Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023754 Listeria monocytogenes strain AL4E chromosome, complete genome 3 crisprs DinG,cas3,WYL,casR,DEDDh,csa3 0 1 7 1

Results visualization

1. NZ_CP023754
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023754_1 209980-210131 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023754_2 542811-543099 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023754_3 2863270-2863380 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023754_2 2.3|542970|35|NZ_CP023754|PILER-CR,CRISPRCasFinder,CRT 542970-543004 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_CP023754_2 2.3|542970|35|NZ_CP023754|PILER-CR,CRISPRCasFinder,CRT 542970-543004 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943

1. spacer 2.3|542970|35|NZ_CP023754|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

2. spacer 2.3|542970|35|NZ_CP023754|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120336 : 126861 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_2 1122541 : 1129964 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_3 1244013 : 1324315 96 Listeria_phage(79.66%) terminase,integrase,tail,tRNA,holin,capsid,protease,portal attL 1243897:1243917|attR 1286613:1286633
DBSCAN-SWA_4 1795782 : 1828648 38 Erysipelothrix_phage(67.74%) terminase,tail,holin,capsid,protease,head,portal NA
DBSCAN-SWA_5 1912831 : 1921117 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 2435614 : 2476054 61 Listeria_phage(96.43%) holin,capsid,tail,terminase NA
DBSCAN-SWA_7 2619346 : 2627190 7 Streptococcus_phage(50.0%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP023754.1|WP_003731276.1|2436412_2436664_+|hypothetical-protein 2436412_2436664_+ 83 aa aa 65 NA NA 2435614-2476054 NA