Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023741 Sphingobium yanoikuyae strain S72 chromosome, complete genome 2 crisprs csa3,WYL,cas3,DEDDh,DinG 1 4 7 0

Results visualization

1. NZ_CP023741
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023741_1 339529-339714 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023741_2 339961-340037 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP023741.1 338880-338910 1 0.968

1. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to position: 338880-338910, mismatch: 1, identity: 0.968

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgcgggcaacgacaatatgggcggcggcacc	Protospacer
****************** ************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP034347 Roseovarius sp. MME-070 plasmid pMME07001, complete sequence 55053-55083 3 0.903
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 157895-157925 5 0.839
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1412001-1412031 5 0.839
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 68750-68780 5 0.839
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP031116 Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence 137691-137721 5 0.839
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP045413 Roseovarius sp. THAF8 plasmid pTHAF8_c, complete sequence 12748-12778 5 0.839
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 116243-116273 5 0.839
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 141024-141054 5 0.839
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 142098-142128 5 0.839
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 135150-135180 5 0.839
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 135151-135181 5 0.839
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 141038-141068 5 0.839
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 218440-218470 5 0.839
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 141036-141066 5 0.839
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 141035-141065 5 0.839
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 719221-719251 5 0.839
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 131094-131124 6 0.806
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP031958 Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence 63115-63145 6 0.806
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 490826-490856 6 0.806
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 142051-142081 6 0.806
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 109983-110013 6 0.806
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1742262-1742292 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 247499-247529 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 155008-155038 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 155007-155037 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 57915-57945 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1267221-1267251 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 924065-924095 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1251856-1251886 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1224186-1224216 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1224177-1224207 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1267340-1267370 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1267323-1267353 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1267316-1267346 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1321707-1321737 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1192153-1192183 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1191250-1191280 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1192145-1192175 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1191501-1191531 6 0.806
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1192136-1192166 6 0.806
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 283148-283178 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1069652-1069682 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1250548-1250578 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 160955-160985 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 68885-68915 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 169948-169978 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 170171-170201 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 76516-76546 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 76624-76654 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 808610-808640 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 186052-186082 7 0.774
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP046165 Vibrio sp. THAF191c plasmid pTHAF191c_d, complete sequence 90356-90386 7 0.774
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP046068 Vibrio sp. THAF191d plasmid pTHAF191d_d, complete sequence 85821-85851 7 0.774
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP045358 Vibrio sp. THAF64 plasmid pTHAF64_c, complete sequence 43255-43285 7 0.774
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 614793-614823 7 0.774
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP024425 Paracoccus yeei strain TT13 plasmid pTT13-3, complete sequence 19727-19757 7 0.774
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 298355-298385 7 0.774
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 58556-58586 7 0.774
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 519799-519829 7 0.774
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 815318-815348 7 0.774
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP034347 Roseovarius sp. MME-070 plasmid pMME07001, complete sequence 52705-52735 7 0.774
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NC_010679 Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence 86822-86852 7 0.774
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 54351-54381 7 0.774
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1416352-1416382 7 0.774
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2102792-2102822 7 0.774
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2170736-2170766 7 0.774
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP013071 Sphingobium indicum B90A plasmid pSRL1, complete sequence 15762-15792 7 0.774
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_AP017658 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_4, complete sequence 91836-91866 7 0.774
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 133086-133116 7 0.774
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 494161-494191 7 0.774
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 453071-453101 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 110418-110448 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 46604-46634 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021116 Rhodobacteraceae bacterium strain G7 plasmid unnamed2, complete sequence 145103-145133 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 660491-660521 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1076267-1076297 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1045092-1045122 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 645485-645515 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 118736-118766 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1142488-1142518 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 242529-242559 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 114789-114819 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 653550-653580 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 643358-643388 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 647005-647035 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 997079-997109 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 904783-904813 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 763886-763916 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 567537-567567 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 283343-283373 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1432149-1432179 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 364255-364285 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 804091-804121 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 667164-667194 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1216845-1216875 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 989528-989558 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1076271-1076301 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 426401-426431 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_KY270852 Enterobacter cloacae strain T5282 plasmid pT5282-mphA, complete sequence 163375-163405 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_KY270851 Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence 118018-118048 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 MN175386 Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence 41655-41685 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_KX810825 Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence 82228-82258 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 245635-245665 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_KM083064 Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence 4381-4411 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_KM670336 Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence 35647-35677 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_KP276584 Escherichia coli strain 39R861 plasmid p39R861-4, complete sequence 137728-137758 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_020086 Escherichia coli plasmid pE66An, complete sequence 62018-62048 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 LT221037 Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence 34670-34700 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 LT221038 Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence 57052-57082 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 279735-279765 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 173554-173584 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 19735-19765 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_009651 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence 87315-87345 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_010886 Klebsiella pneumoniae plasmid pK245, complete sequence 6255-6285 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_012885 Aeromonas hydrophila plasmid pRA1, complete sequence 116782-116812 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_012886 Escherichia coli plasmid pRAx, complete sequence 38295-38325 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP017059 Citrobacter freundii strain SL151 plasmid unnamed2, complete sequence 35865-35895 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP026241 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-e790, complete sequence 169239-169269 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 157658-157688 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 118823-118853 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_008612 Photobacterium damselae subsp. piscicida plasmid pP99-018, complete sequence 5115-5145 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 MT077884 Escherichia coli plasmid p33, complete sequence 124520-124550 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 MT077886 Escherichia coli plasmid p39, complete sequence 123743-123773 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_LS992178 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 4, complete sequence 7112-7142 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_LT904892 Salmonella enterica subsp. enterica serovar Typhi strain 80-2002 plasmid 2 117175-117205 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP028955 Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence 82091-82121 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 126032-126062 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 94006-94036 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP042646 Escherichia coli strain NCYU-21-79 plasmid pNCYU-21-79-1, complete sequence 106808-106838 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP019048 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence 76070-76100 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 LC549808 Klebsiella pneumoniae VNCKp83 plasmid pVNCKp83 DNA, complete sequence 10297-10327 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_008613 Photobacterium damselae subsp. piscicida plasmid pP91278, complete sequence 2922-2952 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP031568 Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence 131968-131998 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP014524 Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence 28581-28611 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 44744-44774 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 263641-263671 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 141643-141673 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 87757-87787 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP022696 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence 96704-96734 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP022697 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence 49582-49612 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP028958 Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence 40217-40247 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP028991 Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence 51893-51923 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP046273 Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence 43899-43929 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 CP052554 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence 65143-65173 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 176931-176961 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_012919 Photobacterium damselae subsp. piscicida plasmid pP9014 DNA, complete sequence 44680-44710 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP040859 Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence 44294-44324 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP021168 Enterobacter hormaechei strain 388 plasmid p388, complete sequence 15183-15213 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 168896-168926 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 164840-164870 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 273166-273196 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP038468 Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence 49109-49139 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 87790-87820 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP012169 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence 43899-43929 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP035277 Citrobacter freundii strain R17 plasmid pCFR17_1, complete sequence 90087-90117 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP021163 Enterobacter hormaechei strain 234 plasmid p234, complete sequence 55711-55741 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP030186 Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence 185042-185072 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 38606-38636 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP009116 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p1, complete sequence 4706-4736 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP040696 Citrobacter freundii strain R47 plasmid pR47-309, complete sequence 172704-172734 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 236201-236231 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 CP052289 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence 10361-10391 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_AP019668 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence 709-739 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP042552 Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence 125962-125992 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 57546-57576 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 CP050162 Escherichia coli plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence 58810-58840 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP034677 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence 36870-36900 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 MK933279 Enterobacter hormaechei strain SCNJ07 plasmid pMCR-SCNJ07, complete sequence 255459-255489 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 172168-172198 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP018451 Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence 54320-54350 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 76038-76068 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP043927 Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence 393127-393157 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP040362 Klebsiella pneumoniae strain R50 plasmid pR50-74, complete sequence 12213-12243 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP021853 Proteus mirabilis strain AR_0156 plasmid unitig_1, complete sequence 90684-90714 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP029723 Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence 2757-2787 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 266204-266234 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP032212 Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence 48609-48639 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP028782 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence 62266-62296 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 135014-135044 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_012556 Enterobacter cloacae plasmid pEC-IMPQ, complete sequence 137203-137233 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_012555 Enterobacter cloacae plasmid pEC-IMP, complete sequence 137203-137233 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP014295 Klebsiella pneumoniae strain KP38731 plasmid unnamed1, complete sequence 21171-21201 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP042579 Enterobacter kobei strain C16 plasmid pC16_001, complete sequence 126059-126089 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 137836-137866 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP011610 Citrobacter freundii strain CAV1321 plasmid pCAV1321-135, complete sequence 85527-85557 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 110435-110465 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP032842 Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence 246750-246780 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP014775 Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence 139856-139886 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 120298-120328 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 CP028782 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pCTXM27_020046, complete sequence 62266-62296 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 153358-153388 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP026018 Klebsiella pneumoniae strain 13190 plasmid p13190-2, complete sequence 45614-45644 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP032176 Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence 30220-30250 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 LC225353 Photobacterium damselae subsp. piscicida plasmid pP0855 DNA, complete sequence 5115-5145 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP022533 Enterobacter hormaechei strain MS7884A plasmid pMS7884A, complete sequence 138040-138070 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 24926-24956 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_AP018145 Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence 159321-159351 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 CP052471 Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-3, complete sequence 57434-57464 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP029717 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence 217741-217771 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 167771-167801 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP042489 Enterobacter hormaechei strain C15 plasmid pC15_001, complete sequence 241294-241324 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_LT985275 Escherichia coli strain R71 plasmid RCS70_p, complete sequence 11032-11062 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP044120 Raoultella planticola strain S25 plasmid pS25-68, complete sequence 46898-46928 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP033103 Enterobacter hormaechei strain L51 plasmid pEHZJ1, complete sequence 258339-258369 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 MN218814 Klebsiella pneumoniae strain KB-2017-139 plasmid p101_srb, complete sequence 73580-73610 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_MH829594 Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence 191894-191924 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 101484-101514 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_MK124610 Citrobacter werkmanii strain Cb_CB1_SE1_NDM_08_2017 plasmid pCB1_SE1_NDM, complete sequence 167652-167682 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP020091 Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence 19449-19479 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 82733-82763 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_MF344580 Enterobacter cloacae strain 30860 plasmid p30860-HI2, complete sequence 181826-181856 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_MH477637 Citrobacter freundii strain 1509-02085 plasmid p02085-tetA, complete sequence 27960-27990 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_MH399264 Enterobacter cloacae strain RJ702 plasmid pIMP26, complete sequence 217978-218008 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP049047 Enterobacter hormaechei strain Y233 plasmid pIHI2-233, complete sequence 285655-285685 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 87002-87032 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP018448 Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-1, complete sequence 8489-8519 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_KY978628 Cronobacter sakazakii strain 505108 plasmid p505108-MDR, complete sequence 224161-224191 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 80433-80463 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_MF788071 Raoultella ornithinolytica strain 23141 plasmid p23141-3, complete sequence 212765-212795 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP031723 Enterobacter hormaechei strain WCHEH020038 plasmid p2_020038, complete sequence 54178-54208 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP028814 Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence 8626-8656 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 94287-94317 8 0.742
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 112080-112110 8 0.742
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 213554-213584 8 0.742
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 253033-253063 8 0.742
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NC_019847 Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence 525-555 8 0.742
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 890200-890230 8 0.742
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP021832 Sinorhizobium meliloti strain HM006 plasmid accessoryA, complete sequence 77512-77542 8 0.742
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NC_019313 Sinorhizobium meliloti plasmid pHRC017, complete sequence 525-555 8 0.742
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 12731-12761 8 0.742
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP051182 Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence 68286-68316 8 0.742
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 44116-44146 8 0.742
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 4343-4373 8 0.742
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP033227 Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence 352879-352909 8 0.742
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1923916-1923946 9 0.71
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 487767-487797 9 0.71
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP022305 Thalassococcus sp. S3 plasmid pS3B, complete sequence 24371-24401 9 0.71
NZ_CP023741_1 1.1|339552|31|NZ_CP023741|CRISPRCasFinder 339552-339582 31 NZ_CP024308 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence 153162-153192 9 0.71
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 19250-19280 9 0.71
NZ_CP023741_1 1.3|339660|31|NZ_CP023741|CRISPRCasFinder 339660-339690 31 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 16550-16580 9 0.71
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NC_010679 Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence 70334-70364 9 0.71
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 224770-224800 9 0.71
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 388149-388179 9 0.71
NZ_CP023741_1 1.2|339606|31|NZ_CP023741|CRISPRCasFinder 339606-339636 31 NC_048106 Synechococcus phage S-CBWM1, complete genome 97883-97913 10 0.677
NZ_CP023741_2 2.1|339984|31|NZ_CP023741|CRISPRCasFinder 339984-340014 31 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 280345-280375 10 0.677

1. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP034347 (Roseovarius sp. MME-070 plasmid pMME07001, complete sequence) position: , mismatch: 3, identity: 0.903

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgacggcaatgacaatatcggcggcggcacc	Protospacer
**  *****.*********************

2. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcaacgacacgatctacggcggcgga	Protospacer
.*****************.* ********  

3. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 5, identity: 0.839

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
gggcggcaacgacacgatttgcggcggctct	Protospacer
 * ***************** ******* *.

4. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 5, identity: 0.839

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
tatcggcaacgacacgatctacggcggcggc	Protospacer
*..***************.* ******** *

5. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031116 (Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cggcggcaacgacacgatctacggcggcgac	Protospacer
.* ***************.* ******** *

6. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP045413 (Roseovarius sp. THAF8 plasmid pTHAF8_c, complete sequence) position: , mismatch: 5, identity: 0.839

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
tggtggcaacgacacgatgaccggcggcgcg	Protospacer
** .**************  ********** 

7. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.839

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgtcggcaacgacacgctgtccggcggcgac	Protospacer
.*.************* * ********** *

8. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

cgcggg-caacgacaatatcggcggcggcacc	CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc	Protospacer
 ***.* *.*****.********* *******

9. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

cgcggg-caacgacaatatcggcggcggcacc	CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc	Protospacer
 ***.* *.*****.********* *******

10. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

cgcggg-caacgacaatatcggcggcggcacc	CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc	Protospacer
 ***.* *.*****.********* *******

11. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

cgcggg-caacgacaatatcggcggcggcacc	CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc	Protospacer
 ***.* *.*****.********* *******

12. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

cgcggg-caacgacaatatcggcggcggcacc	CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc	Protospacer
 ***.* *.*****.********* *******

13. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 5, identity: 0.839

cgcggg-caacgacaatatcggcggcggcacc	CRISPR spacer
-gcggaccaaagacaatgtcggcggcggcagc	Protospacer
 ****. *** ******.************ *

14. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

cgcggg-caacgacaatatcggcggcggcacc	CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc	Protospacer
 ***.* *.*****.********* *******

15. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

cgcggg-caacgacaatatcggcggcggcacc	CRISPR spacer
-gcgagccgacgacgatatcggcgccggcacc	Protospacer
 ***.* *.*****.********* *******

16. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.839

cgcggg-caacgacaatatcggcggcggcacc	CRISPR spacer
-gcggaccaaagacaatgtcggcggcggcagc	Protospacer
 ****. *** ******.************ *

17. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 6, identity: 0.806

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgatttacggcggccaa	Protospacer
.******.************ *******   

18. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031958 (Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cggtggcaacgacatgatttccggtggcgca	Protospacer
.* .**********.*********.***** 

19. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.806

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
tgccggcaacgacacgatctacggcgcgatc	Protospacer
******************.* *****  ..*

20. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.806

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
catcggcaacgacacgatctacggcggcggc	Protospacer
...***************.* ******** *

21. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 6, identity: 0.806

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
tgccggcaatgacacgattgccggctacgat	Protospacer
*********.********* ***** .** .

22. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.806

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
ggacggcaacgacacgattcgcggcggctct	Protospacer
 * ****************. ******* *.

23. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgtcggcaaggacaatagcggcggcggcgac	Protospacer
**. ***** ******* **********. *

24. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
ccccgtcaatgagaatatcggcggcggcaca	Protospacer
* * * ***.** ***************** 

25. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
ccccgtcaatgagaatatcggcggcggcaca	Protospacer
* * * ***.** ***************** 

26. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgttggcaaggacaataccggcggcggcgac	Protospacer
**. ***** *******.**********. *

27. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

28. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

29. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

30. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

31. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

32. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

33. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

34. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

35. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

36. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

37. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

38. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

39. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

40. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgagttcaccgacaacatcggcggcggcatc	Protospacer
** *  ** ******.*************.*

41. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
gacgggcaacgacgtgatttccggcggcgat	Protospacer
 .* *********..************** .

42. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
tgccggcgacgacacgattttcggccaggga	Protospacer
*******.************.**** . *  

43. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcaacgacacgcttttcggcgaggag	Protospacer
.*************** ***.*****. *  

44. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
ggccggcaacgacacgatctacggcgcgatc	Protospacer
 *****************.* *****  ..*

45. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcaacgacacgcttttcggcgaggag	Protospacer
.*************** ***.*****. *  

46. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
ggccggcaatgacacgatttcgggcgcgggt	Protospacer
 ********.*********** ****  * .

47. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgacggcaacgacacgctttctggcggcaag	Protospacer
.* ************* ****.******.  

48. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
aaccggcaacgacacgatcttcggcgaggac	Protospacer
 .****************.*.*****. * *

49. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
aaccggcaacgacacgatcttcggcgaggac	Protospacer
 .****************.*.*****. * *

50. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
tgccggcaacgacaggatttacgaagacgtg	Protospacer
************** ***** **. *.**. 

51. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 7, identity: 0.774

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
tgccggcaacgacaggatttacgaagacgtg	Protospacer
************** ***** **. *.**. 

52. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP046165 (Vibrio sp. THAF191c plasmid pTHAF191c_d, complete sequence) position: , mismatch: 7, identity: 0.774

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
gataagcgccgacacggtttccggtgatgct	Protospacer
*.  .* *********.************ *

53. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP046068 (Vibrio sp. THAF191d plasmid pTHAF191d_d, complete sequence) position: , mismatch: 7, identity: 0.774

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
gataagcgccgacacggtttccggtgatgct	Protospacer
*.  .* *********.************ *

54. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP045358 (Vibrio sp. THAF64 plasmid pTHAF64_c, complete sequence) position: , mismatch: 7, identity: 0.774

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
gataagcgccgacacggtttccggtgatgct	Protospacer
*.  .* *********.************ *

55. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 7, identity: 0.774

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
caacgacaacgacacgctggacggcggcgac	Protospacer
*********.********* **** ...* *

56. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP024425 (Paracoccus yeei strain TT13 plasmid pTT13-3, complete sequence) position: , mismatch: 7, identity: 0.774

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
caacggcaatgacacgctgtatggcggggtc	Protospacer
*****.***************.** .. *.*

57. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
caacggcaatgacacgctgtatggcggggtc	Protospacer
*****.***************.** .. *.*

58. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 7, identity: 0.774

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
caacggcaatgacacgctgtatggcggggtc	Protospacer
*****.***************.** .. *.*

59. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.774

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
aaacaacaacgacacgctgtacggcggggcc	Protospacer
 ***.****.************** .. ***

60. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
gaacaacaacgacacgctgtacggtggggcc	Protospacer
 ***.****.************** .. ***

61. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP034347 (Roseovarius sp. MME-070 plasmid pMME07001, complete sequence) position: , mismatch: 7, identity: 0.774

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cggcggccatgacaatatcggcggcggcctg	Protospacer
**  *** *.****************** . 

62. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_010679 (Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence) position: , mismatch: 7, identity: 0.774

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cacgggcgacgacaatgtcggcggcgcccat	Protospacer
*.*****.********.********* *  .

63. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 7, identity: 0.774

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
catcggcaaggacaataccggcggcggcgac	Protospacer
*.. ***** *******.**********. *

64. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.774

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
catcggcaaggacaataccggcggcggcgac	Protospacer
*.. ***** *******.**********. *

65. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.774

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgtcggcaaggacaataccggcggcggcgat	Protospacer
**. ***** *******.**********. .

66. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.774

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgtcggcaaggacaataccggcggcggcgat	Protospacer
**. ***** *******.**********. .

67. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP013071 (Sphingobium indicum B90A plasmid pSRL1, complete sequence) position: , mismatch: 7, identity: 0.774

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
caagtccaacgagaatagcggcggcggcaac	Protospacer
*. *  ****** **** *********** *

68. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_AP017658 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_4, complete sequence) position: , mismatch: 7, identity: 0.774

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
caagtccaacgagaatagcggcggcggcaac	Protospacer
*. *  ****** **** *********** *

69. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 7, identity: 0.774

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
caagtccaacgagaatagcggcggcggcaac	Protospacer
*. *  ****** **** *********** *

70. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.774

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
caagtccaacgagaatagcggcggcggcaac	Protospacer
*. *  ****** **** *********** *

71. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
ccggggcaacgacacgatgaccggcggcgag	Protospacer
.   **************  *********  

72. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcaatgacacgattgccggctatgat	Protospacer
.********.********* ***** ..* .

73. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
ccggggcaacgacacgatgaccggcggcgag	Protospacer
.   **************  *********  

74. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021116 (Rhodobacteraceae bacterium strain G7 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
ctggggcaacgacacggtttacggcggcgat	Protospacer
.   ************.*** ******** .

75. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

76. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

77. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

78. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

79. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
caccggcaacgacacgctttacggcgcaatc	Protospacer
..************** *** *****  ..*

80. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

81. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

82. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
caccggcaacgacacgctttacggcgcaatc	Protospacer
..************** *** *****  ..*

83. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

84. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

85. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

86. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

87. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

88. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

89. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

90. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

91. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

92. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

93. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

94. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

95. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

96. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

97. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcgacgacacgattttcggcaaggga	Protospacer
.******.************.****.. *  

98. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgtccgcatcgacacggtttccggcggccgg	Protospacer
.*.* *** *******.***********   

99. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KY270852 (Enterobacter cloacae strain T5282 plasmid pT5282-mphA, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

100. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KY270851 (Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

101. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN175386 (Klebsiella pneumoniae strain KP-13-14 plasmid pKP-13-14-NDM-9, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

102. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KX810825 (Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

103. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

104. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KM083064 (Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

105. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KM670336 (Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

106. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KP276584 (Escherichia coli strain 39R861 plasmid p39R861-4, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

107. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_020086 (Escherichia coli plasmid pE66An, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

108. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to LT221037 (Yersinia pseudotuberculosis strain Yps.R1, plasmid pYps.R1 complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

109. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

110. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

111. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

112. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

113. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_009651 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

114. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

115. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_012885 (Aeromonas hydrophila plasmid pRA1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

116. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_012886 (Escherichia coli plasmid pRAx, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

117. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP017059 (Citrobacter freundii strain SL151 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

118. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP026241 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-e790, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

119. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

120. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

121. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_008612 (Photobacterium damselae subsp. piscicida plasmid pP99-018, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

122. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MT077884 (Escherichia coli plasmid p33, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

123. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MT077886 (Escherichia coli plasmid p39, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

124. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_LS992178 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

125. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_LT904892 (Salmonella enterica subsp. enterica serovar Typhi strain 80-2002 plasmid 2) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

126. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

127. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

128. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

129. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP042646 (Escherichia coli strain NCYU-21-79 plasmid pNCYU-21-79-1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

130. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP019048 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166a, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

131. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to LC549808 (Klebsiella pneumoniae VNCKp83 plasmid pVNCKp83 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

132. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_008613 (Photobacterium damselae subsp. piscicida plasmid pP91278, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

133. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031568 (Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

134. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014524 (Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

135. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

136. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

137. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

138. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

139. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022696 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

140. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022697 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

141. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028958 (Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

142. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

143. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

144. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052554 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

145. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

146. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_012919 (Photobacterium damselae subsp. piscicida plasmid pP9014 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

147. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP040859 (Klebsiella pneumoniae strain Xen39 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

148. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021168 (Enterobacter hormaechei strain 388 plasmid p388, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

149. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

150. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

151. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

152. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP038468 (Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

153. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

154. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

155. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP035277 (Citrobacter freundii strain R17 plasmid pCFR17_1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

156. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021163 (Enterobacter hormaechei strain 234 plasmid p234, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

157. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP030186 (Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

158. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

159. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP009116 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

160. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP040696 (Citrobacter freundii strain R47 plasmid pR47-309, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

161. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

162. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052289 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

163. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_AP019668 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

164. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP042552 (Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

165. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

166. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP050162 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

167. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

168. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MK933279 (Enterobacter hormaechei strain SCNJ07 plasmid pMCR-SCNJ07, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

169. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

170. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP018451 (Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

171. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

172. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP043927 (Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

173. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP040362 (Klebsiella pneumoniae strain R50 plasmid pR50-74, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

174. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021853 (Proteus mirabilis strain AR_0156 plasmid unitig_1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

175. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

176. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

177. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032212 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

178. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

179. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

180. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_012556 (Enterobacter cloacae plasmid pEC-IMPQ, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

181. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_012555 (Enterobacter cloacae plasmid pEC-IMP, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

182. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014295 (Klebsiella pneumoniae strain KP38731 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

183. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP042579 (Enterobacter kobei strain C16 plasmid pC16_001, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

184. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

185. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP011610 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-135, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

186. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

187. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

188. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014775 (Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

189. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

190. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pCTXM27_020046, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

191. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

192. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP026018 (Klebsiella pneumoniae strain 13190 plasmid p13190-2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

193. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032176 (Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

194. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to LC225353 (Photobacterium damselae subsp. piscicida plasmid pP0855 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

195. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022533 (Enterobacter hormaechei strain MS7884A plasmid pMS7884A, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

196. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

197. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_AP018145 (Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

198. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052471 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-3, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

199. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029717 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

200. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

201. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP042489 (Enterobacter hormaechei strain C15 plasmid pC15_001, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

202. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_LT985275 (Escherichia coli strain R71 plasmid RCS70_p, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

203. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP044120 (Raoultella planticola strain S25 plasmid pS25-68, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

204. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP033103 (Enterobacter hormaechei strain L51 plasmid pEHZJ1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

205. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN218814 (Klebsiella pneumoniae strain KB-2017-139 plasmid p101_srb, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

206. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MH829594 (Enterobacter cloacae strain EC62 plasmid pIMP-4-EC62, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

207. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

208. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MK124610 (Citrobacter werkmanii strain Cb_CB1_SE1_NDM_08_2017 plasmid pCB1_SE1_NDM, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

209. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP020091 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

210. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

211. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MF344580 (Enterobacter cloacae strain 30860 plasmid p30860-HI2, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

212. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MH477637 (Citrobacter freundii strain 1509-02085 plasmid p02085-tetA, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

213. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MH399264 (Enterobacter cloacae strain RJ702 plasmid pIMP26, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

214. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP049047 (Enterobacter hormaechei strain Y233 plasmid pIHI2-233, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

215. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

216. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP018448 (Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

217. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_KY978628 (Cronobacter sakazakii strain 505108 plasmid p505108-MDR, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

218. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

219. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_MF788071 (Raoultella ornithinolytica strain 23141 plasmid p23141-3, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

220. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP031723 (Enterobacter hormaechei strain WCHEH020038 plasmid p2_020038, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

221. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028814 (Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

222. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

223. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 8, identity: 0.742

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
taccgatgcctacacgctttccggtgatgat	Protospacer
 . .*. *** ***** **************

224. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
gaacaacaacgacacgctgtacggtggggct	Protospacer
 ***.****.************** .. **.

225. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 8, identity: 0.742

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
gaacgacaatgagacgctctacggtgctatc	Protospacer
 *********** ***** ***** . *..*

226. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.742

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
gaacgacaatgagacgctctacggtgctatc	Protospacer
 *********** ***** ***** . *..*

227. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
gaacaacaacgacacgctgtacggtggggct	Protospacer
 ***.****.************** .. **.

228. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP021832 (Sinorhizobium meliloti strain HM006 plasmid accessoryA, complete sequence) position: , mismatch: 8, identity: 0.742

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
gaacgacaatgagacgctctacggtgctatc	Protospacer
 *********** ***** ***** . *..*

229. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NC_019313 (Sinorhizobium meliloti plasmid pHRC017, complete sequence) position: , mismatch: 8, identity: 0.742

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
gaacgacaatgagacgctctacggtgctatc	Protospacer
 *********** ***** ***** . *..*

230. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 8, identity: 0.742

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
gctcggcaacgacagtctcggcggcggcgac	Protospacer
  . **********.* ***********. *

231. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP051182 (Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence) position: , mismatch: 8, identity: 0.742

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
tgaaaaccacgacatgatcggcggcggcacc	Protospacer
.* ...* ******  ***************

232. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 8, identity: 0.742

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cttctgcaacggcaatgtcggcggcggcccg	Protospacer
* .  ******.****.*********** * 

233. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 8, identity: 0.742

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cttctgcaacggcaatgtcggcggcggcccg	Protospacer
* .  ******.****.*********** * 

234. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 8, identity: 0.742

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cgcggccaacgccaatatcggcgctgcccgt	Protospacer
***** ***** *********** .* *  .

235. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.71

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
ctccggcaacgacgcgattaccggcaaccag	Protospacer
. ***********.***** *****..*   

236. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.71

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
cgccggcaacgacgcgattaccggcaatcag	Protospacer
.************.***** *****...   

237. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 9, identity: 0.71

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
agatggcaacgacctgatttccggcggtctg	Protospacer
 * .********* .************. . 

238. spacer 1.1|339552|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 9, identity: 0.71

tgccggcaacgacacgatttccggcggcgcc	CRISPR spacer
ggctggcaacgacacgctttccggtacaacg	Protospacer
 **.************ *******..  .* 

239. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 9, identity: 0.71

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
gaacggcaacgacacgctgtacggcgcgatc	Protospacer
 ****.***.************** .  ..*

240. spacer 1.3|339660|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 9, identity: 0.71

caacgacaatgacacgctgtacgggaatgcc	CRISPR spacer
gaacggcaacgacacgctgtacggcgcgatc	Protospacer
 ****.***.************** .  ..*

241. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NC_010679 (Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence) position: , mismatch: 9, identity: 0.71

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
ggcggccaacaacaatatcggcggctcggtg	Protospacer
 **** ****.**************   .. 

242. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 9, identity: 0.71

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
cttccgcaccgtcaatatcggcggcggccag	Protospacer
* .  *** ** ****************   

243. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.71

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
ccaccatgacgaccatatcggcggctgcacc	Protospacer
*    ...***** *********** *****

244. spacer 1.2|339606|31|NZ_CP023741|CRISPRCasFinder matches to NC_048106 (Synechococcus phage S-CBWM1, complete genome) position: , mismatch: 10, identity: 0.677

ggatggggccgacacgatttccggtgatgat	CRISPR spacer
tcttgtggccgacatgatttccggtgtctga	Protospacer
   ** ********.*********** . . 

245. spacer 2.1|339984|31|NZ_CP023741|CRISPRCasFinder matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 10, identity: 0.677

cgcgggcaacgacaatatcggcggcggcacc	CRISPR spacer
aaagggcaacgacaaaatcggcagcgctttt	Protospacer
 . ************ ******.*** . ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1062614 : 1095658 42 Burkholderia_phage(25.0%) integrase,capsid,head,terminase,portal,tail,plate attL 1048916:1048933|attR 1076601:1076618
DBSCAN-SWA_2 1546824 : 1555747 9 Burkholderia_virus(16.67%) tRNA,protease NA
DBSCAN-SWA_3 2856374 : 2896044 37 Clostridium_phage(12.5%) transposase,integrase attL 2850765:2850779|attR 2892520:2892534
DBSCAN-SWA_4 3105522 : 3112002 11 Pseudomonas_phage(100.0%) capsid,head,tail NA
DBSCAN-SWA_5 3276243 : 3281868 8 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_6 3570147 : 3636535 78 Burkholderia_phage(19.35%) integrase,capsid,head,terminase,portal,coat,tail,plate attL 3560251:3560269|attR 3621238:3621256
DBSCAN-SWA_7 5283646 : 5360165 78 Burkholderia_phage(21.88%) integrase,capsid,head,terminase,portal,protease,tail,plate attL 5303627:5303644|attR 5327957:5327974
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage