Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP017930 Lactobacillus sakei subsp. sakei DSM 20017 = JCM 1157 strain LT-13 plasmid pLs13-a, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP017929 Lactobacillus sakei subsp. sakei DSM 20017 = JCM 1157 strain LT-13 2 crisprs cas3,csa3,DEDDh,DinG 1 0 5 0

Results visualization

1. NZ_AP017929
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017929_1 299869-300275 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017929_2 843764-843847 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP017929_2 2.1|843787|38|NZ_AP017929|CRISPRCasFinder 843787-843824 38 NZ_AP017929.1 843661-843698 0 1.0

1. spacer 2.1|843787|38|NZ_AP017929|CRISPRCasFinder matches to position: 843661-843698, mismatch: 0, identity: 1.0

aattagagtgcttttagtgcttgtttagattttgagca	CRISPR spacer
aattagagtgcttttagtgcttgtttagattttgagca	Protospacer
**************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 428276 : 453321 23 Bacillus_phage(18.18%) bacteriocin,transposase NA
DBSCAN-SWA_2 1171457 : 1179567 9 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 1262556 : 1271301 10 Acanthocystis_turfacea_Chlorella_virus(28.57%) NA NA
DBSCAN-SWA_4 1424751 : 1432781 8 Staphylococcus_phage(28.57%) tRNA NA
DBSCAN-SWA_5 1870549 : 1880168 9 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage