1. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtgcc Protospacer
********************.*
2. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
4. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
5. spacer 9.15|1573049|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 9.15|1573049|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 9.15|1573049|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 9.15|1573049|22|NZ_CP023584|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
9. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 2, identity: 0.917
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcgggacagcatggcgttg Protospacer
******* *.**************
10. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 2, identity: 0.917
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcgggacagcatggcgttg Protospacer
******* *.**************
11. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NC_028947 (Mycobacterium phage Kratio, complete genome) position: , mismatch: 2, identity: 0.917
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccaaacggcatggcgttg Protospacer
********.***.***********
12. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 2, identity: 0.917
atgagcccgccggcgccgccgttg CRISPR spacer
aagagcacgccggcgccgccgttg Protospacer
* **** *****************
13. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917
atgagcccgccggcgccgccgttg CRISPR spacer
atgaggacgccggcgccgccgttg Protospacer
***** *****************
14. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtggg Protospacer
********************
15. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
agtcggcggtgccgacggtgtc Protospacer
*************.*******
16. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggcgtc Protospacer
.*****************.***
17. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgtcggcggtgtc Protospacer
.**********.**********
18. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggcggcgtc Protospacer
*****************.***
19. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
20. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
21. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggccgtgtc Protospacer
*************** *****
22. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgacggcggtgccggcggtgtg Protospacer
** ******************
23. spacer 8.15|1212559|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909
ggacggtggtaccggcggtcag CRISPR spacer
tgacggtggtgccggcggtcag Protospacer
*********.***********
24. spacer 9.2|1572123|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
25. spacer 9.2|1572123|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
26. spacer 9.2|1572123|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
27. spacer 9.2|1572123|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
28. spacer 9.2|1572123|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
29. spacer 9.3|1572177|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
30. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
31. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
32. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
33. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
34. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
35. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
36. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
37. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
38. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
39. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
40. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
41. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
42. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
43. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
44. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
45. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
46. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
47. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
48. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
49. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
50. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
51. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
52. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
53. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
54. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
55. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
56. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 3, identity: 0.889
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcggcgaggagcaggccggcgttg Protospacer
.***** ***.****************
57. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
58. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP026559 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
59. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
60. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
61. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP019872 (Pseudomonas syringae pv. tomato strain B13-200 plasmid pB13-200A, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
62. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
63. spacer 1.6|335652|24|NZ_CP023584|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
64. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgagcagcatggcgctg Protospacer
*********.**********.**
65. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
66. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
67. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacaggatggcgtcg Protospacer
************* *******.*
68. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcgcag Protospacer
******* *************. *
69. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgagcagcatggcgctg Protospacer
*********.**********.**
70. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
71. spacer 1.6|335652|24|NZ_CP023584|CRT matches to CP054316 (Escherichia coli strain SCU-483 plasmid pSCU-483-1) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
72. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
73. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
74. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
75. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_LR723679 (Arsenite-oxidising bacterium NT-25 plasmid 3) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagcatgccgtcg Protospacer
***************** ***.*
76. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
77. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcggtgaacagcatggcgttc Protospacer
****** .***************
78. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
79. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcagcgccgaacagcatggcgtcg Protospacer
*.*******************.*
80. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
81. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
82. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
83. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
84. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
85. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
86. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
87. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
88. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
89. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
90. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccgatcagcatggcggcg Protospacer
********** ********** .*
91. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
92. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
93. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
94. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
95. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
96. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP031228 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pPla107-2) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
97. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
98. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
99. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
100. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
101. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
102. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacaggatggcgtcg Protospacer
************* *******.*
103. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
104. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacaggatggcgtcg Protospacer
************* *******.*
105. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
106. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
107. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP044960 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
108. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
109. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
110. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
111. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
112. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
113. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052880 (Escherichia coli strain C21 plasmid pC21-3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
114. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccggacagcatggcgagg Protospacer
*********.*********** *
115. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgaacaggatggcgatg Protospacer
************* ****** **
116. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
117. spacer 1.6|335652|24|NZ_CP023584|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
118. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgccgagcagcatggcgctg Protospacer
*********.**********.**
119. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
120. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP019215 (Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
121. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
122. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
123. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
124. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
125. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
126. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
127. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
128. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
129. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
130. spacer 1.6|335652|24|NZ_CP023584|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
131. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
132. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
133. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
134. spacer 1.6|335652|24|NZ_CP023584|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
135. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
136. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_LN890525 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgcagaacagcatggcggtt Protospacer
******* ************* *
137. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
138. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
139. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
140. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
141. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
142. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
143. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_LT963412 (Pseudomonas syringae isolate CFBP3840 plasmid PP3, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
144. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
145. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
146. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
147. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
148. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
149. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
150. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
151. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
152. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcggcgaacagcatggcgatc Protospacer
****** ************** *
153. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
154. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
155. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
156. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
157. spacer 1.6|335652|24|NZ_CP023584|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
158. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
159. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
160. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
161. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
162. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
163. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
164. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
165. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
166. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgtgcgccgaacagcatggcgatg Protospacer
* ****************** **
167. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP047261 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326F, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
gcggcgctgaacagcatgccgttg Protospacer
******.********** *****
168. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
ccggcgccgaacagcatggcgttg CRISPR spacer
cgcgcgccgaacagcatggcgatg Protospacer
* ****************** **
169. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ttgagccagccggcgccgccgttc Protospacer
****** ***************
170. spacer 1.8|335748|24|NZ_CP023584|CRT matches to MN010758 (Gordonia phage Dardanus, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtgaacccgccggcgccgccgttc Protospacer
.***.******************
171. spacer 1.8|335748|24|NZ_CP023584|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
172. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
173. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_CP044330 (Methylocystis rosea strain BRCS1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgacgccgccggcgccgccgttg Protospacer
*** ******************
174. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
atcagcccgccggcgccgccgaag Protospacer
** ****************** *
175. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
176. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
177. spacer 1.8|335748|24|NZ_CP023584|CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
178. spacer 1.8|335748|24|NZ_CP023584|CRT matches to MH638294 (Ralstonia phage GP4, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
179. spacer 1.8|335748|24|NZ_CP023584|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
180. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_CP025550 (Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
atgagcccgccagcgccgccgcgg Protospacer
***********.*********. *
181. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgacgccgccggcgccgccgttg Protospacer
*** ******************
182. spacer 1.8|335748|24|NZ_CP023584|CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
183. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 3, identity: 0.885
cgccgttgacgccggccgcgccggat CRISPR spacer
tgccgatgacgccggccgggccggat Protospacer
.**** ************ *******
184. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 3, identity: 0.885
cgccgttgacgccggccgcgccggat CRISPR spacer
tgccgatgacgccggccgggccggat Protospacer
.**** ************ *******
185. spacer 1.9|335793|26|NZ_CP023584|CRT matches to CP021131 (Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence) position: , mismatch: 3, identity: 0.885
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccggtgacgccggacgcgccgggt Protospacer
***** ********* ********.*
186. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 3, identity: 0.885
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttgccgccggccccgccgggt Protospacer
******** ******** ******.*
187. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
188. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
189. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
190. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
191. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
192. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
193. spacer 6.16|927207|24|NZ_CP023584|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
194. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
195. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
196. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
197. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
198. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
199. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
200. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
201. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
202. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
203. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
204. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
205. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
206. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
207. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
208. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
209. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtggt Protospacer
.******************* .
210. spacer 8.7|1212175|22|NZ_CP023584|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
catcggcggtgccggcggtgtg Protospacer
..*******************
211. spacer 8.11|1212358|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864
gctgtggggcggcggtggtgcc CRISPR spacer
cgtgtggggcggcggtggtgca Protospacer
*******************
212. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
213. spacer 9.4|1572231|22|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
214. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
215. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
216. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
217. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
218. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
219. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
220. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
221. spacer 9.15|1573049|22|NZ_CP023584|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
222. spacer 11.5|2088332|24|NZ_CP023584|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
223. spacer 11.5|2088332|24|NZ_CP023584|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
224. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccggcgaagagcaggccggcggcg Protospacer
*** ** ***************** .*
225. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgaggagccggccggcgacg Protospacer
**********.**** ******** .*
226. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgaggagccggccggcggtc Protospacer
**********.**** ******** *
227. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcgcagaagagcgggccggcgtgg Protospacer
.****** *******.********* *
228. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gccgcgccgaagagcagggcggcactg Protospacer
** *************** ****..**
229. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP046258 (Gordonia sp. 135 plasmid pG135, complete sequence) position: , mismatch: 4, identity: 0.852
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gagacgccgaagaacgggccggcgttg Protospacer
* *.*********.*.***********
230. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
231. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
232. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
233. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
234. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgccgaacagcatcgcgaac Protospacer
***************** ***
235. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
236. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
237. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
238. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
239. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
240. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
241. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
242. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
243. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
244. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
245. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
246. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
247. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
acggcgccgaacagaatggcgtcc Protospacer
************* *******.
248. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 4, identity: 0.833
ccggcgccgaacagcatggcgttg CRISPR spacer
ccggcgctgaacagcatggcgaac Protospacer
*******.*************
249. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.833
atgagcccgccggcgccgccgttg CRISPR spacer
tcgagcccgccggcgccgccattc Protospacer
.******************.**
250. spacer 1.8|335748|24|NZ_CP023584|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
atgagcccgccggcgccgccgttg CRISPR spacer
tccagcccgccggcgccggcgttg Protospacer
. *************** *****
251. spacer 1.9|335793|26|NZ_CP023584|CRT matches to KY092483 (Streptomyces phage Bioscum, complete genome) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgtcgacgccggccgcgccgacg Protospacer
******.****************.
252. spacer 1.9|335793|26|NZ_CP023584|CRT matches to MT711975 (Streptomyces phage Alderaan, complete genome) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgtcgacgccggccgcgccgacg Protospacer
******.****************.
253. spacer 1.9|335793|26|NZ_CP023584|CRT matches to MK305888 (Streptomyces phage Austintatious, complete genome) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgtcgacgccggccgcgccgacg Protospacer
******.****************.
254. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NC_047792 (Streptomyces phage Ididsumtinwong, complete genome) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgtcgacgccggccgcgccgacg Protospacer
******.****************.
255. spacer 1.9|335793|26|NZ_CP023584|CRT matches to KY092481 (Streptomyces phage PapayaSalad, complete genome) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgtcgacgccggccgcgccgacg Protospacer
******.****************.
256. spacer 1.9|335793|26|NZ_CP023584|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
cgcctttggcgccggccgcgccggtg Protospacer
**** ***.***************
257. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
tgccgttgacgccggtcgcgcaggaa Protospacer
.**************.***** ***
258. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
tgccgttgacgccggtcgcgcaggaa Protospacer
.**************.***** ***
259. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttgccgccgcccgcgccgctt Protospacer
******** ***** ******** *
260. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttgccgccgcccgcgccgctt Protospacer
******** ***** ******** *
261. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
ccgcgatgacgccggacgcgccggat Protospacer
* ** ********* **********
262. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP049117 (Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttaacgcccgccgcgccgcct Protospacer
*******.***** ********* *
263. spacer 1.9|335793|26|NZ_CP023584|CRT matches to KX344445 (Streptomyces phage Nanodon, complete genome) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
ctccgttgacgccggtcgctccggac Protospacer
* *************.*** *****.
264. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 4, identity: 0.846
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgctgccgccggccgcgccgcct Protospacer
*****.** ************** *
265. spacer 2.4|337839|24|NZ_CP023584|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 4, identity: 0.833
ttccgccggcgcccgcgaaggacc CRISPR spacer
gtccgccggcgcccgcgaagggat Protospacer
********************. .
266. spacer 4.1|366432|27|NZ_CP023584|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
267. spacer 4.1|366432|27|NZ_CP023584|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
268. spacer 4.7|366828|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
269. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
270. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
271. spacer 6.10|926922|27|NZ_CP023584|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
272. spacer 6.10|926922|27|NZ_CP023584|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
273. spacer 6.10|926922|27|NZ_CP023584|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
274. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
275. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
276. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
277. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
278. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
279. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
280. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
281. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
282. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
283. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
284. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
285. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
286. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
287. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
288. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
289. spacer 6.16|927207|24|NZ_CP023584|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
290. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
291. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
292. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
293. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
gtccggcggccttggcgtagcgcct Protospacer
**********.***********.
294. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
295. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggccccggcgtcgcgcga Protospacer
***********.****** ****
296. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtaatggtc Protospacer
*******************..* .*
297. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcatcggcgtagcggcg Protospacer
.********* *********** *
298. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcctccgcgtcgcgcct Protospacer
.************ **** *****.
299. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcgggc Protospacer
.*.******************* *
300. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggccgcgtcgtagcgcca Protospacer
.********** ** *********
301. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
302. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggtgtcctcggcgtagcgcga Protospacer
******.* **************
303. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
304. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggctgcctcggcatagcgccg Protospacer
****** ********.*******
305. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
306. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggtggcctcggcgtagccccg Protospacer
.*****.************** **
307. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
308. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tggcggcggcctcgccgtagcgctt Protospacer
** *********** ********..
309. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcggac Protospacer
.*.******************* *
310. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
agccggcggcctcggcctcgcgccg Protospacer
*************** * *****
311. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
312. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
313. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
314. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
315. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
316. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
317. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
318. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
319. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
320. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
321. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
322. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
323. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
324. spacer 9.14|1572992|25|NZ_CP023584|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
325. spacer 11.5|2088332|24|NZ_CP023584|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
326. spacer 11.5|2088332|24|NZ_CP023584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
327. spacer 11.5|2088332|24|NZ_CP023584|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
328. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcgccgatgagcaggccggcgagc Protospacer
.********* *************
329. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagatg Protospacer
.. ******************* * **
330. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagatg Protospacer
.. ******************* * **
331. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgacgagcaggccggcgagc Protospacer
*** ****** *************
332. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgaagatcaggccggtgcgc Protospacer
************* ********.*.
333. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP021796 (Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagatg Protospacer
.. ******************* * **
334. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgcagcgcaggccggcggcc Protospacer
********* ** *********** .
335. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tcggcgccgaagaacaggcccgcgatc Protospacer
************.****** *** *
336. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
337. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcgccgatgagcaggccgccgacg Protospacer
********* ********** ** .*
338. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
339. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
340. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
341. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
342. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
343. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
344. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
345. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
346. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
347. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
348. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcgccgccgaagagcagggcggcaagg Protospacer
*** ************** ****. *
349. spacer 1.4|335553|27|NZ_CP023584|CRT matches to KM659098 (Sinorhizobium sp. LM21 plasmid pLM21S1, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ctgtcgccgatgagcaggccggcgtgg Protospacer
.* ****** ************** *
350. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
351. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
352. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
353. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
354. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
355. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
356. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
atgtcgccgaagagcaggccggcttcg Protospacer
..* ******************* *.*
357. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
358. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ttggcgccgaacagcaggtcggcgtag Protospacer
.********* ******.****** *
359. spacer 1.6|335652|24|NZ_CP023584|CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 5, identity: 0.792
ccggcgccgaacagcatggcgttg CRISPR spacer
atggcgccgaacagcatggcgcga Protospacer
.*******************. .
360. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gcccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
361. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gcccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
362. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
tgccgttgccgccggtcgcgccggtc Protospacer
.******* ******.******** .
363. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gcccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
364. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
acccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
365. spacer 1.9|335793|26|NZ_CP023584|CRT matches to MN369741 (Mycobacterium phage LoneWolf, complete genome) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
ggccgatgacgccggccgcgccgcgg Protospacer
**** ***************** .
366. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gcccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
367. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gcccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
368. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NC_020275 (Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gcccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
369. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gcccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
370. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
acccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
371. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gcccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
372. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gcccgtcgacgccggccgcgccgggc Protospacer
****.*****************..
373. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
ggccgatgtcgccggccgcgccggtg Protospacer
**** ** ***************
374. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgtggacgccggcctcgccgaga Protospacer
****** ********** *****..
375. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP036221 (Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccggtgacgccggcggcgccgatg Protospacer
***** ********** ******.
376. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP040251 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed1) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccggtgacgccggcggcgccgatg Protospacer
***** ********** ******.
377. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP040252 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed2) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccggtgacgccggcggcgccgatg Protospacer
***** ********** ******.
378. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
ggccgatgtcgccggccgcgccggtg Protospacer
**** ** ***************
379. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttgacgccggacacgccgccg Protospacer
*************** *.*****
380. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gttcgtcgacgccgaccgcgccggat Protospacer
.***.*******.***********
381. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttgccgccggccgcaccgccg Protospacer
******** **********.***
382. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cggcgttgacgccgtccgcgccgtcg Protospacer
** *********** ********
383. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgtcgaggccggccgcgccgcga Protospacer
******.** ************* .
384. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttgacgccggacacgccgccg Protospacer
*************** *.*****
385. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgctgacgccgaccgcgccgacg Protospacer
*****.********.********.
386. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
ggccgatgccgccggccgcgccggtg Protospacer
**** ** ***************
387. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
ccgggttgccgccggccgcgccggac Protospacer
* **** ****************.
388. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgatgacgccgcccgcgccgccc Protospacer
***** ******** ******** .
389. spacer 1.9|335793|26|NZ_CP023584|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cggcgttgacgccgcccgcgccgccc Protospacer
** *********** ******** .
390. spacer 1.9|335793|26|NZ_CP023584|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cggcgttgacgccgcccgcgccgccc Protospacer
** *********** ******** .
391. spacer 1.9|335793|26|NZ_CP023584|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cggcgttgacgccgcccgcgccgccc Protospacer
** *********** ******** .
392. spacer 1.9|335793|26|NZ_CP023584|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
tgccgttgtcgccgcccgcgccggcg Protospacer
.******* ***** *********
393. spacer 1.9|335793|26|NZ_CP023584|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cggcgttgacgccgcccgcgccgccc Protospacer
** *********** ******** .
394. spacer 1.9|335793|26|NZ_CP023584|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cggcgttgacgccgcccgcgccgccc Protospacer
** *********** ******** .
395. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_KR997898 (Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
gcccgtggacgccgggcgcgccggac Protospacer
**** ******** *********.
396. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttgacgccggacacgccgccg Protospacer
*************** *.*****
397. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP029334 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109b, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccggtgacgccggcggcgccgatg Protospacer
***** ********** ******.
398. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttgacgccggacacgccgccg Protospacer
*************** *.*****
399. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttggcgccgcccgcgccgccg Protospacer
********.***** ********
400. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgtcgccgccggccgcgccgccg Protospacer
******.* **************
401. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cgccgttgacgccggacacgccgccg Protospacer
*************** *.*****
402. spacer 1.9|335793|26|NZ_CP023584|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 5, identity: 0.808
cgccgttgacgccggccgcgccggat CRISPR spacer
cggcgttgacgccgcccgcgccgccc Protospacer
** *********** ******** .
403. spacer 4.1|366432|27|NZ_CP023584|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
404. spacer 4.1|366432|27|NZ_CP023584|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
405. spacer 4.7|366828|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
406. spacer 4.7|366828|27|NZ_CP023584|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
407. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
408. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
409. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
410. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
411. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
412. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
413. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
414. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
415. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
416. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
417. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
418. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
419. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
420. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
421. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
422. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
423. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
424. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
425. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
426. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
427. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
428. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
429. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
430. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
431. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
432. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
433. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
434. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
435. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
436. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
437. spacer 6.5|926712|27|NZ_CP023584|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
438. spacer 6.5|926712|27|NZ_CP023584|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
439. spacer 6.5|926712|27|NZ_CP023584|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
440. spacer 6.5|926712|27|NZ_CP023584|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
441. spacer 6.5|926712|27|NZ_CP023584|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
442. spacer 6.10|926922|27|NZ_CP023584|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
443. spacer 6.10|926922|27|NZ_CP023584|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
444. spacer 6.10|926922|27|NZ_CP023584|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
445. spacer 6.10|926922|27|NZ_CP023584|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
446. spacer 6.10|926922|27|NZ_CP023584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
447. spacer 6.10|926922|27|NZ_CP023584|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
448. spacer 6.10|926922|27|NZ_CP023584|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
449. spacer 6.10|926922|27|NZ_CP023584|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
450. spacer 6.10|926922|27|NZ_CP023584|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
451. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
452. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
453. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
454. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
455. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
456. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
457. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
458. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
459. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
460. spacer 6.15|927159|30|NZ_CP023584|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
461. spacer 6.16|927207|24|NZ_CP023584|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
462. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 5, identity: 0.828
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gggaccggcacggccacgggcagtgtcgg Protospacer
************ **.*******. .***
463. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc Protospacer
******************** ******** *.
464. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
gcgcggcggcctcggcgtagagccg Protospacer
***************** ***
465. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
466. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
caccggcggcctcggcgtagcttgc Protospacer
..******************* . *
467. spacer 8.4|1211995|25|NZ_CP023584|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
468. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
469. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
470. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
471. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
472. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
473. spacer 9.5|1572285|25|NZ_CP023584|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
474. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
475. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
476. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
477. spacer 9.13|1572926|34|NZ_CP023584|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
478. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
479. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgacgagcaggcccgccagc Protospacer
********** ********* **
480. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
agtgcgccgaagagcagggcggcgtaa Protospacer
. *************** ****** .
481. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tcgccgccggagagcaggccggcgcgc Protospacer
** *****.**************.
482. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcggcgatgagcaggccggcgacc Protospacer
.***** *** ************* .
483. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
484. spacer 1.4|335553|27|NZ_CP023584|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
485. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
486. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcgccgacgagcaggtcggcgacc Protospacer
********* *******.***** .
487. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
488. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgacgaagagcaggccgtccgca Protospacer
****** ************** * ..
489. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcgccgaagagcagggcggagaac Protospacer
***************** *** *
490. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcggcgaacagcaggccggccacc Protospacer
****** **** *********** .
491. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
492. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcgccgatgagcaggccgccgaac Protospacer
.********* ********** **
493. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013108 (Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
agttcgccgaagagcacgccggcgatg Protospacer
. ************ ******* **
494. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
495. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
496. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
497. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
498. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
499. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
500. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
501. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
502. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
503. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
504. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
505. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
506. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
507. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP028919 (Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tcggcgccgaagatcaggcgggcgact Protospacer
************ ***** **** .
508. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
509. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
510. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
511. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
512. spacer 1.4|335553|27|NZ_CP023584|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
513. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
514. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
515. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
516. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
517. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
518. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
519. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcgccgaagagccgtccggcgcgc Protospacer
************** * ******.
520. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tcggcgccgaacatcaggccggcgcaa Protospacer
********** * **********. .
521. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
522. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
523. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
524. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
525. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
526. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
527. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcggcgaacagcaggccggcgacc Protospacer
***** **** ************ .
528. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
529. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
530. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
531. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
532. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
533. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
534. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
535. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcggcgaacagcaggccggcgacc Protospacer
***** **** ************ .
536. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
537. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
538. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
539. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
540. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
541. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
542. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
543. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
544. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
545. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
546. spacer 1.4|335553|27|NZ_CP023584|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
547. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
548. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
549. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
550. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
551. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
552. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
553. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
554. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
555. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
556. spacer 1.4|335553|27|NZ_CP023584|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
557. spacer 1.4|335553|27|NZ_CP023584|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
558. spacer 1.4|335553|27|NZ_CP023584|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
559. spacer 1.4|335553|27|NZ_CP023584|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
560. spacer 1.4|335553|27|NZ_CP023584|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
561. spacer 1.4|335553|27|NZ_CP023584|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
accgcgccgaagagaaggccggcgcgt Protospacer
.* *********** *********.
562. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
563. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
564. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
565. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
acggcgccgatgagcaggcgggcgaca Protospacer
.********* ******** **** ..
566. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tcggcgccgaacatcaggccggcgcaa Protospacer
********** * **********. .
567. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
568. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
569. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
570. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
571. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgaagaacagggcggccagc Protospacer
*************.**** ****
572. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
573. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
gcggcgccgtcgagcaggccggccgcc Protospacer
********* ************ .
574. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgctcgccgaagaacaggccggcgatg Protospacer
*********.********** **
575. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
atgtcgccgaagagcaggccggcttca Protospacer
..* ******************* *..
576. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcggcgaacagcaggccggcgacc Protospacer
***** **** ************ .
577. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cttgcgccgaggagcaggccggcgctt Protospacer
. *******.*************.*
578. spacer 1.4|335553|27|NZ_CP023584|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
579. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
580. spacer 1.4|335553|27|NZ_CP023584|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
tgttcgccgaagaacaggccggcgatg Protospacer
*********.********** **
581. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcggcgaacagcaggccggcgacc Protospacer
***** **** ************ .
582. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ctcgcgccgaggagcaggcgggcgttc Protospacer
. *******.******** ******
583. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.778
gcggcgccgaagagcaggccggcgttg CRISPR spacer
ccggcgccgaagagcagggcggagaac Protospacer
***************** *** *
584. spacer 1.7|335697|30|NZ_CP023584|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg CRISPR spacer
ccggcgccactgctggcgtccacgccagcc Protospacer
***.. ************ ** *******
585. spacer 1.7|335697|30|NZ_CP023584|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg CRISPR spacer
ccggcgccactgctggcgtccacgccagcc Protospacer
***.. ************ ** *******
586. spacer 1.7|335697|30|NZ_CP023584|CRT matches to KC292025 (Halovirus HHTV-1, complete genome) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg-- CRISPR spacer
tcgatcccactgctggccaccctg--aacggc Protospacer
.**************** ****.* *.**
587. spacer 1.9|335793|26|NZ_CP023584|CRT matches to MT889373 (Arthrobacter phage Brynnie, complete genome) position: , mismatch: 6, identity: 0.769
cgccgttgacgccggccgcgccggat CRISPR spacer
gtccgttgtcgccggccgcgccgcgc Protospacer
****** ************** ..
588. spacer 1.9|335793|26|NZ_CP023584|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 6, identity: 0.769
cgccgttgacgccggccgcgccggat CRISPR spacer
gaccggtgacgccggccgcgccgccc Protospacer
.*** ***************** .
589. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
cagcgaaggcgtcgaagcccagcccgtcga Protospacer
* ** ************ ******.***
590. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.8
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ccccggcggcgtcgaagcccagcggcccca Protospacer
***** ************* *** ** *
591. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 6, identity: 0.8
-ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
gcgccgtc-gcgtcgaggcccagcccgccgt Protospacer
* ***.* *******.*** *********
592. spacer 4.1|366432|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
593. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
594. spacer 4.7|366828|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
595. spacer 4.9|366978|27|NZ_CP023584|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
596. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
597. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
598. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
599. spacer 4.10|367038|27|NZ_CP023584|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
600. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
601. spacer 6.5|926712|27|NZ_CP023584|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
gatggccggtaggctgttgaacggcgc Protospacer
.. *******.******* *******
602. spacer 6.5|926712|27|NZ_CP023584|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
603. spacer 6.5|926712|27|NZ_CP023584|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
604. spacer 6.5|926712|27|NZ_CP023584|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
605. spacer 6.5|926712|27|NZ_CP023584|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
606. spacer 6.5|926712|27|NZ_CP023584|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
607. spacer 6.5|926712|27|NZ_CP023584|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
608. spacer 6.5|926712|27|NZ_CP023584|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
609. spacer 6.10|926922|27|NZ_CP023584|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
610. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
611. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
612. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
613. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
614. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
615. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
616. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
617. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
618. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
619. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
620. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
621. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
622. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
623. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
624. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
625. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
626. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
627. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
628. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
629. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
630. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
631. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
632. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
633. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
634. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
635. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
636. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
637. spacer 6.15|927159|30|NZ_CP023584|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
638. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
639. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
640. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
641. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
642. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
643. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
644. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
645. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
646. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
647. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
648. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
649. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
650. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
651. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
652. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
653. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
654. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
655. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
656. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
657. spacer 6.15|927159|30|NZ_CP023584|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
658. spacer 6.17|927249|36|NZ_CP023584|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg Protospacer
* .************************ .*****
659. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.793
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
cccaccggcacgcccgcgggcagcgccag Protospacer
*********.*********** **.*
660. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 6, identity: 0.793
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
cccaccggcacgcccgcgggcagcgccag Protospacer
*********.*********** **.*
661. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 6, identity: 0.793
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
cccaccggcacgcccgcgggcagcgccag Protospacer
*********.*********** **.*
662. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.793
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
ccgaccggcacgtcggcgcgcagccgcag Protospacer
************ *** ****** *.*
663. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.793
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gcgtacggcaggtccgcgggcagcgccga Protospacer
* * ***** ************* ***.
664. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
ccgaccggcacgtcggcgcgcagccgcag Protospacer
************ *** ****** *.*
665. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.793
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
ccgaccggcacgtcggcgcgcagccgcag Protospacer
************ *** ****** *.*
666. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.793
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
ccgaccggcacgtcggcgcgcagcctcag Protospacer
************ *** ******.*.*
667. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtgc Protospacer
* * ********** ********** .*
668. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc-- Protospacer
************ ******* ***** * .***
669. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc-- Protospacer
.****************** ****** * ***
670. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct- Protospacer
.*********.*************** ..****
671. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac Protospacer
* ******************.**. ****** *
672. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
673. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
674. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
675. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
676. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
677. spacer 9.13|1572926|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
678. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
679. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
680. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
681. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagcct Protospacer
.. ******************* *..
682. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
683. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
684. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
685. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
686. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
687. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
688. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
689. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
cgcgcgccgtagagcaggccggcgagc Protospacer
****** **************
690. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagcct Protospacer
.. ******************* *..
691. spacer 1.4|335553|27|NZ_CP023584|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.741
gcggcgccgaagagcaggccggcgttg CRISPR spacer
attgcgccgaagagcaggccggagcct Protospacer
.. ******************* *..
692. spacer 2.5|337881|30|NZ_CP023584|CRT matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
caccgcccgccccgctgagcagacccgcct CRISPR spacer
tgtcgcccgccccgcagagctgaccccctt Protospacer
...************ **** ***** *.*
693. spacer 4.4|366627|27|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
694. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
695. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
696. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
697. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
698. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
699. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
700. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
701. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
702. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
703. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
704. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
705. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
706. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
707. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
708. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
709. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
710. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
711. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
712. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
713. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
714. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
715. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
716. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
717. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
718. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
719. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
720. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
721. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
722. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
723. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
724. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
725. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
726. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
727. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
728. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
729. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
730. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
731. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
732. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
733. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
734. spacer 6.13|927063|30|NZ_CP023584|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
735. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
736. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
737. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
738. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
739. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
740. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
741. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
742. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
743. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
744. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
745. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
746. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
747. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
748. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
749. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
750. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
751. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
752. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
753. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
754. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
755. spacer 6.13|927063|30|NZ_CP023584|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
756. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
757. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
758. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
759. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
760. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
761. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
762. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
763. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
764. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
765. spacer 6.13|927063|30|NZ_CP023584|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
766. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
767. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
768. spacer 6.13|927063|30|NZ_CP023584|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
769. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
770. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
771. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
772. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
773. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
774. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
775. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
776. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
777. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
778. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
779. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
780. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
781. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
782. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
783. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
784. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
785. spacer 6.13|927063|30|NZ_CP023584|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
786. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
787. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
788. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
789. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
790. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
791. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
792. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
793. spacer 6.13|927063|30|NZ_CP023584|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
794. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
795. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
796. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
797. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
798. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
799. spacer 6.13|927063|30|NZ_CP023584|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
800. spacer 6.13|927063|30|NZ_CP023584|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
801. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
802. spacer 6.13|927063|30|NZ_CP023584|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
803. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
804. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
805. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
806. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
807. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
808. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
809. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
810. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
811. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
812. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
813. spacer 6.15|927159|30|NZ_CP023584|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
814. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
815. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
816. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
817. spacer 6.15|927159|30|NZ_CP023584|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
818. spacer 6.15|927159|30|NZ_CP023584|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
819. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
820. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
821. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
822. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
823. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
824. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
825. spacer 6.17|927249|36|NZ_CP023584|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg Protospacer
**************** *********. * * **
826. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
cgttccgacacgtcggcgggcagccccac Protospacer
* ***.****** ************.
827. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
cgttccgacacgtcggcgggcagccccac Protospacer
* ***.****** ************.
828. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
cgctccgacacgtcggcgggcagccccac Protospacer
* ***.****** ************.
829. spacer 6.19|927360|29|NZ_CP023584|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gggaccggcacggccgcggggaggcttcc Protospacer
************ ******* ** *..
830. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
aacaacggcacgtccccgggcagcaccgc Protospacer
.. * ********** ******** ***
831. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
832. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
833. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
834. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
atcaccggcacgtgcgcgcgcagccctgc Protospacer
. ********** **** *******.*
835. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
atcaccggcacgtgcgcgcgcagccctgc Protospacer
. ********** **** *******.*
836. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP035514 (Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gatgtcggcatgtccgcggacagccccgc Protospacer
*. ..*****.********.********
837. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
838. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
839. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
840. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
841. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
842. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
843. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
844. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
cgttccgacacgtcggcgggcagccccac Protospacer
* ***.****** ************.
845. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
846. spacer 6.19|927360|29|NZ_CP023584|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gggaccggcacgtccgcgggcagccccgg CRISPR spacer
gtgtccggcacgtcggcgggcagccgtcc Protospacer
* * ********** ********** .
847. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc- Protospacer
****** **** *************** ..** .
848. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc-- Protospacer
*.*********.********* *****. .***
849. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc- Protospacer
** *************** ******* *. **.
850. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta---- CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac Protospacer
****** ************* **** * ***
851. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
852. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
853. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc-- Protospacer
*.********.******** ******* .***
854. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc-- Protospacer
*********** *****.******* * * .**
855. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat Protospacer
.******** ********.***** **.*** *
856. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc- Protospacer
.* ******** ******** ****** * ***.
857. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
858. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
859. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
860. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
861. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
862. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
863. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
864. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
865. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
866. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
867. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct- Protospacer
.* ***.****.*************** * ***
868. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg-tggcta CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt- Protospacer
**.***** ***************.*.. *** *
869. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
870. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt Protospacer
* ***************** .*** ****** .
871. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
872. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc-- Protospacer
**.****************.****. * ****
873. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac Protospacer
* ***************** .*** *****..*
874. spacer 8.9|1212259|37|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac Protospacer
******************..******* . ***.**
875. spacer 9.1|1572063|28|NZ_CP023584|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
876. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
877. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
878. spacer 11.3|2088242|30|NZ_CP023584|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
879. spacer 11.3|2088242|30|NZ_CP023584|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
880. spacer 11.3|2088242|30|NZ_CP023584|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
881. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
882. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
883. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
884. spacer 2.5|337881|30|NZ_CP023584|CRT matches to MN234187 (Mycobacterium phage DyoEdafos, complete genome) position: , mismatch: 8, identity: 0.733
caccgcccgccccgctgagcagacccgcct CRISPR spacer
ccgtgcccggcccgctgagcagaccgccac Protospacer
* .***** *************** * .
885. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
gaccgccggcgtcgaagccgtgccattcgc Protospacer
***************** *** .**
886. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 8, identity: 0.733
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
cgccgccggcgtcgaagccgagcgatcttc Protospacer
* ***************** *** *.
887. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 8, identity: 0.733
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
agcaggtcgcgtcgaagccgagcccggcga Protospacer
* * . *********** ****** ***
888. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
889. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
890. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
891. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
892. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
893. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
894. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
895. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
896. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
897. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
898. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
899. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
900. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
901. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
902. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
903. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
904. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
905. spacer 6.13|927063|30|NZ_CP023584|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
906. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
907. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
908. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
909. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
910. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
911. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
912. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
913. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
914. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
915. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
916. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
917. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
918. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
919. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
920. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
921. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
922. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
923. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
924. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
925. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
926. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
927. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
928. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
929. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
930. spacer 6.17|927249|36|NZ_CP023584|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc Protospacer
..* . ************.******* ********
931. spacer 6.17|927249|36|NZ_CP023584|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
932. spacer 6.17|927249|36|NZ_CP023584|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
933. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt-- Protospacer
. ***************** ****** *.**.
934. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc-- Protospacer
*****************. ****** .** *
935. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc-- Protospacer
**********.** **********.* .***
936. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc Protospacer
*.******.**********.****** .**.*
937. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
938. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc Protospacer
****** ******.************ .**.
939. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
940. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
941. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg Protospacer
******* ** ************** * **.
942. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
943. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
944. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg Protospacer
******** *****.*********** * *.
945. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc- Protospacer
.**********.** *********** .* **.
946. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
947. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
948. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
949. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
950. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
951. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
952. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
953. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
954. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
955. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
956. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
957. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
958. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
959. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
960. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
961. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg----gtggcta CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg---- Protospacer
* ******** *******.******* ***
962. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc Protospacer
*************** .******** * **..
963. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcg-gcaacggcggcgccggcgggtggcta CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc Protospacer
* .*** ** ******** ************.
964. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
965. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
966. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
967. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
968. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
969. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
970. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
971. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
972. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
973. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
974. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
975. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
976. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
977. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
978. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
979. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
980. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
981. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg Protospacer
.***************** *.***** * * *.
982. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
983. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
984. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc-- Protospacer
.*********.********* ***** ..***
985. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
986. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
987. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat- Protospacer
.*******.********* ****** ** * *
988. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca Protospacer
.****************** **** * ..**.*
989. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat Protospacer
* ******** *******.***** **.**..*
990. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca Protospacer
*.********.******** ******..* *.*
991. spacer 8.9|1212259|37|NZ_CP023584|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc Protospacer
********.* **************** . ***..*
992. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
993. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
994. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
995. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
996. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
997. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
998. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
999. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
1000. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1001. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
1002. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
1003. spacer 11.3|2088242|30|NZ_CP023584|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
1004. spacer 11.3|2088242|30|NZ_CP023584|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
1005. spacer 14.24|3122174|29|NZ_CP023584|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
1006. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
1007. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1008. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1009. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1010. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1011. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1012. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1013. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1014. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1015. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1016. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
1017. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1018. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1019. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
1020. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
1021. spacer 15.7|3740935|31|NZ_CP023584|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
1022. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ctttgccggcgtcgaagccctgccctgggc Protospacer
*...*************** **** *
1023. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ctttgccggcgtcgaagccctgccctgggc Protospacer
*...*************** **** *
1024. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
tgccgccggcgtcgatgcccagcacctgca Protospacer
. ************* *** *** * . *
1025. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ctttgccggcgtcgaagccctgccctgggc Protospacer
*...*************** **** *
1026. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ctttgccggcgtcgaagccctgccctgggc Protospacer
*...*************** **** *
1027. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
tgccgccggcgtcgatgcccagcacctgca Protospacer
. ************* *** *** * . *
1028. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ttccgccggcgtcgatgcccagcacctgca Protospacer
..************* *** *** * . *
1029. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ctttgccggcgtcgaagccctgccctgggc Protospacer
*...*************** **** *
1030. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
cgaacaccgcgacgaagcccagcccgccgc Protospacer
* * *** ******* *********
1031. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ctttgccggcgtcgaagccctgccctgggc Protospacer
*...*************** **** *
1032. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ctttgccggcgtcgaagccctgccctgggc Protospacer
*...*************** **** *
1033. spacer 2.6|337929|30|NZ_CP023584|CRT matches to MK494113 (Mycobacterium phage Refuge, complete genome) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
gatcggtaacgtcgaagctcagcccgccga Protospacer
.** ...*********. **********
1034. spacer 2.6|337929|30|NZ_CP023584|CRT matches to MK524530 (Mycobacterium phage Pharaoh, complete genome) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
gatcggtaacgtcgaagctcagcccgccga Protospacer
.** ...*********. **********
1035. spacer 2.6|337929|30|NZ_CP023584|CRT matches to KX657793 (Mycobacterium phage DarthPhader, complete genome) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
gatcggtaacgtcgaagctcagcccgccga Protospacer
.** ...*********. **********
1036. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ctttgccggcgtcgaagccctgccctgggc Protospacer
*...*************** **** *
1037. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
tgccgccggcgtcgatgcccagcacctgca Protospacer
. ************* *** *** * . *
1038. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
tgccgccggcgtcgatgcccagcacctgca Protospacer
. ************* *** *** * . *
1039. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.7
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ctttgccggcgtcgaagccctgccctgggc Protospacer
*...*************** **** *
1040. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
1041. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1042. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1043. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1044. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
1045. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
1046. spacer 5.1|691893|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
1047. spacer 6.13|927063|30|NZ_CP023584|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
1048. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
1049. spacer 6.15|927159|30|NZ_CP023584|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
1050. spacer 6.17|927249|36|NZ_CP023584|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc Protospacer
** ******** *************** * .. *
1051. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc-- Protospacer
. ****************. ****** ..***
1052. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc-- Protospacer
. **************** ***** *..***
1053. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc Protospacer
************ ************ .. *
1054. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc-- Protospacer
. ****.****.************* * .***
1055. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc Protospacer
* ****** * *************** * *
1056. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1057. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1058. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1059. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
1060. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
1061. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa Protospacer
*.******* *********.****** ..* *
1062. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc Protospacer
.********* ******** ******* * .
1063. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag Protospacer
********** ************* *. * .
1064. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1065. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat Protospacer
*.********* *********** *** .. *
1066. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1067. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1068. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1069. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1070. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc Protospacer
* *********.******.******* * *
1071. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1072. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1073. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga Protospacer
****************** *.**** * *
1074. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1075. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1076. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1077. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1078. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1079. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1080. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1081. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1082. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1083. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1084. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1085. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1086. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1087. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1088. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1089. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1090. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg Protospacer
*.****************** ***.** * ...
1091. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1092. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1093. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1094. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1095. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1096. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1097. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1098. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac Protospacer
********* ************* .*. **
1099. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1100. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc-- Protospacer
*******.********.****** **..**
1101. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt Protospacer
* .*******.* ************** .**
1102. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1103. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg Protospacer
* **************** ****** * *.
1104. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1105. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga Protospacer
* *******. *************** .* *
1106. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1107. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1108. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc-- Protospacer
.*****************.*** ** ...***
1109. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1110. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1111. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1112. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1113. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1114. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1115. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1116. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc-- Protospacer
. ****************. ***** **..**
1117. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1118. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc Protospacer
*. ****************. ****** * *.
1119. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac Protospacer
* **** *********** ******* **
1120. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1121. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1122. spacer 8.9|1212259|37|NZ_CP023584|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc Protospacer
** **************** ****** *.* * *
1123. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
1124. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
1125. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
1126. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
1127. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
1128. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
1129. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
1130. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
1131. spacer 15.5|3740794|34|NZ_CP023584|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
1132. spacer 15.5|3740794|34|NZ_CP023584|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
1133. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
gcagttcggggtcgaagcccagcccgcgat Protospacer
* .*** ********* ******* .
1134. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 10, identity: 0.667
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
ttgccgaggcggcgaagcccagcccgccct Protospacer
.. * **** ******* ********
1135. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 10, identity: 0.667
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
tggccgaggcggcgaagcccagcccgccct Protospacer
. * **** ******* ********
1136. spacer 2.6|337929|30|NZ_CP023584|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667
ccccgccggcgtcgaagccyagcccgccga CRISPR spacer
tggccgaggcggcgaagcccagcccgcctt Protospacer
. * **** ******* ********
1137. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1138. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1139. spacer 4.6|366762|33|NZ_CP023584|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1140. spacer 6.2|926559|39|NZ_CP023584|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
1141. spacer 6.17|927249|36|NZ_CP023584|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac Protospacer
... . ************************.**.
1142. spacer 6.17|927249|36|NZ_CP023584|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc Protospacer
* . . ************ ******** **** *
1143. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcg-----ggtggcta CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt----- Protospacer
*******.********** **** ***
1144. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc Protospacer
*. ***************..******* . *
1145. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc Protospacer
. ********* ********* ***** . * .
1146. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg Protospacer
********** ***** ******** * ....
1147. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc Protospacer
********* *** ***********. * .
1148. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact Protospacer
. ********. *************** *. .
1149. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1150. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga Protospacer
.********* *******.******* *
1151. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1152. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1153. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1154. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1155. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta------- CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc Protospacer
*****.****** ********* **.**
1156. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
1157. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1158. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag Protospacer
* **********.*****.*******. * .
1159. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1160. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1161. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
1162. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1163. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1164. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1165. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1166. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1167. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1168. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc Protospacer
.*****..***************** * .*
1169. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1170. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1171. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1172. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1173. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1174. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1175. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1176. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1177. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1178. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1179. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1180. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1181. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1182. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1183. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1184. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1185. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1186. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1187. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1188. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg Protospacer
* ********.*********.***** * ..
1189. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1190. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1191. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1192. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1193. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1194. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1195. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1196. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc Protospacer
********.********* ***** . **
1197. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1198. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1199. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1200. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1201. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1202. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1203. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag Protospacer
* ** ***** *************** * .
1204. spacer 8.9|1212259|37|NZ_CP023584|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1205. spacer 8.9|1212259|37|NZ_CP023584|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1206. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
1207. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
1208. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
1209. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
1210. spacer 9.10|1572677|31|NZ_CP023584|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
1211. spacer 9.13|1572926|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
1212. spacer 13.9|3119576|35|NZ_CP023584|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
1213. spacer 14.20|3123047|34|NZ_CP023584|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
1214. spacer 14.36|3123051|34|NZ_CP023584|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
1215. spacer 15.5|3740794|34|NZ_CP023584|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
1216. spacer 15.5|3740794|34|NZ_CP023584|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1217. spacer 15.5|3740794|34|NZ_CP023584|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1218. spacer 15.5|3740794|34|NZ_CP023584|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1219. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg Protospacer
. ****************. ****** *...
1220. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg Protospacer
.********.******** ******. *..
1221. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1222. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1223. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg Protospacer
.******** ******* ******** . ..
1224. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag Protospacer
.********* ********** *** . * .
1225. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg Protospacer
. *************** *****.** * ..
1226. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg Protospacer
.. ******.*.*************** * ..
1227. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc Protospacer
*****.****** *********** . *.
1228. spacer 8.5|1212043|40|NZ_CP023584|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725
tgccggcggcgccggcggtgtcggcggacccgccgggttg CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc Protospacer
*..******.***************** *** .*. *
1229. spacer 15.5|3740794|34|NZ_CP023584|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
1230. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg Protospacer
..********.****** ******** . ...
1231. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgc-----cggcgggtggcta CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg---- Protospacer
***** ..*. ***** *** **** ****
1232. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga----- Protospacer
***** ****. ***** . *** **.*
1233. spacer 8.3|1211938|34|NZ_CP023584|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga----- Protospacer
***** ****. **.** . *** **.*