
gcgagggcggcgacggtgggcgtgtcgccggc	Protospacer
 .     * *********** *** *******

217. spacer 10.6|3736252|32|NZ_AP018034|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cgcagcagcgcgacggtgtcggtggcgccggt	Protospacer
. .  .  **********  ***********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2929556 : 2967828 47 Mycobacterium_phage(30.0%) head,terminase,protease,integrase,capsid,tRNA attL 2958357:2958384|attR 2967981:2968008
DBSCAN-SWA_2 3701837 : 3750330 23 Burkholderia_virus(25.0%) transposase,tRNA,protease NA
DBSCAN-SWA_3 4301030 : 4369726 60 Mycobacterium_phage(50.0%) transposase,tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage