1. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP034347 (Roseovarius sp. MME-070 plasmid pMME07001, complete sequence) position: , mismatch: 3, identity: 0.903
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgacggcaatgacaatatcggcggcggcacc Protospacer
** *****.*********************
2. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcaacgacacgatctacggcggcgga Protospacer
.*****************.* ********
3. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 5, identity: 0.839
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
gggcggcaacgacacgatttgcggcggctct Protospacer
* ***************** ******* *.
4. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 5, identity: 0.839
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
tatcggcaacgacacgatctacggcggcggc Protospacer
*..***************.* ******** *
5. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031116 (Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cggcggcaacgacacgatctacggcggcgac Protospacer
.* ***************.* ******** *
6. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP045413 (Roseovarius sp. THAF8 plasmid pTHAF8_c, complete sequence) position: , mismatch: 5, identity: 0.839
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
tggtggcaacgacacgatgaccggcggcgcg Protospacer
** .************** **********
7. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.839
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgtcggcaacgacacgctgtccggcggcgac Protospacer
.*.************* * ********** *
8. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
cgcggg-caacgacaatatcggcggcggcacc CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc Protospacer
***.* *.*****.********* *******
9. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
cgcggg-caacgacaatatcggcggcggcacc CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc Protospacer
***.* *.*****.********* *******
10. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
cgcggg-caacgacaatatcggcggcggcacc CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc Protospacer
***.* *.*****.********* *******
11. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
cgcggg-caacgacaatatcggcggcggcacc CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc Protospacer
***.* *.*****.********* *******
12. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
cgcggg-caacgacaatatcggcggcggcacc CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc Protospacer
***.* *.*****.********* *******
13. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 5, identity: 0.839
cgcggg-caacgacaatatcggcggcggcacc CRISPR spacer
-gcggaccaaagacaatgtcggcggcggcagc Protospacer
****. *** ******.************ *
14. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
cgcggg-caacgacaatatcggcggcggcacc CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc Protospacer
***.* *.*****.********* *******
15. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
cgcggg-caacgacaatatcggcggcggcacc CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc Protospacer
***.* *.*****.********* *******
16. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.839
cgcggg-caacgacaatatcggcggcggcacc CRISPR spacer
-gcggaccaaagacaatgtcggcggcggcagc Protospacer
****. *** ******.************ *
17. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 6, identity: 0.806
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgatttacggcggccaa Protospacer
.******.************ *******
18. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031958 (Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cggtggcaacgacatgatttccggtggcgca Protospacer
.* .**********.*********.*****
19. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.806
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
tgccggcaacgacacgatctacggcgcgatc Protospacer
******************.* ***** ..*
20. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.806
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
catcggcaacgacacgatctacggcggcggc Protospacer
...***************.* ******** *
21. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 6, identity: 0.806
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
tgccggcaatgacacgattgccggctacgat Protospacer
*********.********* ***** .** .
22. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.806
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
ggacggcaacgacacgattcgcggcggctct Protospacer
* ****************. ******* *.
23. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgtcggcaaggacaatagcggcggcggcgac Protospacer
**. ***** ******* **********. *
24. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
ccccgtcaatgagaatatcggcggcggcaca Protospacer
* * * ***.** *****************
25. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
ccccgtcaatgagaatatcggcggcggcaca Protospacer
* * * ***.** *****************
26. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgttggcaaggacaataccggcggcggcgac Protospacer
**. ***** *******.**********. *
27. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
28. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
29. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
30. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
31. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
32. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
33. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
34. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
35. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
36. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
37. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
38. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
39. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
40. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc Protospacer
** * ** ******.*************.*
41. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
gacgggcaacgacgtgatttccggcggcgat Protospacer
.* *********..************** .
42. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
tgccggcgacgacacgattttcggccaggga Protospacer
*******.************.**** . *
43. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcaacgacacgcttttcggcgaggag Protospacer
.*************** ***.*****. *
44. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
ggccggcaacgacacgatctacggcgcgatc Protospacer
*****************.* ***** ..*
45. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcaacgacacgcttttcggcgaggag Protospacer
.*************** ***.*****. *
46. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
ggccggcaatgacacgatttcgggcgcgggt Protospacer
********.*********** **** * .
47. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgacggcaacgacacgctttctggcggcaag Protospacer
.* ************* ****.******.
48. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
aaccggcaacgacacgatcttcggcgaggac Protospacer
.****************.*.*****. * *
49. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
aaccggcaacgacacgatcttcggcgaggac Protospacer
.****************.*.*****. * *
50. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
tgccggcaacgacaggatttacgaagacgtg Protospacer
************** ***** **. *.**.
51. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 7, identity: 0.774
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
tgccggcaacgacaggatttacgaagacgtg Protospacer
************** ***** **. *.**.
52. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP046165 (Vibrio sp. THAF191c plasmid pTHAF191c_d, complete sequence) position: , mismatch: 7, identity: 0.774
ggatggggccgacacgatttccggtgatgat CRISPR spacer
gataagcgccgacacggtttccggtgatgct Protospacer
*. .* *********.************ *
53. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP046068 (Vibrio sp. THAF191d plasmid pTHAF191d_d, complete sequence) position: , mismatch: 7, identity: 0.774
ggatggggccgacacgatttccggtgatgat CRISPR spacer
gataagcgccgacacggtttccggtgatgct Protospacer
*. .* *********.************ *
54. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP045358 (Vibrio sp. THAF64 plasmid pTHAF64_c, complete sequence) position: , mismatch: 7, identity: 0.774
ggatggggccgacacgatttccggtgatgat CRISPR spacer
gataagcgccgacacggtttccggtgatgct Protospacer
*. .* *********.************ *
55. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 7, identity: 0.774
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
caacgacaacgacacgctggacggcggcgac Protospacer
*********.********* **** ...* *
56. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP024425 (Paracoccus yeei strain TT13 plasmid pTT13-3, complete sequence) position: , mismatch: 7, identity: 0.774
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
caacggcaatgacacgctgtatggcggggtc Protospacer
*****.***************.** .. *.*
57. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
caacggcaatgacacgctgtatggcggggtc Protospacer
*****.***************.** .. *.*
58. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 7, identity: 0.774
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
caacggcaatgacacgctgtatggcggggtc Protospacer
*****.***************.** .. *.*
59. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.774
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
aaacaacaacgacacgctgtacggcggggcc Protospacer
***.****.************** .. ***
60. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
gaacaacaacgacacgctgtacggtggggcc Protospacer
***.****.************** .. ***
61. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP034347 (Roseovarius sp. MME-070 plasmid pMME07001, complete sequence) position: , mismatch: 7, identity: 0.774
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cggcggccatgacaatatcggcggcggcctg Protospacer
** *** *.****************** .
62. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_010679 (Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence) position: , mismatch: 7, identity: 0.774
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cacgggcgacgacaatgtcggcggcgcccat Protospacer
*.*****.********.********* * .
63. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 7, identity: 0.774
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
catcggcaaggacaataccggcggcggcgac Protospacer
*.. ***** *******.**********. *
64. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.774
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
catcggcaaggacaataccggcggcggcgac Protospacer
*.. ***** *******.**********. *
65. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.774
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgtcggcaaggacaataccggcggcggcgat Protospacer
**. ***** *******.**********. .
66. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.774
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgtcggcaaggacaataccggcggcggcgat Protospacer
**. ***** *******.**********. .
67. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP013071 (Sphingobium indicum B90A plasmid pSRL1, complete sequence) position: , mismatch: 7, identity: 0.774
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
caagtccaacgagaatagcggcggcggcaac Protospacer
*. * ****** **** *********** *
68. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_AP017658 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_4, complete sequence) position: , mismatch: 7, identity: 0.774
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
caagtccaacgagaatagcggcggcggcaac Protospacer
*. * ****** **** *********** *
69. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 7, identity: 0.774
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
caagtccaacgagaatagcggcggcggcaac Protospacer
*. * ****** **** *********** *
70. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.774
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
caagtccaacgagaatagcggcggcggcaac Protospacer
*. * ****** **** *********** *
71. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
ccggggcaacgacacgatgaccggcggcgag Protospacer
. ************** *********
72. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcaatgacacgattgccggctatgat Protospacer
.********.********* ***** ..* .
73. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
ccggggcaacgacacgatgaccggcggcgag Protospacer
. ************** *********
74. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021116 (Rhodobacteraceae bacterium strain G7 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
ctggggcaacgacacggtttacggcggcgat Protospacer
. ************.*** ******** .
75. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
76. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
77. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
78. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
79. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
caccggcaacgacacgctttacggcgcaatc Protospacer
..************** *** ***** ..*
80. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
81. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
82. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
caccggcaacgacacgctttacggcgcaatc Protospacer
..************** *** ***** ..*
83. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
84. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
85. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
86. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
87. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
88. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
89. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
90. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
91. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
92. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
93. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
94. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
95. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
96. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
97. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcgacgacacgattttcggcaaggga Protospacer
.******.************.****.. *
98. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgtccgcatcgacacggtttccggcggccgg Protospacer
.*.* *** *******.***********
99. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KY270852 (Enterobacter cloacae strain T5282 plasmid pT5282-mphA, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
100. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KY270851 (Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
101. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
102. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KX810825 (Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
103. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
104. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KM083064 (Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
105. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KM670336 (Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
106. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KP276584 (Escherichia coli strain 39R861 plasmid p39R861-4, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
107. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
108. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to LT221037 (Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
109. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
110. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
111. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
112. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
113. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_009651 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
114. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
115. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_012885 (Aeromonas hydrophila plasmid pRA1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
116. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_012886 (Escherichia coli plasmid pRAx, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
117. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP017059 (Citrobacter freundii strain SL151 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
118. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP026241 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-e790, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
119. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
120. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
121. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_008612 (Photobacterium damselae subsp. piscicida plasmid pP99-018, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
122. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MT077884 (Escherichia coli plasmid p33, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
123. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MT077886 (Escherichia coli plasmid p39, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
124. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_LS992178 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
125. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_LT904892 (Salmonella enterica subsp. enterica serovar Typhi strain 80-2002 plasmid 2) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
126. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
127. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
128. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
129. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP042646 (Escherichia coli strain NCYU-21-79 plasmid pNCYU-21-79-1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
130. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
131. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to LC549808 (Klebsiella pneumoniae VNCKp83 plasmid pVNCKp83 DNA, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
132. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_008613 (Photobacterium damselae subsp. piscicida plasmid pP91278, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
133. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031568 (Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
134. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014524 (Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
135. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
136. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
137. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
138. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
139. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022696 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
140. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022697 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
141. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028958 (Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
142. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
143. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
144. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052554 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
145. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
146. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_012919 (Photobacterium damselae subsp. piscicida plasmid pP9014 DNA, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
147. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP040859 (Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
148. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021168 (Enterobacter hormaechei strain 388 plasmid p388, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
149. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
150. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
151. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
152. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP038468 (Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
153. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
154. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
155. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP035277 (Citrobacter freundii strain R17 plasmid pCFR17_1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
156. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021163 (Enterobacter hormaechei strain 234 plasmid p234, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
157. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP030186 (Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
158. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
159. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP009116 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
160. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP040696 (Citrobacter freundii strain R47 plasmid pR47-309, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
161. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
162. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052289 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
163. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_AP019668 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
164. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP042552 (Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
165. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
166. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP050162 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
167. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
168. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MK933279 (Enterobacter hormaechei strain SCNJ07 plasmid pMCR-SCNJ07, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
169. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
170. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP018451 (Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
171. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
172. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP043927 (Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
173. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP040362 (Klebsiella pneumoniae strain R50 plasmid pR50-74, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
174. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021853 (Proteus mirabilis strain AR_0156 plasmid unitig_1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
175. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
176. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
177. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032212 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
178. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
179. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
180. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_012556 (Enterobacter cloacae plasmid pEC-IMPQ, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
181. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_012555 (Enterobacter cloacae plasmid pEC-IMP, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
182. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014295 (Klebsiella pneumoniae strain KP38731 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
183. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP042579 (Enterobacter kobei strain C16 plasmid pC16_001, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
184. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
185. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP011610 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-135, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
186. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
187. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
188. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014775 (Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
189. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
190. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pCTXM27_020046, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
191. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
192. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP026018 (Klebsiella pneumoniae strain 13190 plasmid p13190-2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
193. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032176 (Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
194. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to LC225353 (Photobacterium damselae subsp. piscicida plasmid pP0855 DNA, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
195. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022533 (Enterobacter hormaechei strain MS7884A plasmid pMS7884A, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
196. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
197. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_AP018145 (Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
198. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052471 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-3, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
199. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029717 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
200. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
201. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP042489 (Enterobacter hormaechei strain C15 plasmid pC15_001, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
202. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_LT985275 (Escherichia coli strain R71 plasmid RCS70_p, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
203. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP044120 (Raoultella planticola strain S25 plasmid pS25-68, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
204. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP033103 (Enterobacter hormaechei strain L51 plasmid pEHZJ1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
205. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN218814 (Klebsiella pneumoniae strain KB-2017-139 plasmid p101_srb, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
206. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MH829594 (Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
207. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
208. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MK124610 (Citrobacter werkmanii strain Cb_CB1_SE1_NDM_08_2017 plasmid pCB1_SE1_NDM, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
209. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP020091 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
210. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
211. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MF344580 (Enterobacter cloacae strain 30860 plasmid p30860-HI2, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
212. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MH477637 (Citrobacter freundii strain 1509-02085 plasmid p02085-tetA, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
213. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MH399264 (Enterobacter cloacae strain RJ702 plasmid pIMP26, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
214. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP049047 (Enterobacter hormaechei strain Y233 plasmid pIHI2-233, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
215. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
216. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP018448 (Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
217. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KY978628 (Cronobacter sakazakii strain 505108 plasmid p505108-MDR, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
218. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
219. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MF788071 (Raoultella ornithinolytica strain 23141 plasmid p23141-3, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
220. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031723 (Enterobacter hormaechei strain WCHEH020038 plasmid p2_020038, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
221. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028814 (Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
222. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
223. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 8, identity: 0.742
ggatggggccgacacgatttccggtgatgat CRISPR spacer
taccgatgcctacacgctttccggtgatgat Protospacer
. .*. *** ***** **************
224. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
gaacaacaacgacacgctgtacggtggggct Protospacer
***.****.************** .. **.
225. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 8, identity: 0.742
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
gaacgacaatgagacgctctacggtgctatc Protospacer
*********** ***** ***** . *..*
226. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.742
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
gaacgacaatgagacgctctacggtgctatc Protospacer
*********** ***** ***** . *..*
227. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
gaacaacaacgacacgctgtacggtggggct Protospacer
***.****.************** .. **.
228. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021832 (Sinorhizobium meliloti strain HM006 plasmid accessoryA, complete sequence) position: , mismatch: 8, identity: 0.742
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
gaacgacaatgagacgctctacggtgctatc Protospacer
*********** ***** ***** . *..*
229. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NC_019313 (Sinorhizobium meliloti plasmid pHRC017, complete sequence) position: , mismatch: 8, identity: 0.742
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
gaacgacaatgagacgctctacggtgctatc Protospacer
*********** ***** ***** . *..*
230. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 8, identity: 0.742
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
gctcggcaacgacagtctcggcggcggcgac Protospacer
. **********.* ***********. *
231. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP051182 (Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence) position: , mismatch: 8, identity: 0.742
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
tgaaaaccacgacatgatcggcggcggcacc Protospacer
.* ...* ****** ***************
232. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 8, identity: 0.742
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cttctgcaacggcaatgtcggcggcggcccg Protospacer
* . ******.****.*********** *
233. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 8, identity: 0.742
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cttctgcaacggcaatgtcggcggcggcccg Protospacer
* . ******.****.*********** *
234. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 8, identity: 0.742
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cgcggccaacgccaatatcggcgctgcccgt Protospacer
***** ***** *********** .* * .
235. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.71
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
ctccggcaacgacgcgattaccggcaaccag Protospacer
. ***********.***** *****..*
236. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.71
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
cgccggcaacgacgcgattaccggcaatcag Protospacer
.************.***** *****...
237. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 9, identity: 0.71
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
agatggcaacgacctgatttccggcggtctg Protospacer
* .********* .************. .
238. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 9, identity: 0.71
tgccggcaacgacacgatttccggcggcgcc CRISPR spacer
ggctggcaacgacacgctttccggtacaacg Protospacer
**.************ *******.. .*
239. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 9, identity: 0.71
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
gaacggcaacgacacgctgtacggcgcgatc Protospacer
****.***.************** . ..*
240. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 9, identity: 0.71
caacgacaatgacacgctgtacgggaatgcc CRISPR spacer
gaacggcaacgacacgctgtacggcgcgatc Protospacer
****.***.************** . ..*
241. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_010679 (Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence) position: , mismatch: 9, identity: 0.71
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
ggcggccaacaacaatatcggcggctcggtg Protospacer
**** ****.************** ..
242. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 9, identity: 0.71
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
cttccgcaccgtcaatatcggcggcggccag Protospacer
* . *** ** ****************
243. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.71
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
ccaccatgacgaccatatcggcggctgcacc Protospacer
* ...***** *********** *****
244. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_048106 (Synechococcus phage S-CBWM1, complete genome) position: , mismatch: 10, identity: 0.677
ggatggggccgacacgatttccggtgatgat CRISPR spacer
tcttgtggccgacatgatttccggtgtctga Protospacer
** ********.*********** . .
245. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 10, identity: 0.677
cgcgggcaacgacaatatcggcggcggcacc CRISPR spacer
aaagggcaacgacaaaatcggcagcgctttt Protospacer
. ************ ******.*** . ..