Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023564 Brachybacterium ginsengisoli strain DCY80 chromosome, complete genome 4 crisprs csa3,cas3,DEDDh,Cas9_archaeal,WYL,DinG 1 3 0 0

Results visualization

1. NZ_CP023564
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023564_1 126136-126246 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023564_2 592107-593204 Orphan NA
20 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023564_3 631064-631178 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023564_4 3810790-3810957 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023564_1 1.1|126160|21|NZ_CP023564|CRISPRCasFinder 126160-126180 21 NZ_CP023564.1 1999864-1999884 2 0.905
NZ_CP023564_1 1.1|126160|21|NZ_CP023564|CRISPRCasFinder 126160-126180 21 NZ_CP023564.1 3489200-3489220 2 0.905

1. spacer 1.1|126160|21|NZ_CP023564|CRISPRCasFinder matches to position: 1999864-1999884, mismatch: 2, identity: 0.905

ggatcacgaccacgagggcca	CRISPR spacer
ggatcacgaccaccacggcca	Protospacer
************* * *****

2. spacer 1.1|126160|21|NZ_CP023564|CRISPRCasFinder matches to position: 3489200-3489220, mismatch: 2, identity: 0.905

ggatcacgaccacgagggcca	CRISPR spacer
ggatgacgaccacgagggtca	Protospacer
**** *************.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023564_2 2.1|592125|30|NZ_CP023564|CRT 592125-592154 30 NZ_CP013105 Paraburkholderia caribensis strain MWAP64 plasmid 2, complete sequence 208409-208438 6 0.8
NZ_CP023564_2 2.9|592593|30|NZ_CP023564|CRT 592593-592622 30 NZ_CP017944 Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence 129432-129461 6 0.8
NZ_CP023564_2 2.2|592173|30|NZ_CP023564|CRT 592173-592202 30 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 315235-315264 7 0.767

1. spacer 2.1|592125|30|NZ_CP023564|CRT matches to NZ_CP013105 (Paraburkholderia caribensis strain MWAP64 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.8

cgaggtcaacaccgctgagaacacggacgt	CRISPR spacer
cgaggtcaacgccgctgagatcatcgagtt	Protospacer
**********.********* **. **  *

2. spacer 2.9|592593|30|NZ_CP023564|CRT matches to NZ_CP017944 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

ggcggacaacgctgccgagaacacggatgt	CRISPR spacer
gtcggccaatgctgccgagaacacggtctt	Protospacer
* *** ***.**************** . *

3. spacer 2.2|592173|30|NZ_CP023564|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 7, identity: 0.767

ggcggacaacgctgctgagaacac-cgacgt	CRISPR spacer
ctgggacaacgatgctgagaacacgcagcg-	Protospacer
   ******** ************ *..** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage