Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP041924 Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome 6 crisprs RT,DEDDh,cas3 0 1 15 0

Results visualization

1. NZ_CP041924
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041924_1 158799-159047 Orphan NA
2 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041924_2 379514-379760 Orphan NA
2 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041924_3 605924-606159 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041924_4 755940-756041 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041924_5 921891-922129 Orphan NA
2 spacers
RT,DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP041924_6 1302689-1302762 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP041924_6 6.1|1302712|28|NZ_CP041924|CRISPRCasFinder 1302712-1302739 28 NC_041878 Pectobacterium phage CBB, complete genome 170074-170101 6 0.786

1. spacer 6.1|1302712|28|NZ_CP041924|CRISPRCasFinder matches to NC_041878 (Pectobacterium phage CBB, complete genome) position: , mismatch: 6, identity: 0.786

tgttaatgttgctacgattgagggttat	CRISPR spacer
tgttaatgttactacgattgtggaagaa	Protospacer
**********.********* **.  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13818 : 56914 41 Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(20.0%) transposase,tRNA NA
DBSCAN-SWA_2 147910 : 194342 45 Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(20.0%) transposase,tRNA NA
DBSCAN-SWA_3 205071 : 280600 52 Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(28.57%) transposase,tRNA NA
DBSCAN-SWA_4 287407 : 352230 53 Bacillus_virus(18.18%) transposase,tRNA,protease NA
DBSCAN-SWA_5 368447 : 426626 48 Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(36.36%) transposase,tRNA NA
DBSCAN-SWA_6 430961 : 492508 56 Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(13.33%) transposase,tRNA NA
DBSCAN-SWA_7 497474 : 661624 116 Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(21.21%) transposase,tRNA,protease NA
DBSCAN-SWA_8 669905 : 739358 52 Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(27.78%) transposase,tRNA,head,protease NA
DBSCAN-SWA_9 742910 : 885810 114 Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(31.25%) transposase,integrase,tRNA attL 739120:739179|attR 804800:805072
DBSCAN-SWA_10 895790 : 952931 48 Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(16.67%) transposase,tRNA NA
DBSCAN-SWA_11 981534 : 1029884 44 Wolbachia_phage(61.9%) transposase,tRNA,protease NA
DBSCAN-SWA_12 1056296 : 1124252 49 Staphylococcus_phage(22.22%) transposase,tRNA NA
DBSCAN-SWA_13 1127700 : 1272956 117 Wolbachia_phage(30.77%) transposase,tRNA,protease,tail NA
DBSCAN-SWA_14 1276635 : 1431088 113 Wolbachia_phage(28.21%) transposase,tRNA NA
DBSCAN-SWA_15 1439082 : 1447974 7 Wolbachia_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage