Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018014 Mycobacterium avium subsp. hominissuis strain OCU901s_S2_2s chromosome, complete genome 7 crisprs cas3,csa3,DinG,WYL,cas4,DEDDh,PD-DExK,PrimPol 0 7 1 0

Results visualization

1. NZ_CP018014
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018014_1 2120801-2120891 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018014_2 2959754-2959852 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018014_3 3287080-3287162 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018014_4 3721038-3721128 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018014_5 4189220-4189303 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018014_6 4764187-4764501 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018014_7 5159599-5159693 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 363455-363481 4 0.852
NZ_CP018014_6 6.2|4764241|27|NZ_CP018014|CRT 4764241-4764267 27 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 344709-344735 5 0.815
NZ_CP018014_6 6.3|4764286|27|NZ_CP018014|CRT 4764286-4764312 27 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 344709-344735 5 0.815
NZ_CP018014_6 6.4|4764331|27|NZ_CP018014|CRT 4764331-4764357 27 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 155630-155656 5 0.815
NZ_CP018014_6 6.4|4764331|27|NZ_CP018014|CRT 4764331-4764357 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5463769-5463795 5 0.815
NZ_CP018014_6 6.4|4764331|27|NZ_CP018014|CRT 4764331-4764357 27 NC_019387 Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence 76697-76723 5 0.815
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 NC_016592 Burkholderia sp. YI23 plasmid byi_3p, complete sequence 62666-62692 5 0.815
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 461543-461569 5 0.815
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 33328-33354 5 0.815
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 49056-49082 5 0.815
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 MK411746 Arthrobacter phage Sonali, complete genome 7847-7873 5 0.815
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 NZ_AP018829 Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence 219001-219027 5 0.815
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 108322-108351 6 0.8
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 CP021131 Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence 224413-224442 6 0.8
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP048642 Streptomyces aureoverticillatus strain HN6 plasmid unnamed, complete sequence 84607-84636 6 0.8
NZ_CP018014_6 6.2|4764241|27|NZ_CP018014|CRT 4764241-4764267 27 NC_016592 Burkholderia sp. YI23 plasmid byi_3p, complete sequence 62666-62692 6 0.778
NZ_CP018014_6 6.2|4764241|27|NZ_CP018014|CRT 4764241-4764267 27 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 134732-134758 6 0.778
NZ_CP018014_6 6.3|4764286|27|NZ_CP018014|CRT 4764286-4764312 27 NC_016592 Burkholderia sp. YI23 plasmid byi_3p, complete sequence 62666-62692 6 0.778
NZ_CP018014_6 6.3|4764286|27|NZ_CP018014|CRT 4764286-4764312 27 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 134732-134758 6 0.778
NZ_CP018014_6 6.5|4764376|27|NZ_CP018014|CRT 4764376-4764402 27 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 25674-25700 6 0.778
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 678281-678307 6 0.778
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 344709-344735 6 0.778
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 NZ_LR594663 Variovorax sp. RA8 plasmid 2 209825-209851 6 0.778
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 154500-154530 7 0.774
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 352345-352375 7 0.774
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 407323-407353 7 0.774
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 381791-381821 7 0.774
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 75346-75376 7 0.774
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 66044-66073 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 311669-311698 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 316124-316153 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 1013439-1013468 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1496944-1496973 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1501399-1501428 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP015204 Rhodococcus sp. 008 plasmid pR8C1, complete sequence 55829-55858 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 19778-19807 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 241047-241076 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 400720-400749 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP042916 Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence 5606-5635 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP042916 Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence 140939-140968 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP042916 Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence 36461-36490 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 MK937608 Microbacterium phage Cressida, complete genome 13019-13048 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP048428 Rhizobium daejeonense strain KACC 13094 plasmid unnamed4, complete sequence 10629-10658 7 0.767
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NC_007486 Rhodococcus erythropolis PR4 plasmid pREC1, complete sequence 73080-73109 7 0.767
NZ_CP018014_6 6.4|4764331|27|NZ_CP018014|CRT 4764331-4764357 27 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 25674-25700 7 0.741
NZ_CP018014_6 6.7|4764457|27|NZ_CP018014|CRT 4764457-4764483 27 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 25674-25700 7 0.741
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 617924-617954 8 0.742
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1195145-1195175 8 0.742
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 114909-114939 8 0.742
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 347972-348002 8 0.742
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 78885-78915 8 0.742
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 627680-627710 8 0.742
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP020333 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence 129286-129316 8 0.742
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 423630-423660 8 0.742
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 23934-23964 8 0.742
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 261069-261099 8 0.742
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_015378 Burkholderia gladioli BSR3 plasmid bgla_3p, complete sequence 123169-123199 8 0.742
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP023739 Methylosinus trichosporium OB3b plasmid pOB3b2, complete sequence 121417-121446 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP023740 Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence 118401-118430 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP028971 Aminobacter sp. MSH1 plasmid pUSP3, complete sequence 23211-23240 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 217634-217663 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 803004-803033 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP037914 Sphingomonas sp. AAP5 plasmid p213, complete sequence 194205-194234 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NC_028980 Pseudomonas phage PAE1, complete genome 2895-2924 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 MN813682 Microbacterium phage Matzah, complete genome 12962-12991 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 MK937591 Microbacterium phage Cinna, complete genome 12985-13014 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 MT889371 Microbacterium phage DelaGarza, complete genome 25276-25305 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP036516 Lichenihabitans psoromatis strain PAMC 29148 plasmid p_unnamed1, complete sequence 150725-150754 8 0.733
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 103136-103165 8 0.733
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1765139-1765169 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1847934-1847964 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1687172-1687202 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1757387-1757417 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1686194-1686224 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1764137-1764167 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1764138-1764168 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1687165-1687195 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1686486-1686516 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1687154-1687184 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1765312-1765342 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1765310-1765340 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1765279-1765309 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 790445-790475 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 77627-77657 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 990514-990544 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2356152-2356182 9 0.71
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 225402-225432 9 0.71
NZ_CP018014_5 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder 4189247-4189276 30 MN823990 Klebsiella pneumoniae strain 120314013 plasmid p314013-FII, complete sequence 54050-54079 9 0.7
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 326295-326325 10 0.677
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1486772-1486802 10 0.677
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 KT381864 Thiobacimonas phage vB_ThpS-P1, complete genome 38274-38304 10 0.677
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_011984 Agrobacterium vitis S4 plasmid pAtS4c, complete sequence 146563-146593 10 0.677
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NC_011982 Agrobacterium vitis S4 plasmid pTiS4, complete sequence 88203-88233 10 0.677
NZ_CP018014_3 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder 3287106-3287136 31 NZ_KY000031 Agrobacterium genomosp. 1 strain Tun198 plasmid pTi_Tun198, complete sequence 16591-16621 10 0.677

1. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852 

--gccggggcgtggcccccgccgaagccg	CRISPR spacer
aagcc--ggcgtggcccacgccgaagcct	Protospacer
  ***  ********** **********

2. spacer 6.2|4764241|27|NZ_CP018014|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
gccggggcgcggcccacgccgaacagc	Protospacer
*********.***** ********

3. spacer 6.3|4764286|27|NZ_CP018014|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
gccggggcgcggcccacgccgaacagc	Protospacer
*********.***** ********

4. spacer 6.4|4764331|27|NZ_CP018014|CRT matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggagcgtggccaccgccgaacccg	CRISPR spacer
tccggcgcctggccaccgccgaacgca	Protospacer
 **** ** *************** *.

5. spacer 6.4|4764331|27|NZ_CP018014|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815 

--gccggagcgtggccaccgccgaacccg	CRISPR spacer
tgacc--agcgtggccaccgccgaactct	Protospacer
  .**  *******************.*

6. spacer 6.4|4764331|27|NZ_CP018014|CRT matches to NC_019387 (Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggagcgtggccaccgccgaacccg	CRISPR spacer
accgctacgtggccaccgccgaacccc	Protospacer
.***  .*******************

7. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to NC_016592 (Burkholderia sp. YI23 plasmid byi_3p, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
gccggggcgacgcccccgccgaagatc	Protospacer
*********  ************* .

8. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
ccgcgggcgtggccgccgccgaagcct	Protospacer
 *  ********** ***********

9. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
gggcgggcgtggcccgcgccgatgccg	Protospacer
*   *********** ****** ****

10. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
acgtgggcgttgaccccgccgaagccg	Protospacer
.*  ****** * **************

11. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to MK411746 (Arthrobacter phage Sonali, complete genome) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
gctccggcgtggcctccgccgaagcct	Protospacer
**.  *********.***********

12. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to NZ_AP018829 (Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gccgg--ggcgtggcccccgccgaagccg	CRISPR spacer
--cgatcggcgtggcccccgccgaagtgg	Protospacer
  **.  *******************. *

13. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 6, identity: 0.8 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
atccgcaaggcgctcgccggcgccgggctc	Protospacer
..**  * *********** **********

14. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to CP021131 (Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence) position: , mismatch: 6, identity: 0.8 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gctccgccggcgcccgccggcgccgggctc	Protospacer
**.*.. ******.***** **********

15. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP048642 (Streptomyces aureoverticillatus strain HN6 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gaccttgcggcgctcgccgtcgccgtagtc	Protospacer
* *** .****************** . **

16. spacer 6.2|4764241|27|NZ_CP018014|CRT matches to NC_016592 (Burkholderia sp. YI23 plasmid byi_3p, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
gccggggcgacgcccccgccgaagatc	Protospacer
*********  ************  .

17. spacer 6.2|4764241|27|NZ_CP018014|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
accgggtcgtggccctcgccgaacagt	Protospacer
.***** ********.********

18. spacer 6.3|4764286|27|NZ_CP018014|CRT matches to NC_016592 (Burkholderia sp. YI23 plasmid byi_3p, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
gccggggcgacgcccccgccgaagatc	Protospacer
*********  ************  .

19. spacer 6.3|4764286|27|NZ_CP018014|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
accgggtcgtggccctcgccgaacagt	Protospacer
.***** ********.********

20. spacer 6.5|4764376|27|NZ_CP018014|CRT matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggagcgtggccaccgccgaagccg	CRISPR spacer
aagaacgcgtggccaccgccgaagccg	Protospacer
.  .. *********************

21. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
agatgggcgtggccctcgacgaagccg	Protospacer
.   ***********.** ********

22. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
gccggggcgcggcccacgccgaacagc	Protospacer
*********.***** *******

23. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
aggaggacgtggcccgcgccgaagccg	Protospacer
.  .**.******** ***********

24. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 7, identity: 0.774 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
ttccccgtcggcccgacccgcatcgtcgcca	Protospacer
...*  *.*******.***************

25. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 7, identity: 0.774 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gcgctggccggcgcggcccgcatcgtcgagc	Protospacer
 * * ******* ***************

26. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.774 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
cccgaggccggcgtggcccgcatcgtcgacc	Protospacer
**. .******* .************** *

27. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 7, identity: 0.774 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
cccgaggccggcgtggcccgcatcgtcgacc	Protospacer
**. .******* .************** *

28. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 7, identity: 0.774 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
cagcagcgcggcgcgggccgcatcgtcgcca	Protospacer
*  *.*  **** *** **************

29. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gaggccgcggcgctcgccgacgccgggctc	Protospacer
*   . .************ **********

30. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
atccggcaggcgctcgccgccgccgggctc	Protospacer
..** .  ***********.**********

31. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
atccggcaggcgctcgccgccgccgggctc	Protospacer
..** .  ***********.**********

32. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
ctcgtcctggcgctcgccgtcgccgcgctc	Protospacer
 .* *  .***************** ****

33. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
atccggcaggcgctcgccgccgccgggctc	Protospacer
..** .  ***********.**********

34. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
atccggcaggcgctcgccgccgccgggctc	Protospacer
..** .  ***********.**********

35. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gatcacgccgcgctcgccgtcgacgggctc	Protospacer
* .*  .* ************* *******

36. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gtcctaacggcgctcgcctgcgccgccatg	Protospacer
*.****************  *****   *

37. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
ttccgcacggcgctcgacgacgccgggctg	Protospacer
 .**  ********** ** *********

38. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
ttccgcacggcgctcgacgacgccgggctg	Protospacer
 .**  ********** ** *********

39. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP042916 (Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gatcacgccgcgctcgccgtcgacgggctc	Protospacer
* .*  .* ************* *******

40. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP042916 (Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gatcacgccgcgctcgccgtcgacgggctc	Protospacer
* .*  .* ************* *******

41. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP042916 (Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gatcacgccgcgctcgccgtcgacgggctc	Protospacer
* .*  .* ************* *******

42. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gtccgtccggcgctcgtcgtcgccgggccg	Protospacer
*.**   *********.***********.

43. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP048428 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
tcggtgacggcgctcgccgtcggcgtgcta	Protospacer
 *  *.**************** ** ***

44. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NC_007486 (Rhodococcus erythropolis PR4 plasmid pREC1, complete sequence) position: , mismatch: 7, identity: 0.767 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gatcacgccgcgctcgccgtcgacgggctc	Protospacer
* .*  .* ************* *******

45. spacer 6.4|4764331|27|NZ_CP018014|CRT matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 7, identity: 0.741 

gccggagcgtggccaccgccgaacccg	CRISPR spacer
aagaacgcgtggccaccgccgaagccg	Protospacer
.  .. ***************** ***

46. spacer 6.7|4764457|27|NZ_CP018014|CRT matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 7, identity: 0.741 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
aagaacgcgtggccaccgccgaagccg	Protospacer
.  .. ******** ************

47. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
tacgcggccggcgcggcccgcatcgtccccg	Protospacer
. .  ******* ************** **.

48. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
tacgcggccggcgcggcccgcatcgtccccg	Protospacer
. .  ******* ************** **.

49. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gtcagcaccggcccggcccgcatcgccgaca	Protospacer
 .. * .******************.** **

50. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gtcagcaccggcccggcccgcatcgccgaca	Protospacer
 .. * .******************.** **

51. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcgggccggcccggcccgcatcgtcgcca-	CRISPR spacer
tgcggggccggcccggcccgcaccgt-gtgat	Protospacer
. . ******************.*** *. *

52. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gtcagcaccggcccggcccgcatcgccgaca	Protospacer
 .. * .******************.** **

53. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP020333 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
atatcgaccgccccggcccgcatcatcgcca	Protospacer
 . . *.*** *************.******

54. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gtcagcaccggcccggcccgcatcgccgaca	Protospacer
 .. * .******************.** **

55. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
catgccgccgccgcggcccgcatcgtcgcgg	Protospacer
* *   **** * **************** .

56. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcggg----ccggcccggcccgcatcgtcgcca	CRISPR spacer
----gagttttccggccgggcccggatcgtcgccc	Protospacer
    *.*    ****** ****** *********

57. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_015378 (Burkholderia gladioli BSR3 plasmid bgla_3p, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
tgcggggccggcccggctcgcaacgtcacga	Protospacer
. . *************.**** ****.* *

58. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP023739 (Methylosinus trichosporium OB3b plasmid pOB3b2, complete sequence) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
ttcctgacggcgctcgccgtcgcctatcag	Protospacer
 .***.****************** . *

59. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
atcgccgcggcgctcgccgacgccgggctg	Protospacer
..* . .************ *********

60. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP028971 (Aminobacter sp. MSH1 plasmid pUSP3, complete sequence) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
agcggaacggcgttcgccgtcgccggccat	Protospacer
. *  *******.************* * .

61. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
atcgctgcggcgctggccgacgccgggctc	Protospacer
..* . .******* **** **********

62. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
ctcgccgcggcgctcgccgtcgcggtgctc	Protospacer
 .* . .**************** * ****

63. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP037914 (Sphingomonas sp. AAP5 plasmid p213, complete sequence) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
acggggatcgctctcgccgtcgccgggctc	Protospacer
.*   .*. ** ******************

64. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NC_028980 (Pseudomonas phage PAE1, complete genome) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
tcatatgcggcgctcgtggtcgccgggctc	Protospacer
 * .  .*********. ************

65. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gttcgtccggcgctcgtcgtcgccgggccg	Protospacer
*..*   *********.***********.

66. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gttcgtccggcgctcgtcgtcgccgggccg	Protospacer
*..*   *********.***********.

67. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
cggcgtgcggcgctcaccgtcgcccggctc	Protospacer
   *  .********.******** *****

68. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP036516 (Lichenihabitans psoromatis strain PAMC 29148 plasmid p_unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
ggcctaatggcgctcggcgtcgccgccgga	Protospacer
* *****.******** ********

69. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 8, identity: 0.733 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
gagcaggcggcgctcgtcgtcgccgggcag	Protospacer
*  * ..*********.***********

70. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

71. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

72. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

73. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

74. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

75. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

76. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

77. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

78. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

79. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

80. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

81. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

82. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gttgcggtcggcccggcccgcatcgtccatc	Protospacer
 .*  **.*******************  .

83. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
aacacagccggctcggcccgcatcatcgcga	Protospacer
  .  .******.***********.**** *

84. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
gccgaattcggcccggcccgcgtcgtcgaca	Protospacer
 *. .. .*************.****** **

85. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
tccgcccgcgcctcggcccgcatcgtcgcca	Protospacer
.*.     ** *.******************

86. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
tccgcccgcgcctcggcccgcatcgtcgcca	Protospacer
.*.     ** *.******************

87. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
tccgagggcggcccggcccgcatcgccgggt	Protospacer
.*. .** *****************.**

88. spacer 5.1|4189247|30|NZ_CP018014|CRISPRCasFinder matches to MN823990 (Klebsiella pneumoniae strain 120314013 plasmid p314013-FII, complete sequence) position: , mismatch: 9, identity: 0.7 

gccctaacggcgctcgccgtcgccgggctc	CRISPR spacer
ttaaaaacgcggctcgccgtcgccgggcag	Protospacer
 .   ****  *****************

89. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.677 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
ggggcggccggcgcggaccgcatcgtcgagg	Protospacer
     ******* *** ***********  .

90. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.677 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
ggggcggccggcgcggaccgcatcgtcgagg	Protospacer
     ******* *** ***********  .

91. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 10, identity: 0.677 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
tagaaacgcggcccggcccgcctcgtcgccc	Protospacer
.   ..  ************* ********

92. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_011984 (Agrobacterium vitis S4 plasmid pAtS4c, complete sequence) position: , mismatch: 10, identity: 0.677 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
tgcatcgccggtccggcccgcatcgccgcgg	Protospacer
. .   *****.*************.*** .

93. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NC_011982 (Agrobacterium vitis S4 plasmid pTiS4, complete sequence) position: , mismatch: 10, identity: 0.677 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
tgcatcgccggtccggcccgcatcgccgcgg	Protospacer
. .   *****.*************.*** .

94. spacer 3.1|3287106|31|NZ_CP018014|CRISPRCasFinder matches to NZ_KY000031 (Agrobacterium genomosp. 1 strain Tun198 plasmid pTi_Tun198, complete sequence) position: , mismatch: 10, identity: 0.677 

cctcgggccggcccggcccgcatcgtcgcca	CRISPR spacer
tgcatcgccggtccggcccgcatcgccgcgg	Protospacer
. .   *****.*************.*** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3814297 : 3820870 7 Bacillus_phage(33.33%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage