Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023539 Staphylococcus lugdunensis strain FDAARGOS_377 chromosome, complete genome 5 crisprs csa3,DEDDh,cas3,DinG 1 0 200 0

Results visualization

1. NZ_CP023539
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023539_1 449109-449198 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023539_2 685497-685587 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023539_3 1115920-1116006 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023539_4 1632212-1632292 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023539_5 2218259-2218349 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023539_3 3.1|1115950|27|NZ_CP023539|CRISPRCasFinder 1115950-1115976 27 NZ_CP023539.1 1673379-1673405 2 0.926

1. spacer 3.1|1115950|27|NZ_CP023539|CRISPRCasFinder matches to position: 1673379-1673405, mismatch: 2, identity: 0.926

gggccccaacaaagagaatttcgaaat	CRISPR spacer
gggccccaacaaagagaaatgcgaaat	Protospacer
****************** * ******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8462 7 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_2 13197 : 13509 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 17106 : 18861 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_4 24176 : 25688 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_5 37620 : 41014 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_6 45481 : 46213 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_7 50057 : 52201 3 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_8 63180 : 64734 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_9 85363 : 85996 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_10 111858 : 120045 8 uncultured_Caudovirales_phage(40.0%) NA NA
DBSCAN-SWA_11 138741 : 141269 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_12 144522 : 149477 4 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_13 161964 : 162846 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_14 184317 : 188376 5 Staphylococcus_virus(33.33%) NA NA
DBSCAN-SWA_15 197821 : 199915 1 Enterobacteria_phage(100.0%) protease NA
DBSCAN-SWA_16 207479 : 208085 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_17 219442 : 227688 6 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_18 244350 : 246014 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_19 249946 : 250837 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_20 254701 : 280934 8 Tupanvirus(80.0%) NA NA
DBSCAN-SWA_21 287098 : 288511 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_22 320062 : 321868 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_23 331398 : 334836 4 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_24 346658 : 348266 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_25 355646 : 361592 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_26 373609 : 378557 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_27 384429 : 385071 1 Golden_Marseillevirus(100.0%) NA NA
DBSCAN-SWA_28 392229 : 393744 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_29 397005 : 401836 7 Yellowstone_lake_mimivirus(33.33%) NA NA
DBSCAN-SWA_30 415751 : 420424 4 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_31 424129 : 429388 3 Moraxella_phage(33.33%) tRNA NA
DBSCAN-SWA_32 434631 : 437899 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_33 445146 : 458319 20 Staphylococcus_phage(62.5%) terminase,integrase attL 447096:447115|attR 460925:460944
DBSCAN-SWA_34 464026 : 466468 3 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_35 476606 : 477692 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_36 481986 : 492224 9 Bacillus_virus(40.0%) NA NA
DBSCAN-SWA_37 499839 : 505326 6 Catovirus(33.33%) NA NA
DBSCAN-SWA_38 528691 : 532376 3 Aeropyrum_pernix_spindle-shaped_virus(50.0%) NA NA
DBSCAN-SWA_39 549110 : 549836 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_40 559847 : 560192 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_41 570455 : 571193 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_42 579184 : 609438 31 Staphylococcus_phage(96.0%) tRNA NA
DBSCAN-SWA_43 619861 : 625119 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_44 634359 : 636069 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_45 639548 : 642510 2 Serratia_phage(50.0%) tRNA NA
DBSCAN-SWA_46 646760 : 651070 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_47 654624 : 655758 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_48 667836 : 671031 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_49 675505 : 678050 2 Staphylococcus_phage(50.0%) transposase NA
DBSCAN-SWA_50 682895 : 689157 4 Feldmannia_irregularis_virus(25.0%) NA NA
DBSCAN-SWA_51 694269 : 705584 10 Brevibacillus_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_52 714815 : 717446 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_53 726809 : 760941 29 uncultured_Mediterranean_phage(18.75%) tRNA NA
DBSCAN-SWA_54 774376 : 780561 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_55 783653 : 786824 2 Micromonas_pusilla_virus(50.0%) NA NA
DBSCAN-SWA_56 793386 : 794337 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_57 797360 : 810988 13 Catovirus(14.29%) tRNA NA
DBSCAN-SWA_58 823384 : 826199 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_59 833786 : 835124 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_60 839787 : 841212 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_61 846169 : 849696 4 Lactococcus_phage(33.33%) transposase NA
DBSCAN-SWA_62 853910 : 855395 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_63 860964 : 871168 11 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_64 881374 : 884777 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_65 893569 : 900705 5 Bacillus_virus(25.0%) tRNA NA
DBSCAN-SWA_66 903974 : 905748 3 Geobacillus_phage(50.0%) NA NA
DBSCAN-SWA_67 912303 : 917816 5 Acinetobacter_phage(75.0%) NA NA
DBSCAN-SWA_68 926866 : 930309 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_69 934697 : 936299 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_70 944224 : 950280 7 Yellowstone_lake_phycodnavirus(33.33%) lysis NA
DBSCAN-SWA_71 953711 : 954503 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_72 961663 : 973701 16 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_73 984827 : 986090 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_74 996480 : 1000874 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_75 1006170 : 1007811 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_76 1011535 : 1012660 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_77 1016973 : 1022153 6 Phage_Wrath(33.33%) NA NA
DBSCAN-SWA_78 1032319 : 1032862 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_79 1036045 : 1036918 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_80 1044936 : 1045413 1 Fowlpox_virus(100.0%) NA NA
DBSCAN-SWA_81 1051364 : 1057600 4 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_82 1060745 : 1061366 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_83 1068015 : 1069062 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_84 1073191 : 1078931 4 Bodo_saltans_virus(33.33%) NA NA
DBSCAN-SWA_85 1086334 : 1095210 6 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_86 1102639 : 1103401 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_87 1108024 : 1114477 5 Erwinia_phage(33.33%) tRNA,protease NA
DBSCAN-SWA_88 1117572 : 1120547 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_89 1132946 : 1133363 1 Lactococcus_phage(100.0%) transposase NA
DBSCAN-SWA_90 1140173 : 1142174 3 Acanthamoeba_polyphaga_mimivirus(33.33%) NA NA
DBSCAN-SWA_91 1152168 : 1154172 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_92 1157319 : 1158252 1 Prochlorococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_93 1161492 : 1163754 3 Methanothermobacter_phage(50.0%) NA NA
DBSCAN-SWA_94 1166807 : 1167419 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_95 1171454 : 1176061 4 Halovirus(33.33%) NA NA
DBSCAN-SWA_96 1180065 : 1182816 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_97 1202397 : 1202979 1 Cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_98 1209678 : 1214229 3 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_99 1219178 : 1220237 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_100 1223765 : 1226603 5 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_101 1238543 : 1240391 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_102 1248729 : 1257703 9 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_103 1265736 : 1266909 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_104 1270187 : 1285008 14 Prochlorococcus_phage(22.22%) NA NA
DBSCAN-SWA_105 1297057 : 1300870 1 Staphylococcus_virus(100.0%) NA NA
DBSCAN-SWA_106 1311646 : 1312948 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_107 1322669 : 1327513 3 uncultured_Mediterranean_phage(33.33%) protease NA
DBSCAN-SWA_108 1346431 : 1348240 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_109 1354816 : 1356830 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_110 1362290 : 1364900 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_111 1369850 : 1373501 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_112 1390167 : 1390761 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_113 1400458 : 1409679 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_114 1416560 : 1422584 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_115 1425851 : 1426211 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_116 1430354 : 1433023 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_117 1461614 : 1466060 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_118 1477342 : 1478584 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_119 1485433 : 1497837 21 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_120 1507066 : 1508020 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_121 1514859 : 1521016 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_122 1529748 : 1534694 5 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_123 1538840 : 1541675 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_124 1550839 : 1559099 8 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_125 1568905 : 1599531 24 uncultured_Caudovirales_phage(36.84%) transposase NA
DBSCAN-SWA_126 1602729 : 1609350 8 Pandoravirus(16.67%) NA NA
DBSCAN-SWA_127 1619580 : 1620963 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_128 1629183 : 1629750 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_129 1636810 : 1637278 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_130 1647510 : 1648272 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_131 1651794 : 1652844 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_132 1657936 : 1659981 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_133 1666798 : 1670848 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_134 1676148 : 1680656 5 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_135 1690960 : 1691518 1 Clostridium_phage(100.0%) integrase attL 1685945:1685958|attR 1692126:1692139
DBSCAN-SWA_136 1695298 : 1696081 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_137 1707682 : 1715463 8 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_138 1727951 : 1728620 1 Elephant_endotheliotropic_herpesvirus(100.0%) NA NA
DBSCAN-SWA_139 1733466 : 1734879 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_140 1755356 : 1756031 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_141 1767652 : 1768843 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_142 1772096 : 1783200 6 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_143 1786999 : 1791820 8 Bacillus_virus(50.0%) tRNA NA
DBSCAN-SWA_144 1797288 : 1799748 1 Escherichia_phage(100.0%) protease NA
DBSCAN-SWA_145 1804955 : 1806338 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_146 1818472 : 1828708 9 Tupanvirus(16.67%) protease,tRNA NA
DBSCAN-SWA_147 1837996 : 1840470 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_148 1846110 : 1849408 3 Hokovirus(33.33%) tRNA NA
DBSCAN-SWA_149 1852968 : 1853586 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_150 1868968 : 1870699 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_151 1886645 : 1897083 8 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_152 1910749 : 1913886 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_153 1923659 : 1925183 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_154 1932050 : 1951921 27 Staphylococcus_phage(43.75%) terminase,integrase attL 1930994:1931053|attR 1944075:1944148
DBSCAN-SWA_155 1962925 : 1972247 10 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_156 1975336 : 1975897 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_157 1980227 : 1980986 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_158 1985280 : 1986063 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_159 1992535 : 1993375 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_160 2003314 : 2010751 4 Bacillus_virus(66.67%) tRNA NA
DBSCAN-SWA_161 2016892 : 2023356 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_162 2030947 : 2031748 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_163 2035498 : 2036479 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_164 2051606 : 2061232 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_165 2075417 : 2076116 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_166 2080736 : 2082758 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_167 2094454 : 2100169 6 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_168 2106084 : 2107203 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_169 2113888 : 2116465 3 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_170 2121632 : 2128477 5 Bacillus_virus(33.33%) tRNA NA
DBSCAN-SWA_171 2133207 : 2135820 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_172 2142495 : 2144053 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_173 2150157 : 2150838 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_174 2158510 : 2159746 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_175 2165840 : 2170594 4 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_176 2173667 : 2173868 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_177 2187316 : 2187988 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_178 2196775 : 2198159 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_179 2201594 : 2202290 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_180 2219804 : 2222837 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_181 2227667 : 2230056 2 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_182 2256845 : 2259557 3 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_183 2263643 : 2265260 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_184 2277459 : 2334111 52 Staphylococcus_phage(25.0%) integrase,protease,transposase attL 2290417:2290434|attR 2317322:2317339
DBSCAN-SWA_185 2341113 : 2343567 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_186 2347424 : 2348174 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_187 2368819 : 2369998 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_188 2373495 : 2375881 2 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_189 2382931 : 2395622 9 Klosneuvirus(25.0%) holin NA
DBSCAN-SWA_190 2404437 : 2405328 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_191 2408608 : 2412743 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_192 2444178 : 2452850 6 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_193 2456878 : 2457817 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_194 2464720 : 2468111 6 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_195 2478164 : 2482794 4 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_196 2504971 : 2505964 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_197 2538407 : 2542075 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_198 2546462 : 2547158 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_199 2556818 : 2561037 4 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_200 2569280 : 2569943 1 Bacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage