Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023630 Mycobacterium tuberculosis strain MDRMA2441 chromosome, complete genome 14 crisprs csa3,c2c9_V-U4,cas3,DinG,WYL,cas4,DEDDh,cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6 9 43 2 1

Results visualization

1. NZ_CP023630
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_1 333648-334446 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_2 366464-367162 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_3 691969-692045 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_4 926541-927488 Orphan NA
19 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_5 1191251-1191359 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_6 1211885-1212741 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_7 1572121-1573193 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_8 2088242-2088496 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_9 2163330-2163434 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_10 2168768-2168987 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_11 3119102-3120456 TypeIII II-B,III-A
18 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_12 3121779-3123493 TypeIII II-B,III-A
23 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_13 3740585-3741126 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023630_14 4110601-4110689 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023630_6 6.8|1212313|16|NZ_CP023630|CRISPRCasFinder 1212313-1212328 16 NZ_CP023630.1 2088557-2088572 0 1.0
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 674718-674736 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1213411-1213429 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1217552-1217570 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1217624-1217642 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1630616-1630634 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1633442-1633460 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1990758-1990776 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2061482-2061500 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2061929-2061947 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2062028-2062046 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2802031-2802049 1 0.947
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2805559-2805577 1 0.947
NZ_CP023630_8 8.2|2088323|18|NZ_CP023630|CRT 2088323-2088340 18 NZ_CP023630.1 401062-401079 1 0.944
NZ_CP023630_8 8.2|2088323|18|NZ_CP023630|CRT 2088323-2088340 18 NZ_CP023630.1 607365-607382 1 0.944
NZ_CP023630_8 8.4|2088413|18|NZ_CP023630|CRT 2088413-2088430 18 NZ_CP023630.1 3450101-3450118 1 0.944
NZ_CP023630_2 2.5|366752|42|NZ_CP023630|CRISPRCasFinder 366752-366793 42 NZ_CP023630.1 374783-374824 2 0.952
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP023630.1 373598-373630 2 0.939
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 NZ_CP023630.1 675037-675072 2 0.944
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 NZ_CP023630.1 1213684-1213719 2 0.944
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 NZ_CP023630.1 2423699-2423734 2 0.944
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NZ_CP023630.1 2960453-2960474 2 0.909
NZ_CP023630_6 6.11|1212451|22|NZ_CP023630|CRISPRCasFinder 1212451-1212472 22 NZ_CP023630.1 837377-837398 2 0.909
NZ_CP023630_6 6.11|1212451|22|NZ_CP023630|CRISPRCasFinder 1212451-1212472 22 NZ_CP023630.1 1217579-1217600 2 0.909
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 150187-150205 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 335187-335205 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 335640-335658 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 335691-335709 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 335700-335718 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 337989-338007 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 338118-338136 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 338385-338403 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 338432-338450 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 338508-338526 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 363036-363054 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 443375-443393 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 546719-546737 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 623927-623945 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 624149-624167 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 673884-673902 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 840160-840178 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1090914-1090932 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1091562-1091580 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1095602-1095620 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1212940-1212958 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1213330-1213348 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1217972-1217990 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1489130-1489148 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1618580-1618598 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1619033-1619051 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1635955-1635973 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1635964-1635982 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1864243-1864261 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1864771-1864789 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 1990032-1990050 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2001412-2001430 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2088752-2088770 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2303436-2303454 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2356888-2356906 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2419561-2419579 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2423629-2423647 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2569124-2569142 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2693440-2693458 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2795346-2795364 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 2795928-2795946 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3054511-3054529 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3054610-3054628 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3705416-3705434 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3737375-3737393 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3737999-3738017 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3738242-3738260 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3738375-3738393 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3802254-3802272 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3802437-3802455 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3802605-3802623 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3930425-3930443 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3932164-3932182 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3940671-3940689 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 3948675-3948693 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 4031640-4031658 2 0.895
NZ_CP023630_6 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder 1212568-1212586 19 NZ_CP023630.1 4094184-4094202 2 0.895

1. spacer 6.8|1212313|16|NZ_CP023630|CRISPRCasFinder matches to position: 2088557-2088572, mismatch: 0, identity: 1.0

gtggctgtacggcgac	CRISPR spacer
gtggctgtacggcgac	Protospacer
****************

2. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 674718-674736, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggtggggccggtggc	Protospacer
******.************

3. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1213411-1213429, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

4. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1217552-1217570, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggaggc	Protospacer
*************** ***

5. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1217624-1217642, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

6. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1630616-1630634, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggtggc	Protospacer
********* *********

7. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1633442-1633460, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggaggc	Protospacer
*************** ***

8. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1990758-1990776, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

9. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2061482-2061500, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

10. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2061929-2061947, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

11. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2062028-2062046, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

12. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2802031-2802049, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggtggc	Protospacer
** ****************

13. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2805559-2805577, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggtggc	Protospacer
************ ******

14. spacer 8.2|2088323|18|NZ_CP023630|CRT matches to position: 401062-401079, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

15. spacer 8.2|2088323|18|NZ_CP023630|CRT matches to position: 607365-607382, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

16. spacer 8.4|2088413|18|NZ_CP023630|CRT matches to position: 3450101-3450118, mismatch: 1, identity: 0.944

gatcagcgtcccgccggt	CRISPR spacer
gatcagcgtcccgctggt	Protospacer
**************.***

17. spacer 2.5|366752|42|NZ_CP023630|CRISPRCasFinder matches to position: 374783-374824, mismatch: 2, identity: 0.952

ccggtgcccgagttgaagaacccgatgtttccgctgccggag	CRISPR spacer
ccggtgcccgagttgaacaacccgacgtttccgctgccggag	Protospacer
***************** *******.****************

18. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to position: 373598-373630, mismatch: 2, identity: 0.939

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
aggctgccgaacccgatctggccgctgccggtg	Protospacer
********** *************.********

19. spacer 4.17|927324|36|NZ_CP023630|CRT matches to position: 675037-675072, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatgggcaacggcggcaacggcggggccggcgg	Protospacer
****** ***********.*****************

20. spacer 4.17|927324|36|NZ_CP023630|CRT matches to position: 1213684-1213719, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggccacggcggggccggcgg	Protospacer
******************. ****************

21. spacer 4.17|927324|36|NZ_CP023630|CRT matches to position: 2423699-2423734, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcggtgccggcgg	Protospacer
******************.******** ********

22. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to position: 2960453-2960474, mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tggcgggggtgccggcggtgtc	Protospacer
** *** ***************

23. spacer 6.11|1212451|22|NZ_CP023630|CRISPRCasFinder matches to position: 837377-837398, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgccggtggggcc	Protospacer
*********** ****** ***

24. spacer 6.11|1212451|22|NZ_CP023630|CRISPRCasFinder matches to position: 1217579-1217600, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgtcggtggcgcc	Protospacer
*********** ******.***

25. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 150187-150205, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcggcggtggc	Protospacer
********* * *******

26. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 335187-335205, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

27. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 335640-335658, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggctggcggc	Protospacer
************.**.***

28. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 335691-335709, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

29. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 335700-335718, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

30. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 337989-338007, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggcggc	Protospacer
************ **.***

31. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 338118-338136, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

32. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 338385-338403, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggtcggtggc	Protospacer
** ********.*******

33. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 338432-338450, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgccgccggtggc	Protospacer
********  *********

34. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 338508-338526, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgccggc	Protospacer
************** .***

35. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 363036-363054, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccgtcggcgccggtggc	Protospacer
***** *** *********

36. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 443375-443393, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggacggtggc	Protospacer
** ******** *******

37. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 546719-546737, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggccgggccggtggc	Protospacer
** **** ***********

38. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 623927-623945, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggcgccggtggc	Protospacer
** ****** *********

39. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 624149-624167, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

40. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 673884-673902, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

41. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 840160-840178, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggcggc	Protospacer
************ **.***

42. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1090914-1090932, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

43. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1091562-1091580, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggaggggccggcggc	Protospacer
****** ********.***

44. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1095602-1095620, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

45. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1212940-1212958, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggggccggaggc	Protospacer
******.******** ***

46. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1213330-1213348, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggccggcggc	Protospacer
** ************.***

47. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1217972-1217990, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

48. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1489130-1489148, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

49. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1618580-1618598, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

50. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1619033-1619051, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggagccggtggc	Protospacer
******.**.*********

51. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1635955-1635973, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggcgccggtggc	Protospacer
******.** *********

52. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1635964-1635982, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

53. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1864243-1864261, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

54. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1864771-1864789, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

55. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 1990032-1990050, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

56. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2001412-2001430, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgtcggcggtgccggtggc	Protospacer
**.****** *********

57. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2088752-2088770, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggggccggcggc	Protospacer
*** ***********.***

58. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2303436-2303454, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgtcggc	Protospacer
************** .***

59. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2356888-2356906, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgccggc	Protospacer
************** .***

60. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2419561-2419579, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggtcgatggc	Protospacer
***********.**.****

61. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2423629-2423647, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgcggccggcggc	Protospacer
******** ******.***

62. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2569124-2569142, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

63. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2693440-2693458, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

64. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2795346-2795364, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcaggcggtgccggtggc	Protospacer
*** ***** *********

65. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 2795928-2795946, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggaccggcggc	Protospacer
**********.****.***

66. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3054511-3054529, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggggccggcggc	Protospacer
*** ***********.***

67. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3054610-3054628, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

68. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3705416-3705434, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccgtcgggcccggtggc	Protospacer
***** **** ********

69. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3737375-3737393, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

70. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3737999-3738017, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgcaggtggc	Protospacer
********* ** ******

71. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3738242-3738260, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggtgccggtggc	Protospacer
******.** *********

72. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3738375-3738393, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgcggccggcggc	Protospacer
******** ******.***

73. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3802254-3802272, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggcggc	Protospacer
** ************.***

74. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3802437-3802455, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

75. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3802605-3802623, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

76. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3930425-3930443, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccagcggggccggcggc	Protospacer
****.**********.***

77. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3932164-3932182, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

78. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3940671-3940689, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggcacggtggc	Protospacer
**********  *******

79. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 3948675-3948693, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggaccggcggc	Protospacer
**********.****.***

80. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 4031640-4031658, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

81. spacer 6.13|1212568|19|NZ_CP023630|CRISPRCasFinder matches to position: 4094184-4094202, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136911 1 0.955
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1975819-1975840 1 0.955
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1109892-1109913 1 0.955
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP016457 Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence 87869-87890 1 0.955
NZ_CP023630_7 7.15|1573140|22|NZ_CP023630|CRISPRCasFinder 1573140-1573161 22 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 362668-362689 1 0.955
NZ_CP023630_7 7.15|1573140|22|NZ_CP023630|CRISPRCasFinder 1573140-1573161 22 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2289382-2289403 1 0.955
NZ_CP023630_7 7.15|1573140|22|NZ_CP023630|CRISPRCasFinder 1573140-1573161 22 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 81656-81677 1 0.955
NZ_CP023630_7 7.15|1573140|22|NZ_CP023630|CRISPRCasFinder 1573140-1573161 22 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 56160-56181 1 0.955
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 794580-794601 2 0.909
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 75477-75498 2 0.909
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 713470-713491 2 0.909
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NC_021056 Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence 29437-29458 2 0.909
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 56975-56996 2 0.909
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 458462-458483 2 0.909
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1354617-1354638 2 0.909
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 881389-881410 2 0.909
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NC_047977 Microbacterium phage Hendrix, complete genome 3065-3086 2 0.909
NZ_CP023630_6 6.15|1212652|22|NZ_CP023630|CRISPRCasFinder 1212652-1212673 22 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 917429-917450 2 0.909
NZ_CP023630_7 7.2|1572213|22|NZ_CP023630|CRISPRCasFinder 1572213-1572234 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 881140-881161 2 0.909
NZ_CP023630_7 7.2|1572213|22|NZ_CP023630|CRISPRCasFinder 1572213-1572234 22 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 225972-225993 2 0.909
NZ_CP023630_7 7.2|1572213|22|NZ_CP023630|CRISPRCasFinder 1572213-1572234 22 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 451168-451189 2 0.909
NZ_CP023630_7 7.2|1572213|22|NZ_CP023630|CRISPRCasFinder 1572213-1572234 22 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 234992-235013 2 0.909
NZ_CP023630_7 7.2|1572213|22|NZ_CP023630|CRISPRCasFinder 1572213-1572234 22 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 597449-597470 2 0.909
NZ_CP023630_7 7.3|1572267|22|NZ_CP023630|CRISPRCasFinder 1572267-1572288 22 NZ_CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 117076-117097 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 448838-448859 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 160471-160492 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 175264-175285 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 457593-457614 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 166709-166730 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 166709-166730 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 166709-166730 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 166709-166730 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 164465-164486 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 97458-97479 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP012698 Microbacterium sp. No. 7 plasmid A, complete sequence 53118-53139 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 100830-100851 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 307854-307875 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 23841-23862 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 279961-279982 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 359201-359222 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 606826-606847 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 411558-411579 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 300111-300132 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 483830-483851 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 68146-68167 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 175112-175133 2 0.909
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 314082-314103 2 0.909
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 402883-402907 2 0.92
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 416172-416196 2 0.92
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 472935-472959 2 0.92
NZ_CP023630_1 1.11|334222|27|NZ_CP023630|CRT 334222-334248 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5507414-5507440 3 0.889
NZ_CP023630_1 1.11|334222|27|NZ_CP023630|CRT 334222-334248 27 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 756232-756258 3 0.889
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4024254-4024277 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4460576-4460599 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 122201-122224 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 37773-37796 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 116652-116675 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 72348-72371 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 KU716094 Mycobacterium phage Eidsmoe, complete genome 5649-5672 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MH371122 Mycobacterium phage Priya, complete genome 5650-5673 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MK016502 Mycobacterium phage Pat3, complete genome 22827-22850 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MK937593 Mycobacterium phage Flypotenuse, complete genome 23717-23740 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MG872835 Mycobacterium phage Conquerage, complete genome 5649-5672 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MH536820 Mycobacterium phage Glexan, complete genome 23717-23740 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 91001-91024 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 44795-44818 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1701753-1701776 3 0.875
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MH271298 Microbacterium phage Floof, complete genome 37939-37962 3 0.875
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 MN703413 Arthrobacter phage Powerpuff, complete genome 38834-38858 3 0.88
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 MT024871 Arthrobacter phage YesChef, complete genome 37693-37717 3 0.88
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 355111-355132 3 0.864
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 58695-58716 3 0.864
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 90623-90644 3 0.864
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1457966-1457987 3 0.864
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 422944-422965 3 0.864
NZ_CP023630_6 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder 1212268-1212289 22 KT381864 Thiobacimonas phage vB_ThpS-P1, complete genome 3900-3921 3 0.864
NZ_CP023630_6 6.11|1212451|22|NZ_CP023630|CRISPRCasFinder 1212451-1212472 22 NZ_CP048287 Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence 4076-4097 3 0.864
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 9264-9285 3 0.864
NZ_CP023630_7 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder 1572321-1572342 22 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 13233-13254 3 0.864
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 937294-937318 3 0.88
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1470762-1470786 3 0.88
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 MN586053 Arthrobacter phage BeatusComedenti, complete genome 26689-26713 3 0.88
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NC_031254 Arthrobacter phage Kitkat, complete genome 26809-26833 3 0.88
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NC_031231 Arthrobacter phage KellEzio, complete genome 26691-26715 3 0.88
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 633177-633201 3 0.88
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 74124-74148 3 0.88
NZ_CP023630_7 7.15|1573140|22|NZ_CP023630|CRISPRCasFinder 1573140-1573161 22 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 380879-380900 3 0.864
NZ_CP023630_8 8.5|2088452|24|NZ_CP023630|CRT 2088452-2088475 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1555522-1555545 3 0.875
NZ_CP023630_8 8.5|2088452|24|NZ_CP023630|CRT 2088452-2088475 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1560190-1560213 3 0.875
NZ_CP023630_2 2.1|366497|27|NZ_CP023630|CRISPRCasFinder 366497-366523 27 NC_023591 Mycobacterium phage Adler, complete genome 61249-61275 4 0.852
NZ_CP023630_2 2.1|366497|27|NZ_CP023630|CRISPRCasFinder 366497-366523 27 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 61247-61273 4 0.852
NZ_CP023630_2 2.7|366893|27|NZ_CP023630|CRISPRCasFinder 366893-366919 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 10066-10092 4 0.852
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 460464-460490 4 0.852
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NC_016652 Rhodococcus phage REQ2, complete genome 36035-36061 4 0.852
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 KY945355 Mycobacterium phage Shandong1, complete genome 25634-25660 4 0.852
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 106725-106751 4 0.852
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 NC_041888 Mycobacterium phage Tortellini, complete genome 37216-37242 4 0.852
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1096460-1096489 4 0.867
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1898211-1898234 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 261506-261529 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 673134-673157 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP016822 Rhodococcus sp. p52 plasmid pDF03, complete sequence 60076-60099 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MN582086 Siphoviridae sp. ctdEk19, complete genome 33324-33347 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 21980-22003 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MT889380 Mycobacterium phage Coco12, complete genome 22623-22646 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NC_023698 Mycobacterium phage Avani, complete genome 21987-22010 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MT114167 Mycobacterium phage Phanphagia, complete genome 22278-22301 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 558871-558894 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1500559-1500582 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 295932-295955 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1116335-1116358 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MN096355 Mycobacterium phage Purky, complete genome 48975-48998 4 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 MK279853 Gordonia phage Gray, complete genome 68404-68427 4 0.833
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 9745-9769 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1906386-1906410 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 794756-794780 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 CP003956 Rhodococcus opacus PD630 plasmid 7, complete sequence 34847-34871 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1665271-1665295 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NC_012723 Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence 15832-15856 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 348896-348920 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 406425-406449 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 CP054917 Streptomyces sp. NA02950 plasmid unnamed, complete sequence 26065-26089 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 450297-450321 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NC_022437 Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence 16147-16171 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1382131-1382155 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1418915-1418939 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 118938-118962 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1711697-1711721 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 722328-722352 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 67000-67024 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 118938-118962 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1149411-1149435 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 438623-438647 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 243636-243660 4 0.84
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1410063-1410087 4 0.84
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 818773-818800 4 0.857
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 420542-420569 4 0.857
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 77799-77826 4 0.857
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 176640-176664 4 0.84
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 29428-29452 4 0.84
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 38191-38215 4 0.84
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 MT553342 Microbacterium phage Kelcole, complete genome 51573-51597 4 0.84
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NC_048068 Microbacterium phage OneinaGillian, complete genome 50894-50918 4 0.84
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 MT310894 Microbacterium phage Tempo, complete genome 51697-51721 4 0.84
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_CP047175 Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence 42080-42104 4 0.84
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 67777-67801 4 0.84
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 MN034284 Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence 624-648 4 0.84
NZ_CP023630_7 7.14|1573083|25|NZ_CP023630|CRISPRCasFinder 1573083-1573107 25 MN582064 Podoviridae sp. ctka020, complete genome 29274-29298 4 0.84
NZ_CP023630_8 8.5|2088452|24|NZ_CP023630|CRT 2088452-2088475 24 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 680430-680453 4 0.833
NZ_CP023630_8 8.5|2088452|24|NZ_CP023630|CRT 2088452-2088475 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5913119-5913142 4 0.833
NZ_CP023630_8 8.5|2088452|24|NZ_CP023630|CRT 2088452-2088475 24 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 143186-143209 4 0.833
NZ_CP023630_1 1.2|333742|27|NZ_CP023630|CRT 333742-333768 27 MN103533 Mycobacterium phage Weirdo19, complete genome 26901-26927 5 0.815
NZ_CP023630_1 1.11|334222|27|NZ_CP023630|CRT 334222-334248 27 MK415400 Phage apr34_1784, complete genome 5470-5496 5 0.815
NZ_CP023630_1 1.11|334222|27|NZ_CP023630|CRT 334222-334248 27 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 161455-161481 5 0.815
NZ_CP023630_1 1.11|334222|27|NZ_CP023630|CRT 334222-334248 27 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 35634-35660 5 0.815
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 201261-201290 5 0.833
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 KM389325 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence 195-224 5 0.833
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 519541-519570 5 0.833
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 734-763 5 0.833
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 295647-295676 5 0.833
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 416946-416975 5 0.833
NZ_CP023630_2 2.1|366497|27|NZ_CP023630|CRISPRCasFinder 366497-366523 27 LR794124 Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1 34861-34887 5 0.815
NZ_CP023630_2 2.1|366497|27|NZ_CP023630|CRISPRCasFinder 366497-366523 27 NC_012662 Vibrio phage VP93, complete genome 35301-35327 5 0.815
NZ_CP023630_2 2.7|366893|27|NZ_CP023630|CRISPRCasFinder 366893-366919 27 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 2189-2215 5 0.815
NZ_CP023630_2 2.7|366893|27|NZ_CP023630|CRISPRCasFinder 366893-366919 27 MN693945 Marine virus AFVG_250M952, complete genome 34909-34935 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 369429-369455 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 338832-338858 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 363377-363403 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 104717-104743 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 338543-338569 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 340811-340837 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 342690-342716 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 343060-343086 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 355714-355740 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 343060-343086 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 348335-348361 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 343052-343078 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 69464-69490 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 363377-363403 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 355714-355740 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 342690-342716 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 10340-10366 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 19365-19391 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 MN586031 Gordonia phage Gambino, complete genome 3053-3079 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 KU998236 Gordonia phage Blueberry, complete genome 3053-3079 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 MN062704 Gordonia phage JuJu, complete genome 3063-3089 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 MK501729 Gordonia phage Walrus, complete genome 3053-3079 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NC_031226 Gordonia phage BaxterFox, complete genome 2982-3008 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 MK967393 Rhodococcus phage Whack, complete genome 3063-3089 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 MT723935 Gordonia phage Azula, complete genome 3053-3079 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 KU963249 Gordonia phage Yeezy, complete genome 2982-3008 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 MH153808 Gordonia phage Petra, complete genome 3053-3079 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 MT639650 Gordonia phage Ohgeesy, complete genome 2982-3008 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 MH536818 Gordonia phage Frokostdame, complete genome 3055-3081 5 0.815
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 KX557275 Gordonia phage CarolAnn, complete genome 3052-3078 5 0.815
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 KX683875 Mycobacterium phage Baehexic, complete genome 12181-12207 5 0.815
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 KM197169 Mycobacterium phage Piro94, complete genome 12178-12204 5 0.815
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 MF668269 Mycobacterium phage Drake55, complete genome 12177-12203 5 0.815
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 MK284522 Mycobacterium phage Malec, complete genome 11950-11976 5 0.815
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 KM677210 Mycobacterium phage Larenn, complete genome 11945-11971 5 0.815
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 1800-1826 5 0.815
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 136919-136945 5 0.815
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 658056-658082 5 0.815
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1514868-1514894 5 0.815
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5852040-5852066 5 0.815
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 235006-235032 5 0.815
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 263243-263269 5 0.815
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 MH576962 Streptomyces phage Satis, complete genome 95306-95332 5 0.815
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 MK620894 Streptomyces phage Kradal, complete genome 95310-95336 5 0.815
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1068923-1068952 5 0.833
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1739900-1739929 5 0.833
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233389-233418 5 0.833
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 44938-44967 5 0.833
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 137673-137702 5 0.833
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 984252-984281 5 0.833
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1598936-1598965 5 0.833
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233398-233427 5 0.833
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292905-292934 5 0.833
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 AY950802 Haloarcula phage SH1, complete genome 16104-16133 5 0.833
NZ_CP023630_4 4.16|927282|24|NZ_CP023630|CRT 927282-927305 24 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 11649-11672 5 0.792
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MG925349 Mycobacterium phage Mendokysei, complete genome 21052-21085 5 0.853
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3841167-3841191 5 0.8
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NC_015178 Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence 157500-157524 5 0.8
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 179155-179179 5 0.8
NZ_CP023630_6 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder 1212088-1212112 25 NC_009469 Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence 67026-67050 5 0.8
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 94483-94510 5 0.821
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 KU728633 Mycobacterium phage Bipper, complete genome 41992-42019 5 0.821
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 MK977701 Mycobacterium phage Cracklewink, complete genome 41985-42012 5 0.821
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 100320-100347 5 0.821
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 614111-614135 5 0.8
NZ_CP023630_7 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder 1572375-1572399 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 92705-92729 5 0.8
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 45440-45470 5 0.839
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 123562-123592 5 0.839
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 72551-72581 5 0.839
NZ_CP023630_7 7.13|1573017|34|NZ_CP023630|CRISPRCasFinder 1573017-1573050 34 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 89410-89443 5 0.853
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NC_010850 Rhodococcus sp. NS1 plasmid pNSL1, complete sequence 92901-92931 5 0.839
NZ_CP023630_1 1.3|333787|30|NZ_CP023630|CRT 333787-333816 30 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 57659-57688 6 0.8
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 586980-587009 6 0.8
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 453093-453122 6 0.8
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 236156-236185 6 0.8
NZ_CP023630_2 2.1|366497|27|NZ_CP023630|CRISPRCasFinder 366497-366523 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 207335-207361 6 0.778
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 435770-435802 6 0.818
NZ_CP023630_2 2.7|366893|27|NZ_CP023630|CRISPRCasFinder 366893-366919 27 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 32942-32968 6 0.778
NZ_CP023630_2 2.9|367043|27|NZ_CP023630|CRISPRCasFinder 367043-367069 27 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 50750-50776 6 0.778
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 179708-179734 6 0.778
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4846911-4846937 6 0.778
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 78863-78889 6 0.778
NZ_CP023630_2 2.10|367103|27|NZ_CP023630|CRISPRCasFinder 367103-367129 27 MK494099 Mycobacterium phage Typha, complete genome 33831-33857 6 0.778
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 658647-658673 6 0.778
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 NC_023606 Mycobacterium phage CRB1, complete genome 11649-11675 6 0.778
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 MK524491 Mycobacterium phage Whabigail7, complete genome 12139-12165 6 0.778
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 KX619650 Mycobacterium phage Jerm, complete genome 12089-12115 6 0.778
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 MN585998 Mycobacterium phage Bugsy, complete genome 12128-12154 6 0.778
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 JN408460 Mycobacterium phage Turbido, complete genome 12151-12177 6 0.778
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 MH077576 Mycobacterium phage AbbyPaige, complete genome 12129-12155 6 0.778
NZ_CP023630_4 4.5|926787|27|NZ_CP023630|CRT 926787-926813 27 MH825704 Mycobacterium phage LilTurb, complete genome 12148-12174 6 0.778
NZ_CP023630_4 4.10|926997|27|NZ_CP023630|CRT 926997-927023 27 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 147990-148016 6 0.778
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 508-537 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 280809-280838 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 561652-561681 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554428-554457 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542116-542145 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 610786-610815 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571170-571199 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1563589-1563618 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 421135-421164 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1217050-1217079 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1265979-1266008 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1135414-1135443 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP037868 Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence 5790-5819 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1195134-1195163 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1134511-1134540 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 762260-762289 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1168711-1168740 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1168700-1168729 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1135406-1135435 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1134762-1134791 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1135397-1135426 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1217165-1217194 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1217149-1217178 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1217142-1217171 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_019408 Caulobacter phage CcrRogue, complete genome 180466-180495 6 0.8
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 174181-174210 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 270228-270257 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 MK937608 Microbacterium phage Cressida, complete genome 54022-54051 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554437-554466 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542125-542154 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP017592 Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence 7337-7366 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP008898 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence 43955-43984 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 73653-73682 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 36331-36360 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571179-571208 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 317155-317184 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 116386-116415 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP050069 Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence 79588-79617 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP039425 Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence 132572-132601 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP009856 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence 26128-26157 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP039430 Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence 132570-132599 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 32030-32059 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 14031-14060 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 17715-17744 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 19031-19060 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1930897-1930926 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190353-190382 6 0.8
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 MH029534 Myoviridae environmental samples clone NHS-Seq2, complete sequence 34123-34152 6 0.8
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 MT723940 Mycobacterium phage Ellie, complete genome 24126-24161 6 0.833
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466597-3466630 6 0.824
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210883-2210916 6 0.824
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283764-283797 6 0.824
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445248-445281 6 0.824
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 39276-39303 6 0.786
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 76834-76861 6 0.786
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 NZ_LR594663 Variovorax sp. RA8 plasmid 2 131793-131820 6 0.786
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 27764-27794 6 0.806
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 438646-438676 6 0.806
NZ_CP023630_7 7.13|1573017|34|NZ_CP023630|CRISPRCasFinder 1573017-1573050 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 28989-29022 6 0.824
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NC_009478 Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence 8328-8358 6 0.806
NZ_CP023630_1 1.3|333787|30|NZ_CP023630|CRT 333787-333816 30 MK460246 Mycobacterium phage Nibb, complete genome 5349-5378 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 401811-401840 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 191003-191032 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_AP022334 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence 130127-130156 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP024582 Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence 282765-282794 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1675975-1676004 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 988804-988833 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 1096-1125 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 98302-98331 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 258318-258347 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 52934-52963 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 944807-944836 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1187570-1187599 7 0.767
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NC_021279 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence 36879-36908 7 0.767
NZ_CP023630_2 2.4|366692|27|NZ_CP023630|CRISPRCasFinder 366692-366718 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 48081-48107 7 0.741
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 943873-943902 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 392100-392129 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1838430-1838459 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 616186-616215 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 397449-397478 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1703655-1703684 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 212329-212358 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 679499-679528 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1744018-1744047 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1760732-1760761 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 178925-178954 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 75369-75398 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 153012-153041 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 589998-590027 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 81538-81567 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 845884-845913 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 258296-258325 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1723933-1723962 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1859622-1859651 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 137321-137350 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 258496-258525 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 257917-257946 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 234345-234374 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 461507-461536 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 254201-254230 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 236985-237014 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 298368-298397 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 258487-258516 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 461579-461608 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 390422-390451 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1964821-1964850 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 461516-461545 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 237930-237959 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 849014-849043 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1227007-1227036 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 238244-238273 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 245279-245308 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 235437-235466 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 126762-126791 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 234570-234599 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 258309-258338 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 231309-231338 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 235690-235719 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 238261-238290 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 251052-251081 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 298440-298469 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 230351-230380 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 461938-461967 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 438995-439024 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 252665-252694 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 245262-245291 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 245236-245265 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 241864-241893 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 240004-240033 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 235466-235495 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 280525-280554 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 251050-251079 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 HM560026 Uncultured bacterium plasmid pTRACA45, complete sequence 1764-1793 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_010867 Neisseria lactamica plasmid pNL3.1, complete sequence 3216-3245 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 121720-121749 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 535160-535189 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 326858-326887 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 121664-121693 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 KT997827 Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome 28429-28458 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 235977-236006 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1424992-1425021 7 0.767
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 KT997829 Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome 24686-24715 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 278785-278814 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 113824-113853 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 158849-158878 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 384914-384943 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 317121-317150 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 385410-385439 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 260932-260961 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 329309-329338 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 391416-391445 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 243975-244004 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 301676-301705 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 201076-201105 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 635292-635321 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 422833-422862 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 494408-494437 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 MN582086 Siphoviridae sp. ctdEk19, complete genome 33318-33347 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 864583-864612 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP022700 Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence 61493-61522 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1238691-1238720 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1484042-1484071 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1466967-1466996 7 0.767
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP031082 Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence 119508-119537 7 0.767
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 NC_022087 Mycobacterium phage AnnaL29, complete genome 5558-5593 7 0.806
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210628-2210661 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2209827-2209860 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 24930-24963 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2133215-2133248 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MT889380 Mycobacterium phage Coco12, complete genome 22836-22869 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MT114167 Mycobacterium phage Phanphagia, complete genome 22491-22524 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 531146-531179 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 117310-117343 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 254574-254607 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP039641 Azospirillum sp. TSH100 plasmid p2, complete sequence 30914-30947 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MH697583 Mycobacterium phage EricMillard, complete genome 32257-32290 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MH727551 Mycobacterium phage Kalah2, complete genome 32307-32340 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MH077579 Mycobacterium phage Halley, complete genome 31970-32003 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MH669017 Mycobacterium phage Zelink, complete genome 33051-33084 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN062701 Mycobacterium phage Dallas, complete genome 31496-31529 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK524527 Mycobacterium phage ThreeRngTarjay, complete genome 32107-32140 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK524529 Mycobacterium phage Phoebus, complete genome 32257-32290 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MF919512 Mycobacterium phage Klein, complete genome 31531-31564 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 KF114875 Mycobacterium phage Redno2, complete genome 31720-31753 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK967379 Mycobacterium phage HokkenD, complete genome 31519-31552 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 307986-308019 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 178492-178525 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 275379-275412 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445383-445416 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 275378-275411 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN813686 Mycobacterium phage BirdsNest, complete genome 30327-30360 7 0.794
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_042035 Mycobacterium phage Zemanar, complete sequence 31516-31549 7 0.794
NZ_CP023630_6 6.9|1212352|37|NZ_CP023630|CRISPRCasFinder 1212352-1212388 37 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136926 7 0.811
NZ_CP023630_7 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder 1572153-1572180 28 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 259627-259654 7 0.75
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 281800-281830 7 0.774
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 CP017041 Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence 68407-68437 7 0.774
NZ_CP023630_8 8.3|2088362|30|NZ_CP023630|CRT 2088362-2088391 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 52187-52216 7 0.767
NZ_CP023630_8 8.3|2088362|30|NZ_CP023630|CRT 2088362-2088391 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 75140-75169 7 0.767
NZ_CP023630_8 8.3|2088362|30|NZ_CP023630|CRT 2088362-2088391 30 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 376489-376518 7 0.767
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 147567-147597 7 0.774
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 36995-37025 7 0.774
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP042263 Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence 372247-372277 7 0.774
NZ_CP023630_1 1.3|333787|30|NZ_CP023630|CRT 333787-333816 30 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 475069-475098 8 0.733
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NC_019847 Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence 101111-101140 8 0.733
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 730591-730620 8 0.733
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 480868-480897 8 0.733
NZ_CP023630_1 1.12|334267|30|NZ_CP023630|CRT 334267-334296 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 61392-61421 8 0.733
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1386736-1386768 8 0.758
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 35126-35158 8 0.758
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1241611-1241643 8 0.758
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 275839-275871 8 0.758
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 310597-310629 8 0.758
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2714450-2714479 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 837910-837939 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 424702-424731 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 975216-975245 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1013021-1013050 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_KY126370 Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence 93253-93282 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP054625 Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence 22400-22429 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1889334-1889363 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 21202-21231 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP046347 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence 30108-30137 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP044100 Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence 32856-32885 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 111116-111145 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 KY555144 Caulobacter phage Ccr5, complete genome 178242-178271 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_KP873172 Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence 21059-21088 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 159096-159125 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 50097-50126 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP022156 Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence 15249-15278 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP024682 Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence 41943-41972 8 0.733
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 242723-242752 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 28649-28678 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 310870-310899 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 462801-462830 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 292109-292138 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 287383-287412 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 292305-292334 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 292675-292704 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 306458-306487 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 292675-292704 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 295900-295929 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 292670-292699 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 306458-306487 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 292305-292334 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 298287-298316 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1682210-1682239 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 294530-294559 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 375826-375855 8 0.733
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 112972-113001 8 0.733
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 MG770216 Mycobacterium phage Rem711, complete genome 26292-26327 8 0.778
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 KY087993 Mycobacterium phage Hammy, complete genome 24359-24394 8 0.778
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 MF140406 Mycobacterium phage DarthP, complete genome 24368-24403 8 0.778
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466471-3466504 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350662-350695 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350530-350563 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3051061-3051094 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 36586-36619 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_047958 Burkholderia phage vB_BmuP_KL4, complete genome 28566-28599 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 117037-117070 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 928385-928418 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 131278-131311 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 117079-117112 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 117037-117070 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 670302-670335 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1123064-1123097 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 530145-530178 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 187401-187434 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN234223 Mycobacterium phage Philly, complete genome 30948-30981 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 KJ194581 Mycobacterium phage Audrey, complete genome 31094-31127 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MH051265 Mycobacterium phage Yahalom, complete genome 31107-31140 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MH316565 Mycobacterium phage Mortcellus, complete genome 31732-31765 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MT310871 Mycobacterium phage Jackstina, complete genome 31017-31050 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 EU816589 Mycobacterium phage Phaedrus, complete genome 31013-31046 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MT952851 Mycobacterium phage Gervas, complete genome 31075-31108 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MG920059 Mycobacterium phage Baloo, complete genome 31097-31130 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_023686 Mycobacterium phage Gadjet, complete genome 31104-31137 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_041965 Mycobacterium phage Athena, complete genome 31845-31878 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 DQ398049 Mycobacterium phage Pipefish, complete genome 32489-32522 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MT310892 Mycobacterium phage Compostia, complete genome 31524-31557 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN699018 Mycobacterium phage Kamiyu, complete genome 31063-31096 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687345-687378 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 118498-118531 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 539300-539333 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK814754 Mycobacterium phage Sumter, complete genome 28141-28174 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK814754 Mycobacterium phage Sumter, complete genome 28639-28672 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN369739 Mycobacterium phage Kenuha5, complete genome 22588-22621 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK967397 Mycobacterium phage Mahavrat, complete genome 24814-24847 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MT522000 Mycobacterium phage Soul22, complete genome 22192-22225 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 KY348865 Mycobacterium phage Bubbles123, complete genome 25540-25573 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN428047 Mycobacterium phage Doomphist, complete genome 24962-24995 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 22190-22223 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 AY129336 Mycobacteriophage Che9d, complete genome 22205-22238 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MT771340 Mycobacterium phage Jorgensen, complete genome 28476-28509 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK359343 Mycobacterium phage Pollywog, complete genome 23655-23688 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_042030 Mycobacterium phage Yoshi, complete sequence 22193-22226 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_048729 Mycobacterium phage Renaud18, complete genome 22865-22898 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_026585 Mycobacteriophage Estave1, complete genome 22558-22591 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK305886 Mycobacterium phage Poenanya, complete genome 24962-24995 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN859129 Mycobacterium virus DotProduct, complete genome 24829-24862 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MG925354 Mycobacterium phage Ogopogo, complete genome 22785-22818 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN698995 Mycobacterium phage Dori, complete genome 28163-28196 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_023698 Mycobacterium phage Avani, complete genome 22197-22230 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_011054 Mycobacterium phage Boomer, complete genome 24637-24670 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN234184 Mycobacterium phage IdentityCrisis, complete genome 19984-20017 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MH077585 Mycobacterium phage TChen, complete genome 22970-23003 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_048788 Mycobacterium phage ThetaBob, complete genome 22783-22816 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 125963-125996 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP015733 Arthrobacter sp. U41 plasmid unnamed1, complete sequence 138036-138069 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN096355 Mycobacterium phage Purky, complete genome 13505-13538 8 0.765
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN234183 Mycobacterium phage Antsirabe, complete genome 23060-23093 8 0.765
NZ_CP023630_6 6.9|1212352|37|NZ_CP023630|CRISPRCasFinder 1212352-1212388 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 683728-683764 8 0.784
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 349053-349083 8 0.742
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 336247-336277 8 0.742
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP039913 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence 262996-263026 8 0.742
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 336247-336277 8 0.742
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP018001 Rhizobium sp. Y9 plasmid pY9, complete sequence 264529-264559 8 0.742
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NC_022536 Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence 458177-458207 8 0.742
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 311056-311086 8 0.742
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 88587-88617 8 0.742
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 284157-284187 8 0.742
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 300067-300097 8 0.742
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1510497-1510527 8 0.742
NZ_CP023630_8 8.3|2088362|30|NZ_CP023630|CRT 2088362-2088391 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 9194-9223 8 0.733
NZ_CP023630_8 8.3|2088362|30|NZ_CP023630|CRT 2088362-2088391 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 983284-983313 8 0.733
NZ_CP023630_12 12.24|3122328|29|NZ_CP023630|PILER-CR 3122328-3122356 29 MK599315 Pseudomonas phage PA1C, complete genome 299172-299200 8 0.724
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 CP033373 Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence 12237-12267 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1260343-1260373 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1009358-1009388 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1260501-1260531 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1009351-1009381 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 756669-756699 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1137767-1137797 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1009365-1009395 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1260057-1260087 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1260001-1260031 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 981946-981976 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 938267-938297 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 748414-748444 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 896022-896052 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 215713-215743 8 0.742
NZ_CP023630_13 13.7|3741073|31|NZ_CP023630|CRT 3741073-3741103 31 NC_014213 Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence 111748-111778 8 0.742
NZ_CP023630_1 1.13|334315|39|NZ_CP023630|CRT 334315-334353 39 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 24079-24117 9 0.769
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 91175-91207 9 0.727
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 668963-668995 9 0.727
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 789706-789738 9 0.727
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 625853-625885 9 0.727
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NZ_CP023630_3 3.1|691992|31|NZ_CP023630|CRISPRCasFinder 691992-692022 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NZ_CP023630_4 4.13|927138|30|NZ_CP023630|CRT 927138-927167 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5046041-5046070 9 0.7
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 65937-65966 9 0.7
NZ_CP023630_4 4.15|927234|30|NZ_CP023630|CRT 927234-927263 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 65937-65966 9 0.7
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 MF140398 Mycobacterium phage Amohnition, complete genome 24446-24481 9 0.75
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350101-350134 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210928-2210961 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 231456-231489 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306612-306645 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283233-283266 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 EF602154 Burkholderia phage BcepNY3, complete genome 21505-21538 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 AY369265 Burkholderia cenocepacia phage Bcep1, complete genome 23287-23320 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_005263 Burkholderia phage Bcep1, complete genome 23287-23320 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 307143-307176 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 298112-298145 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 723127-723160 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP053906 Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence 19270-19303 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 KC170279 Uncultured bacterium plasmid pMBUI8, complete sequence 15929-15962 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 652970-653003 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 490801-490834 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 637964-637997 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 235008-235041 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 646029-646062 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 635838-635871 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 684904-684937 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1303766-1303799 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 897262-897295 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 233325-233358 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 560015-560048 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1424629-1424662 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 796570-796603 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 659643-659676 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1083784-1083817 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1052610-1052643 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1150006-1150039 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 654523-654556 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 771404-771437 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 290861-290894 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 371773-371806 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1224363-1224396 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 997046-997079 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1083789-1083822 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MH001451 Mycobacterium phage Nairb, complete genome 21242-21275 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MF155936 Mycobacterium phage ZenTime222, complete genome 21242-21275 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MH588544 Caulobacter phage CcrBL10, complete genome 39042-39075 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK494089 Mycobacterium phage Ibrahim, complete genome 21242-21275 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_024135 Mycobacterium phage Bernal13, complete genome 21242-21275 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 KM591905 Mycobacterium phage RonRayGun, complete genome 21242-21275 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN735432 Mycobacteriophage Whitty, complete genome 21242-21275 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_KX443399 Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence 82507-82540 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_KX443400 Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence 82532-82565 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_KX443398 Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence 82528-82561 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 90688-90721 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_KP851975 Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence 82645-82678 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 55533-55566 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 318448-318481 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_KF439868 Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence 81659-81692 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 84861-84894 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 135548-135581 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 498515-498548 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 927230-927263 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 241368-241401 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 455289-455322 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 241368-241401 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 239809-239842 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 244056-244089 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 238174-238207 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 131481-131514 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 241368-241401 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 747004-747037 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 KC736071 Mycobacterium phage WIVsmall, complete genome 29683-29716 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 171949-171982 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 52095-52128 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 129601-129634 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 301604-301637 9 0.735
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 779027-779060 9 0.735
NZ_CP023630_6 6.9|1212352|37|NZ_CP023630|CRISPRCasFinder 1212352-1212388 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 686592-686628 9 0.757
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 345043-345073 9 0.71
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 245050-245080 9 0.71
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 194387-194417 9 0.71
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 MN234199 Mycobacterium phage Ekdilam, complete genome 24235-24265 9 0.71
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1145162-1145192 9 0.71
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 453136-453166 9 0.71
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP013740 Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence 2806-2836 9 0.71
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1908459-1908489 9 0.71
NZ_CP023630_13 13.5|3740932|34|NZ_CP023630|CRT 3740932-3740965 34 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 922290-922323 9 0.735
NZ_CP023630_13 13.5|3740932|34|NZ_CP023630|CRT 3740932-3740965 34 MG812496 Gordonia phage SallySpecial, complete genome 7675-7708 9 0.735
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 91179-91211 10 0.697
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 90245-90277 10 0.697
NZ_CP023630_2 2.6|366827|33|NZ_CP023630|CRISPRCasFinder 366827-366859 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 99166-99198 10 0.697
NZ_CP023630_4 4.2|926634|39|NZ_CP023630|CRT 926634-926672 39 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 107058-107096 10 0.744
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 MN369764 Mycobacterium phage Rahalelujah, complete genome 24340-24375 10 0.722
NZ_CP023630_4 4.17|927324|36|NZ_CP023630|CRT 927324-927359 36 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 25147-25182 10 0.722
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210946-2210979 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1732364-1732397 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 21676-21709 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 CP000620 Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence 96060-96093 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP020810 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence 93944-93977 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 98684-98717 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK524490 Mycobacterium phage Donny, complete genome 33811-33844 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MK494095 Mycobacterium phage Daegal, complete genome 5959-5992 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN699007 Mycobacterium phage Acadian, complete genome 33806-33839 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MT889381 Mycobacterium phage Suigeneris, complete genome 33811-33844 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP015373 Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence 47518-47551 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 AP018709 Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence 27460-27493 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 194712-194745 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 362178-362211 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 10252-10285 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 677361-677394 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 8446-8479 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 65893-65926 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 640930-640963 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 104485-104518 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_024998 Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83 31366-31399 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_008385 Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence 29995-30028 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP018471 Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence 16577-16610 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_KJ588780 Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence 15929-15962 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_MN366359 Bacterium plasmid pALTS31, complete sequence 15929-15962 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 100724-100757 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_001735 Enterobacter aerogenes plasmid R751, complete sequence 31148-31181 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 AGRM01000006 Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence 12357-12390 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 AJ863570 Uncultured bacterium IncP-1beta multiresistance plasmid pB8 25168-25201 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP034651 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence 17683-17716 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1350942-1350975 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 136497-136530 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 46815-46848 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 25131-25164 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JX469829 Uncultured bacterium plasmid pB1, complete sequence 16215-16248 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JX469831 Uncultured bacterium plasmid pKSP212, complete sequence 15929-15962 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN106172 Uncultured bacterium plasmid pAKD29, complete sequence 15931-15964 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 15929-15962 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 15932-15965 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 15939-15972 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 15929-15962 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 15929-15962 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 15929-15962 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JN106169 Uncultured bacterium plasmid pAKD18, complete sequence 15929-15962 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN386974 Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence 16066-16099 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_001381 Mycobacterium fortuitum plasmid pAL5000, complete sequence 2682-2715 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 31441-31474 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP021650 Acidovorax sp. T1 plasmid p2-T1, complete sequence 40579-40612 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 JX486125 Uncultured bacterium plasmid pRWC72a, complete sequence 15940-15973 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 50284-50317 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 AJ639924 Uncultured bacterium plasmid pB3 complete genome 17431-17464 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 KU356987 Variovorax paradoxus plasmid pBS64, complete sequence 15928-15961 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 KU356988 Variovorax paradoxus plasmid pHB44, complete sequence 15930-15963 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 155712-155745 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP009797 Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence 16433-16466 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_013176 Pseudomonas putida plasmid pW2, complete sequence 10533-10566 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 49358-49391 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP017455 Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence 23524-23557 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 71777-71810 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_MN366358 Bacterium plasmid pALTS29, complete sequence 15940-15973 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MN234219 Mycobacterium phage Mercurio, complete genome 23308-23341 10 0.706
NZ_CP023630_6 6.9|1212352|37|NZ_CP023630|CRISPRCasFinder 1212352-1212388 37 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 331923-331959 10 0.73
NZ_CP023630_6 6.9|1212352|37|NZ_CP023630|CRISPRCasFinder 1212352-1212388 37 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 716620-716656 10 0.73
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 425898-425928 10 0.677
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 344090-344120 10 0.677
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 68383-68413 10 0.677
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 16322-16352 10 0.677
NZ_CP023630_7 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder 1572768-1572798 31 NZ_AP014581 Burkholderia sp. RPE67 plasmid p3, complete sequence 131907-131937 10 0.677
NZ_CP023630_7 7.13|1573017|34|NZ_CP023630|CRISPRCasFinder 1573017-1573050 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1081518-1081551 10 0.706
NZ_CP023630_11 11.9|3119730|35|NZ_CP023630|PILER-CR,CRISPRCasFinder,CRT 3119730-3119764 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NZ_CP023630_12 12.20|3123201|34|NZ_CP023630|CRISPRCasFinder,CRT 3123201-3123234 34 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 171698-171731 10 0.706
NZ_CP023630_12 12.36|3123205|34|NZ_CP023630|PILER-CR 3123205-3123238 34 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 171698-171731 10 0.706
NZ_CP023630_13 13.5|3740932|34|NZ_CP023630|CRT 3740932-3740965 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 470079-470112 10 0.706
NZ_CP023630_13 13.5|3740932|34|NZ_CP023630|CRT 3740932-3740965 34 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 68774-68807 10 0.706
NZ_CP023630_13 13.5|3740932|34|NZ_CP023630|CRT 3740932-3740965 34 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
NZ_CP023630_13 13.5|3740932|34|NZ_CP023630|CRT 3740932-3740965 34 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350092-350125 11 0.676
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 239254-239287 11 0.676
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MH051334 Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome 23136-23169 11 0.676
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 MG852086 Escherichia phage vB_EcoS-Ro145clw, complete genome 41310-41343 11 0.676
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261086-261119 11 0.676
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 584732-584765 11 0.676
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 70292-70325 11 0.676
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 507461-507494 11 0.676
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 155836-155869 11 0.676
NZ_CP023630_6 6.5|1212136|40|NZ_CP023630|CRISPRCasFinder 1212136-1212175 40 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261884-261923 11 0.725
NZ_CP023630_13 13.5|3740932|34|NZ_CP023630|CRT 3740932-3740965 34 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 326578-326611 11 0.676
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190139-190172 12 0.647
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_CP026703 Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence 14966-14999 12 0.647
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 302491-302524 14 0.588
NZ_CP023630_6 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder 1212031-1212064 34 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 282346-282379 15 0.559

1. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtgcc	Protospacer
********************.*

2. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

3. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

4. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcgggccggcggca	Protospacer
**********.***********

5. spacer 7.15|1573140|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

6. spacer 7.15|1573140|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

7. spacer 7.15|1573140|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

8. spacer 7.15|1573140|22|NZ_CP023630|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

9. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtggg	Protospacer
********************  

10. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
agtcggcggtgccgacggtgtc	Protospacer
 *************.*******

11. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggcgtc	Protospacer
.*****************.***

12. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgtcggcggtgtc	Protospacer
.**********.**********

13. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggcggcgtc	Protospacer
 *****************.***

14. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

15. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

16. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggccgtgtc	Protospacer
 *************** *****

17. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgacggcggtgccggcggtgtg	Protospacer
** ****************** 

18. spacer 6.15|1212652|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909

ggacggtggtaccggcggtcag	CRISPR spacer
tgacggtggtgccggcggtcag	Protospacer
 *********.***********

19. spacer 7.2|1572213|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

20. spacer 7.2|1572213|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

21. spacer 7.2|1572213|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

22. spacer 7.2|1572213|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

23. spacer 7.2|1572213|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

24. spacer 7.3|1572267|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909

ggtaccgtcctcgccggcggtg	CRISPR spacer
ggcaccgtcctcgccggcggtt	Protospacer
**.****************** 

25. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

26. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

27. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

28. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

29. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

30. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

31. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

32. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

33. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

34. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgggg	Protospacer
******************** .

35. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
accgccgatcaggccggcggca	Protospacer
..********************

36. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ctcggcgatcaggccggcggca	Protospacer
 *** *****************

37. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

38. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

39. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

40. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

41. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcg	Protospacer
***************** ***.

42. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ggcgccgatcaggccggcggcc	Protospacer
* ******************* 

43. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggcctgcggcg	Protospacer
*************** *****.

44. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

45. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgccg	Protospacer
******************* *.

46. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgagcaggccggcggcc	Protospacer
******** ************ 

47. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

48. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

49. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

50. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

51. spacer 1.11|334222|27|NZ_CP023630|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
tcgccgttggcgatcagtccgccgtcg	Protospacer
.************ ***********.*

52. spacer 1.11|334222|27|NZ_CP023630|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
tcgccgttggcgatcagtccgccgtcg	Protospacer
.************ ***********.*

53. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgacctcggcggcgcgggcga	Protospacer
.***************** ****.

54. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctgggcggcgctggcgg	Protospacer
 ****.*** **************

55. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

56. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
agccgacctcggcggcgatggcgc	Protospacer
*.*************** ***** 

57. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

58. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

59. spacer 4.16|927282|24|NZ_CP023630|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

60. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

61. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

62. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

63. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

64. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

65. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aaccggcctcggcggcgctgccgc	Protospacer
*****.************** ** 

66. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccgagctcggcggcgctgccgg	Protospacer
 ***** ************* ***

67. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctcggcggcgcgggcgg	Protospacer
 ****.************ *****

68. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aacccacctcggcggcgatggcgc	Protospacer
**** ************ ***** 

69. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

70. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

71. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

72. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

73. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

74. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

75. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtggt	Protospacer
.******************* .

76. spacer 6.7|1212268|22|NZ_CP023630|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
catcggcggtgccggcggtgtg	Protospacer
..******************* 

77. spacer 6.11|1212451|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864

gctgtggggcggcggtggtgcc	CRISPR spacer
cgtgtggggcggcggtggtgca	Protospacer
  ******************* 

78. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgcgg	Protospacer
*******************  .

79. spacer 7.4|1572321|22|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
ttcgccgatcaggccggcggtg	Protospacer
 *******************..

80. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
ctcgccgaacacgcggaagccgtct	Protospacer
**.*********** ********* 

81. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
attgtcgaacacgcggaagccgtcg	Protospacer
 ***.********* **********

82. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

83. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

84. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

85. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
catgcggaacacgccgaatccgtcg	Protospacer
* *** ************ ******

86. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgatcacgccgtagccgttg	Protospacer
******** ******* ******.*

87. spacer 7.15|1573140|22|NZ_CP023630|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864

caatccggcggcgccgccggca	CRISPR spacer
gaatccggcggcgccgccgggc	Protospacer
 *******************  

88. spacer 8.5|2088452|24|NZ_CP023630|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

89. spacer 8.5|2088452|24|NZ_CP023630|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

90. spacer 2.1|366497|27|NZ_CP023630|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

91. spacer 2.1|366497|27|NZ_CP023630|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

92. spacer 2.7|366893|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ccgaagccgatgtcgtagcggccggcg	Protospacer
 ************.***** *****.*

93. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg	Protospacer
.* ********* ***********.**

94. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
acggcgccgaagttgaggccgccgacg	Protospacer
**  **************.****** *

95. spacer 4.10|926997|27|NZ_CP023630|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgcatccggcggcggcggttgcgttct	Protospacer
** **************** ***** .

96. spacer 4.10|926997|27|NZ_CP023630|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggcctcggcggcggcggtggcgttgc	Protospacer
*** ..*************.*******

97. spacer 4.10|926997|27|NZ_CP023630|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggccgcggcggcggcggtagcggtgc	Protospacer
*** . ***************** ***

98. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc	Protospacer
 ************ ********* ***.** 

99. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

100. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
gcccgatctcggcggcgctggcgt	Protospacer
. ****.**************** 

101. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

102. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgtcgacgtcggcggcgctggcgg	Protospacer
 ..**** ****************

103. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cttcgacttcggcggcgctggcgg	Protospacer
  .****.****************

104. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

105. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

106. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

107. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

108. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgccgacctcggcggcggtggcga	Protospacer
 .*************** *****.

109. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

110. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

111. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tctcgacctcggcggcgatggcgg	Protospacer
  .************** ******

112. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tgccgacctcggctgcgctggcgc	Protospacer
 .*********** ********* 

113. spacer 4.16|927282|24|NZ_CP023630|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ggtcgacctcgacggcgctggcgg	Protospacer
...********.************

114. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

115. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

116. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

117. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gtccggcggccttggcgtagcgcct	Protospacer
  **********.***********.

118. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

119. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggccccggcgtcgcgcga	Protospacer
***********.****** ****  

120. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtaatggtc	Protospacer
*******************..* .*

121. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcatcggcgtagcggcg	Protospacer
.********* *********** * 

122. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcctccgcgtcgcgcct	Protospacer
.************ **** *****.

123. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcgggc	Protospacer
.*.*******************  *

124. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggccgcgtcgtagcgcca	Protospacer
.********** ** ********* 

125. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

126. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggtgtcctcggcgtagcgcga	Protospacer
******.* **************  

127. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

128. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggctgcctcggcatagcgccg	Protospacer
 ****** ********.******* 

129. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

130. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggtggcctcggcgtagccccg	Protospacer
.*****.************** ** 

131. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

132. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tggcggcggcctcgccgtagcgctt	Protospacer
** *********** ********..

133. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcggac	Protospacer
.*.*******************  *

134. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
agccggcggcctcggcctcgcgccg	Protospacer
 *************** * ***** 

135. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

136. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

137. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

138. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

139. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
tccgccgaacgcgccgaagccgtcg	Protospacer
...*******.**************

140. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

141. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

142. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

143. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

144. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

145. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacacgccgatgccctgc	Protospacer
***************** *** *  

146. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
aatgccgaattcgccgaagccgtcg	Protospacer
  *******. **************

147. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cccgtagaacacgccgaagccgtcg	Protospacer
*..*. *******************

148. spacer 7.14|1573083|25|NZ_CP023630|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgccaccgacccccccttgc	CRISPR spacer
ttttccgacaccgacccccccttga	Protospacer
.** *** **************** 

149. spacer 8.5|2088452|24|NZ_CP023630|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcgaagaagctgaacacgcccgc	Protospacer
**************** ****  .

150. spacer 8.5|2088452|24|NZ_CP023630|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
gtcgatgaagctgaacccgccgaa	Protospacer
.**** ****************  

151. spacer 8.5|2088452|24|NZ_CP023630|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcggagaagctgaacccgcccgg	Protospacer
****.****************   

152. spacer 1.2|333742|27|NZ_CP023630|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815

ccggcgcctagagcgttggcaccgctg	CRISPR spacer
ctcgggcctagagcgttggcaccgtgg	Protospacer
*. * *******************. *

153. spacer 1.11|334222|27|NZ_CP023630|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
ccgccgttggcgaccagtccgcaatca	Protospacer
************* ******** .*..

154. spacer 1.11|334222|27|NZ_CP023630|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
gggtcgtcggagaacagtccgccgttg	Protospacer
  *.***.** ****************

155. spacer 1.11|334222|27|NZ_CP023630|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
gtggcgttgtcgaacagaccgccgttg	Protospacer
 .* ***** ******* *********

156. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccgggtcaccgccagcggggccagga	Protospacer
********* ************ ***. *.

157. spacer 1.12|334267|30|NZ_CP023630|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccgatccagacaccgccagcggcgccgagg	Protospacer
***..* .******************* **

158. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ccggccgggacaccgccagcggcg-ccgtgg	CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg-	Protospacer
*****************  *****  **.* 

159. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc	Protospacer
  *.****  **** **************** 

160. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc	Protospacer
  *.****  **** **************** 

161. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc	Protospacer
  *.****  **** **************** 

162. spacer 2.1|366497|27|NZ_CP023630|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

163. spacer 2.1|366497|27|NZ_CP023630|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

164. spacer 2.7|366893|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
gcgaagccgaagttgtagctgcgctcg	Protospacer
********** ***********   .*

165. spacer 2.7|366893|27|NZ_CP023630|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
atgaagccgatgttgtcgctaccgggg	Protospacer
..************** ***.**** *

166. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

167. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

168. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

169. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccccgcggaagttgaggtcgcgggtg	Protospacer
 ****** ************** *. *

170. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

171. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

172. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

173. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

174. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

175. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

176. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

177. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

178. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

179. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

180. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

181. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

182. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

183. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

184. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

185. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

186. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

187. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

188. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

189. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccttaccgaagttgaggtcgacgagg	Protospacer
 **...*************** *****

190. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

191. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

192. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

193. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

194. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

195. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

196. spacer 4.5|926787|27|NZ_CP023630|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

197. spacer 4.5|926787|27|NZ_CP023630|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

198. spacer 4.5|926787|27|NZ_CP023630|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

199. spacer 4.5|926787|27|NZ_CP023630|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

200. spacer 4.5|926787|27|NZ_CP023630|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

201. spacer 4.10|926997|27|NZ_CP023630|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

202. spacer 4.10|926997|27|NZ_CP023630|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

203. spacer 4.10|926997|27|NZ_CP023630|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

204. spacer 4.10|926997|27|NZ_CP023630|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

205. spacer 4.10|926997|27|NZ_CP023630|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgggtccggcggcggcggtggcggttt	Protospacer
***.***************.*** * .

206. spacer 4.10|926997|27|NZ_CP023630|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgactccggcggcgggggtagcgttcg	Protospacer
**. *********** *********  

207. spacer 4.10|926997|27|NZ_CP023630|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgccgccggcggcggcggtggcgttgg	Protospacer
**   **************.****** 

208. spacer 4.10|926997|27|NZ_CP023630|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

209. spacer 4.10|926997|27|NZ_CP023630|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

210. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgaggccggcctgctggtcgtctccgggct	Protospacer
*** **************** ******   

211. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agattccggcctgttcgtcggctccggcgg	Protospacer
 **. ********.* **************

212. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg	Protospacer
** *..********** ***** *******

213. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg	Protospacer
** ******************* * *  **

214. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
cgacgccggcatgccggtcggcttcctgct-	Protospacer
********** ***.******* *** **  

215. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

216. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

217. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg	Protospacer
*******.***** **********   ***

218. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctg--ttcggctccggcggcgctggcgg	CRISPR spacer
--tactgattacggctccggcggtgctggcgg	Protospacer
  *.***  * ************.********

219. spacer 4.15|927234|30|NZ_CP023630|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833

--cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg	Protospacer
  ***.*  *************** *.*****

220. spacer 4.16|927282|24|NZ_CP023630|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792

aaccgacctcggcggcgctggcgg	CRISPR spacer
gggcgacctcggcggcgctggcct	Protospacer
.. *******************  

221. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc	Protospacer
******************** ********  *. 

222. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gcgcggcggcctcggcgtagagccg	Protospacer
   ***************** *** 

223. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

224. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
caccggcggcctcggcgtagcttgc	Protospacer
..******************* . *

225. spacer 6.4|1212088|25|NZ_CP023630|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

226. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gctgccgtgggtgccatcgttgccgagt	Protospacer
*.***** *****************. .

227. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

228. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

229. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gttgccgcgggtgccctcgttgcggacg	Protospacer
******* ******* ******* *.* 

230. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gccgccgaacacgccgaagccgttt	Protospacer
 ..********************. 

231. spacer 7.5|1572375|25|NZ_CP023630|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaacacgccgacgccgcgc	Protospacer
 **************** ****.  

232. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

233. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

234. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

235. spacer 7.13|1573017|34|NZ_CP023630|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853

gtcgccgtgcagccagccaccaccgcca-ccggcg	CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc-	Protospacer
 *************.********* *** ** ** 

236. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839

aacgccc-acttcaccgccgttgccgccgtca	CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga	Protospacer
 **.*** ************.********  *

237. spacer 1.3|333787|30|NZ_CP023630|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

ccggcggagccgaagagcaagccgccgttc	CRISPR spacer
tcagcggagccgaagatcacgccgccgagc	Protospacer
.*.************* ** *******  *

238. spacer 1.12|334267|30|NZ_CP023630|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg	Protospacer
*************** ** *****  *  *

239. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8

ccggccgggacaccgccagcggcgccgtgg----	CRISPR spacer
ccagccgggagaccgccagcggc----tggctct	Protospacer
**.******* ************    ***    

240. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc	Protospacer
   .****  ******.************** 

241. spacer 2.1|366497|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
agttcactggtgtccacatcgcccgaa	Protospacer
*.. ***.***************** .

242. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg	Protospacer
**   *.***** ******************.*

243. spacer 2.7|366893|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ggataggcgatgttgtagctgccggaa	Protospacer
* . ** ****************** .

244. spacer 2.9|367043|27|NZ_CP023630|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778

gccaagccgatatcgaagatcccggtg	CRISPR spacer
accatgccgatatcgacgatcccgtcc	Protospacer
.*** *********** ******* . 

245. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tagacgccgaagtcgaggtcggcgagg	Protospacer
    *********.******* *****

246. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
ctcccgccgaagttgagggtgccgaac	Protospacer
 .**************** .*****. 

247. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
aagaagccgaagttgaggtcgccgtag	Protospacer
*    ******************* .*

248. spacer 2.10|367103|27|NZ_CP023630|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg	Protospacer
   .******.**.*************

249. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

250. spacer 4.5|926787|27|NZ_CP023630|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
gatggccggtaggctgttgaacggcgc	Protospacer
.. *******.******* ******* 

251. spacer 4.5|926787|27|NZ_CP023630|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

252. spacer 4.5|926787|27|NZ_CP023630|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

253. spacer 4.5|926787|27|NZ_CP023630|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

254. spacer 4.5|926787|27|NZ_CP023630|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

255. spacer 4.5|926787|27|NZ_CP023630|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

256. spacer 4.5|926787|27|NZ_CP023630|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

257. spacer 4.5|926787|27|NZ_CP023630|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

258. spacer 4.10|926997|27|NZ_CP023630|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggatcctgcggcggcggtagaaagcc	Protospacer
******* ************* .   *

259. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

260. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

261. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctggtggtcggctacctcga	Protospacer
***** ******* ********* *  **.

262. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

263. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

264. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

265. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

266. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

267. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac	Protospacer
**  ** ****************.****. 

268. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

269. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

270. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

271. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcg----gctccggcgg	CRISPR spacer
cgacgccggccggctggtcggagagctgcg----	Protospacer
*********** ********    *** **    

272. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

273. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

274. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg	Protospacer
** *************.******.*  * *

275. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

276. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

277. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

278. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

279. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

280. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

281. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

282. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

283. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc	Protospacer
** *..************** * ****** 

284. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccgacctgctggtcggggcggactg	Protospacer
********.************  * *.* *

285. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
caagctggtcggccccggcggcgctggcaa	Protospacer
*  **** *****.**************..

286. spacer 4.15|927234|30|NZ_CP023630|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tcacctgtccggctccggcggcggtggcga	Protospacer
.*  ****.************** *****.

287. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

288. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

289. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg--	CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg	Protospacer
.************* ********  .**.*  

290. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

291. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

292. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

293. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

294. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg	Protospacer
* *  .*.******.***************

295. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

296. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

297. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

298. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

299. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

300. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

301. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

302. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

303. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

304. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt--cggctccggcggcgctggcgg	CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg	Protospacer
  .**.*.*  **** ****************

305. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt----cggctccggcggcgctggcgg	CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg	Protospacer
    * ***    *************** *****

306. spacer 4.15|927234|30|NZ_CP023630|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8

-cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg	Protospacer
 ..** * ****** *.**************

307. spacer 4.17|927324|36|NZ_CP023630|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg	Protospacer
  * .************************ .*****

308. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc--	Protospacer
************ ******* *****  * .***  

309. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc--	Protospacer
 .****************** ****** *  ***  

310. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct-	Protospacer
 .*********.*************** ..**** 

311. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac	Protospacer
 * ******************.**. ****** * 

312. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

313. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

314. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccggcggtgccatcggtgccgagg	Protospacer
* ****** ********** *****.  

315. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

316. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

317. spacer 7.13|1573017|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824

--gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca	Protospacer
  ****.*  *****  ******************.

318. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg	Protospacer
. ** ***************.******* *.

319. spacer 1.3|333787|30|NZ_CP023630|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767

ccggcggagccgaagagcaagccgccgttc	CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc	Protospacer
******.******** ********  .. *

320. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca	Protospacer
******.******** ********* .  .

321. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca	Protospacer
..**** ** *****************. .

322. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc	Protospacer
* ******.***************. . * 

323. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc	Protospacer
.** *.. *** ***************** 

324. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacaccga	Protospacer
******.*************.**.*  .*.

325. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacgccga	Protospacer
******.*************.**.*  .*.

326. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccatccggcacaccgccagcggcaccggca	Protospacer
**. **** **************.***  .

327. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccatccggcacaccgccagcggcaccggca	Protospacer
**. **** **************.***  .

328. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg	Protospacer
 ******** **.***********   .**

329. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
accgcatcgaccccgccagcggcgccgtga	Protospacer
 * **   *** *****************.

330. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacgccga	Protospacer
******.*************.**.*  .*.

331. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacgccga	Protospacer
******.*************.**.*  .*.

332. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccatccggcacaccgccagcggcaccggca	Protospacer
**. **** **************.***  .

333. spacer 2.4|366692|27|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

aagccgcccgagttcgcgagaccgaag	CRISPR spacer
tgaccgcccgagttcgcgagacgttgg	Protospacer
 ..*******************   .*

334. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

335. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

336. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

337. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

338. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

339. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

340. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

341. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

342. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

343. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

344. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

345. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

346. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

347. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

348. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

349. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

350. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc	Protospacer
 * ****************** *.***   

351. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

352. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

353. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

354. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

355. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

356. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

357. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

358. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

359. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

360. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

361. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

362. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

363. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggaccggcccgctggtcggccccggctt	Protospacer
**. .******.**********.*****  

364. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gctgggcggcctgctggtcggctggggcgg	Protospacer
    * *****************  *****

365. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

366. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

367. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

368. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

369. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

370. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

371. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt	Protospacer
 ************* ********.*. *  

372. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

373. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

374. spacer 4.13|927138|30|NZ_CP023630|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

375. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

376. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

377. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

378. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

379. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

380. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

381. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

382. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

383. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

384. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

385. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

386. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

387. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

388. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

389. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

390. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

391. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

392. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

393. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

394. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

395. spacer 4.13|927138|30|NZ_CP023630|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

396. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

397. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

398. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

399. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

400. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

401. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

402. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

403. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

404. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

405. spacer 4.13|927138|30|NZ_CP023630|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

406. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

407. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

408. spacer 4.13|927138|30|NZ_CP023630|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

409. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

410. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

411. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

412. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

413. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

414. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

415. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

416. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

417. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

418. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

419. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

420. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

421. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

422. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

423. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

424. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

425. spacer 4.13|927138|30|NZ_CP023630|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

426. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

427. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

428. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

429. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

430. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

431. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

432. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

433. spacer 4.13|927138|30|NZ_CP023630|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
acacgccgccctgctggtcggcttaggtcg	Protospacer
  ****** **************. **. *

434. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc	Protospacer
 .****** **************. * ** 

435. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agacgccggcctgctgttcggcctcgaccc	Protospacer
 *************** *****..**.*  

436. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggctcggcctgctgctcggcttcggcga	Protospacer
**.  .********** ******.*****.

437. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
gtcggccggcctgctggtcggcgcccggct-	Protospacer
    ****************** .*****  

438. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctgctggtcgacttcatccc	Protospacer
***** **************.**.*. *  

439. spacer 4.13|927138|30|NZ_CP023630|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

440. spacer 4.13|927138|30|NZ_CP023630|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac	Protospacer
**   **************** *.****. 

441. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga	Protospacer
.******* *************   * **.

442. spacer 4.13|927138|30|NZ_CP023630|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

443. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

444. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

445. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg	Protospacer
*..  .*.*************** ******

446. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

447. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

448. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

449. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

450. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

451. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

452. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

453. spacer 4.15|927234|30|NZ_CP023630|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

454. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

455. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

456. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

457. spacer 4.15|927234|30|NZ_CP023630|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
actgctgtccggctccggcggca-tgatgtc	Protospacer
 *******.*************. **..*  

458. spacer 4.15|927234|30|NZ_CP023630|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccggccttcgacttcggcggcgctggcgg	Protospacer
 *.* . ****.**.***************

459. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

460. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gttcctccacggttccggcggcgctggcgg	Protospacer
 .* ** . ***.*****************

461. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

462. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

463. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

464. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

465. spacer 4.17|927324|36|NZ_CP023630|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg	Protospacer
  **************** *********. * * **

466. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc-	Protospacer
****** **** *************** ..** . 

467. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc--	Protospacer
*.*********.********* *****.  .***  

468. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc-	Protospacer
 ** *************** ******* *. **. 

469. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta----	CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac	Protospacer
****** ************* ****    * ***    

470. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

471. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

472. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc--	Protospacer
 *.********.******** *******  .***  

473. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc--	Protospacer
*********** *****.******* * *  .**  

474. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat	Protospacer
 .******** ********.***** **.*** * 

475. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc-	Protospacer
.* ******** ******** ****** * ***. 

476. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

477. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

478. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

479. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

480. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

481. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

482. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

483. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

484. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

485. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

486. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct-	Protospacer
.* ***.****.*************** *  *** 

487. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg-tggcta	CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt-	Protospacer
**.***** ***************.*.. *** * 

488. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

489. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt	Protospacer
 * ***************** .*** ****** . 

490. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

491. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc--	Protospacer
 **.****************.****.  * ****  

492. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac	Protospacer
 * ***************** .*** *****..* 

493. spacer 6.9|1212352|37|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac	Protospacer
******************..*******  . ***.**

494. spacer 7.1|1572153|28|NZ_CP023630|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
agcacccggggtgccgtcgttgccggcg	Protospacer
. ..** ********.*********** 

495. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc	Protospacer
. *  **** *********.********** 

496. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg	Protospacer
**. ***.************ ******. *.

497. spacer 8.3|2088362|30|NZ_CP023630|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

498. spacer 8.3|2088362|30|NZ_CP023630|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

499. spacer 8.3|2088362|30|NZ_CP023630|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

500. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

501. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

502. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atccgccatttcaccgccgttgccgacgccg	Protospacer
* *  ***.**************** **.*.

503. spacer 1.3|333787|30|NZ_CP023630|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733

ccggcggagccgaagagcaagccgccgttc	CRISPR spacer
agcacgaagccgaagagaaagccgccgatg	Protospacer
   .**.********** ********* * 

504. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
tcaccctggacaccgcctgcggcgccggac	Protospacer
.*. ** ********** ********* . 

505. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccggcagcggcacgaaca	Protospacer
******.******** *******.* .  .

506. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga	Protospacer
.**     **************** ****.

507. spacer 1.12|334267|30|NZ_CP023630|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcg----gcgccgtgg	CRISPR spacer
agggccgggacaccgcccgcggccagcgct----	Protospacer
  *************** ***    ****.    

508. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca	Protospacer
  * **.*****.**************** *..

509. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

510. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact	Protospacer
* ********.**********.**** .**.. 

511. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc	Protospacer
 ***************** ** ***.* *  * 

512. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

513. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccggcctgctggtcgggctgacctc	Protospacer
********************* .. . *  

514. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

515. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

516. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

517. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc	Protospacer
*  .   *** ****************** 

518. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

519. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct	Protospacer
 * *************  ********    

520. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

521. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcaccgccctgctgatcggctccggcat	Protospacer
   *.*** *******.***********. 

522. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

523. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

524. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt	Protospacer
 . ******************. ***  * 

525. spacer 4.13|927138|30|NZ_CP023630|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc	Protospacer
 *  ..************** * ****** 

526. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

527. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

528. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

529. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

530. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

531. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

532. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgaccatctcggctccgacggcgctggcgc	Protospacer
*   *  .*********.*********** 

533. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

534. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccaccccgcggctccggaggcgctggcgg	Protospacer
 *..*. . ********* ***********

535. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

536. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

537. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

538. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

539. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

540. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

541. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

542. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

543. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

544. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

545. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

546. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgatcggctccggcgccggcttctc	Protospacer
******* ************ ** .  *  

547. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgtgcggctccggcggcaaccccga	Protospacer
 ******* *************. .  **.

548. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgatgttcgactccggcggcgacgcacc	Protospacer
**** ******.*********** .*    

549. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg	Protospacer
 *  *   .************** ******

550. spacer 4.17|927324|36|NZ_CP023630|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc	Protospacer
..* . ************.******* ******** 

551. spacer 4.17|927324|36|NZ_CP023630|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

552. spacer 4.17|927324|36|NZ_CP023630|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

553. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt--	Protospacer
 . ***************** ******  *.**.  

554. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc--	Protospacer
  *****************. ******  .** *  

555. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc--	Protospacer
 **********.** **********.*   .***  

556. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc	Protospacer
 *.******.**********.******  .**.*  

557. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

558. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc	Protospacer
 ****** ******.************ .**.  

559. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

560. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

561. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg	Protospacer
  ******* ** **************  * **.

562. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

563. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

564. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg	Protospacer
 ******** *****.***********   * *.

565. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc-	Protospacer
 .**********.** *********** .* **. 

566. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

567. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

568. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

569. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

570. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

571. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

572. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

573. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

574. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

575. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

576. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

577. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

578. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

579. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

580. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

581. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg----gtggcta	CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg----	Protospacer
 * ******** *******.*******    ***    

582. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc	Protospacer
*************** .********   * **..  

583. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcg-gcaacggcggcgccggcgggtggcta	CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc	Protospacer
  * .*** ** ******** ************. 

584. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

585. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

586. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

587. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

588. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

589. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

590. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

591. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

592. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

593. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

594. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

595. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

596. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

597. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

598. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

599. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

600. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

601. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg	Protospacer
 .***************** *.***** * * *.

602. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

603. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

604. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc--	Protospacer
 .*********.********* *****  ..***  

605. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

606. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

607. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat-	Protospacer
  .*******.********* ****** ** * * 

608. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca	Protospacer
.******************  **** * ..**.*

609. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat	Protospacer
*  ******** *******.***** **.**..* 

610. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca	Protospacer
 *.********.******** ******..* *.*

611. spacer 6.9|1212352|37|NZ_CP023630|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc	Protospacer
 ********.* **************** . ***..*

612. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc	Protospacer
.   ********.******.*********  

613. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

614. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

615. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

616. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

617. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

618. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

619. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc	Protospacer
.   **************** *.***** * 

620. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

621. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgc--gccttgcccgccgttgccgccggca	CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg	Protospacer
  ..**  **********  *********** .

622. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
attgccgccctggccgccgttgccgccgatc	Protospacer
* *  ****.** ***************.. 

623. spacer 8.3|2088362|30|NZ_CP023630|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

624. spacer 8.3|2088362|30|NZ_CP023630|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

625. spacer 12.24|3122328|29|NZ_CP023630|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724

tccgcgaaattcactgcgcgttattcaag	CRISPR spacer
gacgcgaaatacactgcgctttattttca	Protospacer
  ******** ******** *****.  .

626. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg	Protospacer
   *********** ********** **. .

627. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

628. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

629. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

630. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

631. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

632. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

633. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

634. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

635. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

636. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct	Protospacer
 .*. *. ***********.********** 

637. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

638. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

639. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

640. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca	Protospacer
  ** . .****.*******.**********

641. spacer 13.7|3741073|31|NZ_CP023630|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt	Protospacer
* ************** **** *** * .. 

642. spacer 1.13|334315|39|NZ_CP023630|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769

--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc	CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag	Protospacer
  ***. *.  **************** *** *******  

643. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc	Protospacer
  *.  .******************.*****. 

644. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

645. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

646. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

647. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

648. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

649. spacer 3.1|691992|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

650. spacer 4.13|927138|30|NZ_CP023630|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggcgccggcctgctggtcggactgctcac	Protospacer
**.****************** ..   *. 

651. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

652. spacer 4.15|927234|30|NZ_CP023630|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

653. spacer 4.17|927324|36|NZ_CP023630|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc	Protospacer
** ******** *************** * ..  * 

654. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc--	Protospacer
 . ****************. ******  ..***  

655. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc--	Protospacer
 . ****************  *****  *..***  

656. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc	Protospacer
 ************ ************  .. *  

657. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc--	Protospacer
 . ****.****.*************  * .***  

658. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc	Protospacer
 * ****** * ***************  *  * 

659. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

660. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

661. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

662. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

663. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

664. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa	Protospacer
 *.******* *********.****** ..*  *

665. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc	Protospacer
 .********* ******** ******* *  . 

666. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag	Protospacer
  ********** *************  *. * .

667. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

668. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat	Protospacer
*.********* *********** *** .. *  

669. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

670. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

671. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

672. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

673. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc	Protospacer
 * *********.******.*******   * * 

674. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

675. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

676. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga	Protospacer
  ****************** *.****  *   *

677. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

678. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

679. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

680. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

681. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

682. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

683. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

684. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

685. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

686. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

687. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

688. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

689. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

690. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

691. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

692. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

693. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg	Protospacer
*.****************** ***.** *  ...

694. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

695. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

696. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

697. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

698. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

699. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

700. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

701. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac	Protospacer
 *********  ************* .*. **  

702. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

703. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc--	Protospacer
   *******.********.******  **..**  

704. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt	Protospacer
* .*******.* **************  .**  

705. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

706. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg	Protospacer
 * ****************  ****** *   *.

707. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

708. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga	Protospacer
*  *******. ***************  .*  *

709. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

710. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

711. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc--	Protospacer
 .*****************.*** **  ...***  

712. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

713. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

714. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

715. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

716. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

717. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

718. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

719. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc--	Protospacer
 . ****************. *****  **..**  

720. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

721. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc	Protospacer
*. ****************. ****** *  *. 

722. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac	Protospacer
 * **** *********** *******  **   

723. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

724. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

725. spacer 6.9|1212352|37|NZ_CP023630|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc	Protospacer
 ** **************** ******  *.* *  *

726. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg	Protospacer
.... ****.***************** .*.

727. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
tggcccgccttgccctccattgccgccggac	Protospacer
 . . ********** **.**********  

728. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
atccttgccttgaccgccgttgccgccgctg	Protospacer
* .. .****** *************** ..

729. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accccagccctgcccgccgttgccgccgctc	Protospacer
* ..  ***.****************** . 

730. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc	Protospacer
. ******** ********* ****   .* 

731. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accggcaccttgcccgccattgccgccatgt	Protospacer
* . **.***********.********.   

732. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc	Protospacer
 .   *******.******* *******.* 

733. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
agcgtggccttggccgccgttgccggcggtc	Protospacer
*..   ****** ************ ***. 

734. spacer 13.5|3740932|34|NZ_CP023630|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg	Protospacer
.**    .********.**** ***********.

735. spacer 13.5|3740932|34|NZ_CP023630|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg	Protospacer
*. . *. *****.***** *************.

736. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

737. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

738. spacer 2.6|366827|33|NZ_CP023630|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

739. spacer 4.2|926634|39|NZ_CP023630|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744

cggcgcgggcggggccgtcacgggaaccggcgccaccgg	CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc	Protospacer
*.  * ** ********.**************** *   

740. spacer 4.17|927324|36|NZ_CP023630|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac	Protospacer
... .  ************************.**. 

741. spacer 4.17|927324|36|NZ_CP023630|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc	Protospacer
* . . ************ ******** ****  * 

742. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcg-----ggtggcta	CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt-----	Protospacer
   *******.********** ****     ***     

743. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc	Protospacer
*. ***************..*******  .  * 

744. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc	Protospacer
. ********* ********* ***** . * . 

745. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg	Protospacer
 ********** ***** ******** *  ....

746. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc	Protospacer
  ********* *** ***********. *  . 

747. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact	Protospacer
. ********. ***************  *. . 

748. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

749. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga	Protospacer
 .********* *******.*******      *

750. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

751. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

752. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

753. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

754. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta-------	CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc	Protospacer
*****.****** *********       **.**       

755. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

756. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

757. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag	Protospacer
 * **********.*****.*******.  *  .

758. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

759. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

760. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

761. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

762. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

763. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

764. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

765. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

766. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

767. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc	Protospacer
 .*****..*****************  *  .* 

768. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

769. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

770. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

771. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

772. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

773. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

774. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

775. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

776. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

777. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

778. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

779. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

780. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

781. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

782. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

783. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

784. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

785. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

786. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

787. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg	Protospacer
*  ********.*********.*****  *  ..

788. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

789. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

790. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

791. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

792. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

793. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

794. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

795. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc	Protospacer
  ********.********* *****  . **  

796. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

797. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

798. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

799. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

800. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

801. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

802. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag	Protospacer
 * ** ***** ***************   *  .

803. spacer 6.9|1212352|37|NZ_CP023630|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

804. spacer 6.9|1212352|37|NZ_CP023630|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

805. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

806. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg	Protospacer
  .. ****** *******.********  .

807. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggccagaacttccccgctgttgccgccggca	Protospacer
..... . *** *****.*************

808. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

809. spacer 7.10|1572768|31|NZ_CP023630|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc	Protospacer
...   ****** ************ ***. 

810. spacer 7.13|1573017|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706

gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca	Protospacer
 . .. .*******.***************.**.

811. spacer 11.9|3119730|35|NZ_CP023630|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

acttgcgcgcacaacgcatccgccatccacggggc	CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt	Protospacer
...  **********.***.**********. **.

812. spacer 12.20|3123201|34|NZ_CP023630|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706

tagaaggcgatcactggaagcacggcgcttgcga	CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac	Protospacer
 . ********** ******* ***** . **. 

813. spacer 12.36|3123205|34|NZ_CP023630|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706

tagaaggcgatcactggaagcacggcgcttgcga	CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac	Protospacer
 . ********** ******* ***** . **. 

814. spacer 13.5|3740932|34|NZ_CP023630|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc	Protospacer
   . *  ***** **************** ** 

815. spacer 13.5|3740932|34|NZ_CP023630|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

816. spacer 13.5|3740932|34|NZ_CP023630|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

817. spacer 13.5|3740932|34|NZ_CP023630|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

818. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg	Protospacer
 . ****************. ******   *...

819. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg	Protospacer
  .********.******** ******.   *..

820. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

821. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

822. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg	Protospacer
 .******** ******* ********  .  ..

823. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag	Protospacer
  .********* ********** ***  . * .

824. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg	Protospacer
 .  *************** *****.**  * ..

825. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg	Protospacer
 .. ******.*.***************  * ..

826. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc	Protospacer
*****.****** ***********  .    *. 

827. spacer 6.5|1212136|40|NZ_CP023630|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725

tgccggcggcgccggcggtgtcggcggacccgccgggttg	CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc	Protospacer
 *..******.***************** *** .*.  * 

828. spacer 13.5|3740932|34|NZ_CP023630|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc	Protospacer
  ...*.  **.********.************ 

829. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg	Protospacer
..********.****** ********   . ...

830. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgc-----cggcgggtggcta	CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg----	Protospacer
 ***** ..*. ***** ***     **** ****    

831. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga-----	Protospacer
     ***** ****. ***** . *** **.*      

832. spacer 6.3|1212031|34|NZ_CP023630|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga-----	Protospacer
     ***** ****. **.** . *** **.*      

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 889015 : 947565 54 Burkholderia_virus(16.67%) transposase,tRNA,bacteriocin,protease NA
DBSCAN-SWA_2 2941130 : 2976470 41 Tupanvirus(11.11%) integrase,tRNA,capsid,transposase,head,terminase,protease attL 2969905:2969932|attR 2980887:2980914
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP023630.1|WP_009938544.1|2960020_2962357_-|PE-family-protein 2960020_2962357_- 778 aa aa NA NA NA 2941130-2976470 yes