Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016809 Paenibacillus ihbetae strain IHBB 9852 chromosome, complete genome 8 crisprs WYL,csa3,DinG,cas3,DEDDh,Cas9_archaeal 0 1 471 0

Results visualization

1. NZ_CP016809
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016809_1 1535081-1535223 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016809_2 1898227-1898301 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016809_3 1908994-1909090 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016809_4 2235975-2236073 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016809_5 2923847-2923947 TypeII NA
1 spacers
Cas9_archaeal

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016809_6 3048147-3048256 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016809_7 4088711-4088784 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016809_8 4964939-4965031 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016809_6 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder 3048172-3048231 60 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 900668-900727 9 0.85
NZ_CP016809_6 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder 3048172-3048231 60 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 2547774-2547833 9 0.85
NZ_CP016809_6 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder 3048172-3048231 60 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1553592-1553651 9 0.85
NZ_CP016809_6 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder 3048172-3048231 60 NZ_CP016544 Planococcus donghaensis strain DSM 22276 plasmid pPD76, complete sequence 7380-7439 9 0.85
NZ_CP016809_6 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder 3048172-3048231 60 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1583788-1583847 10 0.833
NZ_CP016809_6 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder 3048172-3048231 60 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 484370-484429 10 0.833
NZ_CP016809_6 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder 3048172-3048231 60 CP031730 Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence 312640-312699 10 0.833
NZ_CP016809_6 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder 3048172-3048231 60 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 485380-485439 11 0.817

1. spacer 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.85

ctctgcttgtaaggcagatgctctcccagctgagctaagcctccgaatatgtatggtagc	CRISPR spacer
ctctgcttgtaaggcagatgctctcccagctgagctaagcctccg---ttgtaagcgact	Protospacer
*********************************************    **** *  * .

2. spacer 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.85

ctctgcttgtaaggcagatgctctcccagctgagctaagcctccgaatatgtatggtagc	CRISPR spacer
ctctgcttgtaaggcagatgctctcccagctgagctaagcctccata-----atggtgac	Protospacer
********************************************. *     *****..*

3. spacer 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.85

ctctgcttgtaaggcagatgctctcccagctgagctaagcctccgaatatgtatggtagc	CRISPR spacer
ctctgcttgtaaggcagatgctctcccagctgagctaagcctccata-----atggtgac	Protospacer
********************************************. *     *****..*

4. spacer 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder matches to NZ_CP016544 (Planococcus donghaensis strain DSM 22276 plasmid pPD76, complete sequence) position: , mismatch: 9, identity: 0.85

ctctgcttgtaaggcagatgctctcccagctgagctaagcctccgaatatgtatggtagc	CRISPR spacer
ctctgcttgtaaggcagatgctctcccagctgagctaatcctccaaa-----atggtgac	Protospacer
************************************** *****.**     *****..*

5. spacer 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.833

ctctgcttgtaaggcagatgctctcccagctgagctaagcctccgaatatgtatggtagc	CRISPR spacer
ctctgcttgtaaggcagatgctctcccagctgagctaagcctccatg-----atggtgac	Protospacer
********************************************. .     *****..*

6. spacer 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.833

ctctgcttgtaaggcagatgctctcccagctgagctaagcctccgaatatgtatggtagc	CRISPR spacer
ctctgcttgtaaggcagatgctctcccagctgagctaatcctcc------atatggtgac	Protospacer
************************************** *****      .******..*

7. spacer 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder matches to CP031730 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.833

ctctgcttgtaaggcagatgctctcccagctgagctaagcctccgaata------tgtat	CRISPR spacer
ctctgcttgtaaggcagatgctctcccagctgagctaatcctccatagaaacaggtgtat	Protospacer
************************************** *****. * *      *****

8. spacer 6.1|3048172|60|NZ_CP016809|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.817

ctctgcttgtaaggcagatgctctcccagctgagctaagcctccgaatatgtatggtagc	CRISPR spacer
ctctgcttgtaaggcagatgctctcccagctgagctaatcctcca-----ttttggtgac	Protospacer
************************************** *****.      * ****..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 16158 12 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_2 78827 : 79823 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_3 90104 : 91916 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_4 97967 : 99506 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_5 104688 : 106434 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_6 111774 : 112485 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_7 117665 : 122382 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_8 126711 : 127446 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_9 132571 : 136110 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_10 143806 : 149524 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_11 155230 : 156001 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_12 161314 : 164023 3 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_13 167199 : 167832 1 Salicola_phage(100.0%) NA NA
DBSCAN-SWA_14 177407 : 178142 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_15 186830 : 188261 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_16 195056 : 195989 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_17 205156 : 206167 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_18 217453 : 220648 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_19 224952 : 227659 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_20 234125 : 236528 2 Orpheovirus(50.0%) NA NA
DBSCAN-SWA_21 266927 : 270991 4 Cowpox_virus(33.33%) NA NA
DBSCAN-SWA_22 288612 : 290555 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_23 313897 : 318456 6 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_24 341646 : 342501 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_25 355079 : 359422 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_26 371018 : 372378 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_27 377194 : 379854 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_28 385974 : 390944 4 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_29 404198 : 405485 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_30 409144 : 413305 5 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_31 418982 : 419924 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_32 447470 : 448253 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_33 455670 : 457547 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_34 467586 : 470034 2 Bordetella_phage(50.0%) NA NA
DBSCAN-SWA_35 477856 : 483884 5 Malacosoma_sp._alphabaculovirus(50.0%) NA NA
DBSCAN-SWA_36 497124 : 500196 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_37 510393 : 511092 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_38 517310 : 518846 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_39 540029 : 545449 4 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_40 552419 : 556008 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_41 563161 : 570596 7 Erysipelothrix_phage(25.0%) NA NA
DBSCAN-SWA_42 576864 : 578001 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_43 624269 : 625355 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_44 632255 : 633878 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_45 641584 : 647822 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_46 651041 : 656656 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_47 667148 : 671098 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_48 680369 : 691903 10 Megavirus(16.67%) NA NA
DBSCAN-SWA_49 695903 : 696530 1 Phage_Wrath(100.0%) NA NA
DBSCAN-SWA_50 700033 : 771007 77 Paenibacillus_phage(36.17%) capsid,protease,terminase,coat,head,portal,tRNA,holin,integrase,tail attL 701462:701521|attR 743020:743112
DBSCAN-SWA_51 794841 : 802500 3 Hokovirus(33.33%) NA NA
DBSCAN-SWA_52 807840 : 820793 9 Bacillus_phage(50.0%) protease NA
DBSCAN-SWA_53 830482 : 834333 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_54 838250 : 843309 4 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_55 855639 : 861494 5 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_56 864831 : 867699 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_57 872089 : 873388 1 unidentified_phage(100.0%) tRNA NA
DBSCAN-SWA_58 877745 : 878615 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_59 888714 : 894413 6 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_60 897835 : 900555 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_61 906445 : 908581 3 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_62 927951 : 931787 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_63 938089 : 947904 12 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_64 952573 : 957384 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_65 968498 : 969920 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_66 987042 : 989272 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_67 1005661 : 1006588 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_68 1010596 : 1015529 5 Bacillus_virus(33.33%) tRNA NA
DBSCAN-SWA_69 1021784 : 1023644 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_70 1027032 : 1030185 2 Citrobacter_phage(50.0%) NA NA
DBSCAN-SWA_71 1061303 : 1066681 4 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_72 1094920 : 1117382 20 Klosneuvirus(22.22%) NA NA
DBSCAN-SWA_73 1122224 : 1124411 1 Salmon_gill_poxvirus(100.0%) NA NA
DBSCAN-SWA_74 1127750 : 1133997 6 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_75 1138233 : 1141023 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_76 1148495 : 1150316 1 Acidianus_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_77 1158970 : 1160947 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_78 1166168 : 1167893 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_79 1172817 : 1176461 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_80 1180138 : 1181560 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_81 1187438 : 1188566 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_82 1192590 : 1193151 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_83 1222371 : 1224364 2 Equid_gammaherpesvirus(50.0%) NA NA
DBSCAN-SWA_84 1234441 : 1235083 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_85 1239043 : 1253768 12 Bodo_saltans_virus(40.0%) tRNA NA
DBSCAN-SWA_86 1258645 : 1260228 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_87 1281707 : 1286754 4 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_88 1296644 : 1297976 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_89 1303554 : 1318761 14 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_90 1328650 : 1329622 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_91 1334707 : 1345183 6 Xanthomonas_phage(33.33%) NA NA
DBSCAN-SWA_92 1349014 : 1351926 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_93 1357021 : 1362423 4 Catovirus(33.33%) NA NA
DBSCAN-SWA_94 1365475 : 1367293 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_95 1374525 : 1382055 5 Clostridium_botulinum_C_phage(33.33%) tRNA NA
DBSCAN-SWA_96 1412492 : 1413191 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_97 1417714 : 1418740 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_98 1455323 : 1457138 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_99 1480306 : 1481056 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_100 1492557 : 1494078 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_101 1497958 : 1498948 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_102 1502445 : 1503204 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_103 1511582 : 1525290 13 Phage_TP(40.0%) tRNA NA
DBSCAN-SWA_104 1529142 : 1537604 7 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_105 1542924 : 1553621 9 Yellowstone_lake_phycodnavirus(16.67%) tRNA NA
DBSCAN-SWA_106 1559144 : 1564487 4 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_107 1573863 : 1575552 1 Bacillus_amyloliquefaciens_phage(100.0%) NA NA
DBSCAN-SWA_108 1603398 : 1609226 3 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_109 1617552 : 1628118 8 Moraxella_phage(40.0%) protease NA
DBSCAN-SWA_110 1638637 : 1649950 10 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_111 1664570 : 1665707 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_112 1668740 : 1668974 1 Caldibacillus_phage(100.0%) NA NA
DBSCAN-SWA_113 1674334 : 1677229 3 Powai_lake_megavirus(33.33%) NA NA
DBSCAN-SWA_114 1683478 : 1684210 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_115 1698533 : 1703153 6 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_116 1711241 : 1719086 7 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_117 1722751 : 1728787 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_118 1738443 : 1738962 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_119 1746188 : 1748186 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_120 1751998 : 1753796 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_121 1775091 : 1775841 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_122 1779002 : 1779995 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_123 1786346 : 1789935 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_124 1793635 : 1794373 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_125 1799635 : 1806298 7 Hokovirus(33.33%) protease NA
DBSCAN-SWA_126 1816848 : 1818887 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_127 1822046 : 1823678 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_128 1834946 : 1836149 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_129 1841451 : 1842468 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_130 1850357 : 1856462 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_131 1882139 : 1884095 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_132 1890842 : 1891925 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_133 1895032 : 1896523 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_134 1899816 : 1901559 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_135 1909794 : 1911273 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_136 1948232 : 1950098 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_137 1957378 : 1964022 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_138 1968473 : 1970219 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_139 1985270 : 1986767 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_140 1994192 : 1995790 3 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_141 1999230 : 2003424 4 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_142 2007686 : 2010431 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_143 2031123 : 2031975 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_144 2039791 : 2041684 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_145 2051596 : 2055276 3 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_146 2060733 : 2061408 1 Canid_alphaherpesvirus(100.0%) NA NA
DBSCAN-SWA_147 2070210 : 2071323 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_148 2080578 : 2083932 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_149 2098115 : 2101609 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_150 2105797 : 2106343 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_151 2113067 : 2113865 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_152 2118353 : 2120153 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_153 2123530 : 2125321 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_154 2152049 : 2153292 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_155 2157604 : 2162740 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_156 2168235 : 2171535 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_157 2190150 : 2190900 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_158 2205345 : 2206506 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_159 2209774 : 2210479 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_160 2214614 : 2219497 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_161 2227861 : 2228566 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_162 2233421 : 2238019 3 Streptococcus_phage(33.33%) transposase NA
DBSCAN-SWA_163 2253283 : 2254225 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_164 2269434 : 2271516 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_165 2289403 : 2306887 15 Synechococcus_phage(30.0%) NA NA
DBSCAN-SWA_166 2309964 : 2310735 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_167 2320608 : 2322330 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_168 2335811 : 2339306 2 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_169 2349148 : 2350924 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_170 2358472 : 2359345 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_171 2364954 : 2365956 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_172 2374154 : 2378419 5 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_173 2390081 : 2390690 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_174 2394243 : 2405621 9 Bacillus_virus(40.0%) NA NA
DBSCAN-SWA_175 2414029 : 2419044 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_176 2423583 : 2431471 6 Erwinia_phage(33.33%) NA NA
DBSCAN-SWA_177 2436012 : 2437977 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_178 2441019 : 2441784 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_179 2445000 : 2448503 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_180 2465949 : 2466627 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_181 2495774 : 2497597 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_182 2520788 : 2523890 1 Hyphantria_cunea_nuclear_polyhedrosis_virus(100.0%) NA NA
DBSCAN-SWA_183 2527776 : 2529558 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_184 2547780 : 2555710 6 uncultured_Mediterranean_phage(33.33%) holin NA
DBSCAN-SWA_185 2572621 : 2577092 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_186 2584167 : 2585076 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_187 2595358 : 2596018 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_188 2602606 : 2603332 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_189 2608550 : 2609306 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_190 2615275 : 2616190 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_191 2620929 : 2623209 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_192 2626855 : 2627515 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_193 2636475 : 2637306 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_194 2647964 : 2655227 6 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_195 2665246 : 2666077 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_196 2675515 : 2677012 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_197 2683876 : 2685847 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_198 2690795 : 2697457 7 Lactococcus_phage(25.0%) NA NA
DBSCAN-SWA_199 2713369 : 2715772 1 Alphaproteobacteria_virus(100.0%) NA NA
DBSCAN-SWA_200 2743328 : 2744051 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_201 2750260 : 2750980 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_202 2755639 : 2757265 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_203 2764508 : 2765183 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_204 2785768 : 2788729 1 Bombyx_mandarina_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_205 2799426 : 2800062 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_206 2803256 : 2805290 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_207 2808606 : 2811327 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_208 2815570 : 2816530 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_209 2824513 : 2825527 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_210 2857659 : 2859186 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_211 2865967 : 2867773 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_212 2877437 : 2878328 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_213 2886041 : 2887067 1 Clostridium_botulinum_C_phage(100.0%) NA NA
DBSCAN-SWA_214 2891987 : 2893700 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_215 2897180 : 2898734 1 Phormidium_phage(100.0%) NA NA
DBSCAN-SWA_216 2907346 : 2921563 14 Lactococcus_phage(33.33%) NA NA
DBSCAN-SWA_217 2934683 : 2935262 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_218 2950729 : 2951482 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_219 2955292 : 2956372 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_220 2963488 : 2964790 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_221 2986531 : 2987821 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_222 2994307 : 2994904 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_223 2999170 : 3020055 19 Bacillus_phage(36.36%) NA NA
DBSCAN-SWA_224 3026141 : 3031325 5 Lactobacillus_phage(33.33%) coat NA
DBSCAN-SWA_225 3044887 : 3046012 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_226 3056202 : 3057930 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_227 3065151 : 3069396 3 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_228 3073328 : 3074186 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_229 3077422 : 3079495 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_230 3103465 : 3106099 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_231 3111578 : 3112052 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_232 3122544 : 3128717 5 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_233 3135167 : 3136679 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_234 3140098 : 3145225 5 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_235 3151964 : 3154662 2 Ostreococcus_tauri_virus(50.0%) protease NA
DBSCAN-SWA_236 3163228 : 3163501 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_237 3167210 : 3167753 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_238 3174279 : 3176707 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_239 3183106 : 3194319 12 Streptococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_240 3204915 : 3213830 7 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_241 3220950 : 3221850 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_242 3231021 : 3236585 6 Leptospira_phage(50.0%) protease NA
DBSCAN-SWA_243 3240185 : 3240662 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_244 3247114 : 3249054 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_245 3256283 : 3274317 14 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_246 3297803 : 3300442 2 Serratia_phage(50.0%) NA NA
DBSCAN-SWA_247 3305111 : 3306023 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_248 3311149 : 3312178 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_249 3347672 : 3353023 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_250 3356194 : 3367331 9 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_251 3410377 : 3411850 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_252 3415840 : 3419008 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_253 3432121 : 3433006 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_254 3456154 : 3463696 9 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_255 3466771 : 3469025 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_256 3480460 : 3481231 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_257 3495134 : 3495908 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_258 3507490 : 3508549 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_259 3524779 : 3530294 5 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_260 3533423 : 3539583 7 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_261 3543949 : 3545719 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_262 3550599 : 3551751 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_263 3563731 : 3566273 2 Lactobacillus_phage(50.0%) transposase NA
DBSCAN-SWA_264 3579031 : 3580063 1 Epinotia_aporema_granulovirus(100.0%) NA NA
DBSCAN-SWA_265 3586771 : 3587689 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_266 3592983 : 3593703 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_267 3602042 : 3606136 2 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_268 3612592 : 3614296 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_269 3618557 : 3635332 12 Bacillus_phage(50.0%) holin,lysis NA
DBSCAN-SWA_270 3642512 : 3665865 22 Bacillus_phage(44.44%) NA NA
DBSCAN-SWA_271 3685384 : 3686659 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_272 3698586 : 3699501 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_273 3702529 : 3704263 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_274 3709352 : 3712685 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_275 3725050 : 3726223 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_276 3729395 : 3732839 3 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_277 3744635 : 3747559 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_278 3751957 : 3753676 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_279 3767774 : 3769655 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_280 3773901 : 3777490 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_281 3783399 : 3783636 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_282 3792493 : 3794365 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_283 3797578 : 3797776 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_284 3802484 : 3803597 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_285 3808854 : 3811102 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_286 3817900 : 3822382 4 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_287 3827198 : 3828146 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_288 3834784 : 3844089 5 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_289 3847246 : 3849760 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_290 3860563 : 3862429 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_291 3868884 : 3883340 11 Catovirus(33.33%) NA NA
DBSCAN-SWA_292 3887668 : 3890011 3 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_293 3897733 : 3907178 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_294 3915265 : 3918096 4 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_295 3947753 : 3950210 1 Cronobacter_phage(100.0%) protease NA
DBSCAN-SWA_296 3960076 : 3961483 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_297 3965086 : 3965620 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_298 3969418 : 3981643 7 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_299 4003122 : 4005138 2 Moumouvirus(50.0%) NA NA
DBSCAN-SWA_300 4026474 : 4028307 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_301 4032584 : 4034843 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_302 4037844 : 4038741 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_303 4041911 : 4049032 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_304 4055314 : 4062157 9 Mollivirus(25.0%) NA NA
DBSCAN-SWA_305 4071238 : 4072540 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_306 4082006 : 4083113 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_307 4099781 : 4101572 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_308 4113921 : 4115748 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_309 4119089 : 4120442 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_310 4128245 : 4130429 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_311 4136643 : 4144516 5 Pandoravirus(25.0%) NA NA
DBSCAN-SWA_312 4161888 : 4163520 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_313 4170880 : 4180083 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_314 4185241 : 4186685 2 Bacillus_virus(50.0%) protease NA
DBSCAN-SWA_315 4197160 : 4198084 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_316 4203662 : 4204376 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_317 4224131 : 4227378 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_318 4232199 : 4233288 1 Microcystis_virus(100.0%) NA NA
DBSCAN-SWA_319 4241953 : 4242175 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_320 4245247 : 4245475 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_321 4263576 : 4267222 4 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_322 4270686 : 4273996 5 Lake_Baikal_phage(50.0%) NA NA
DBSCAN-SWA_323 4279408 : 4351738 77 Bacillus_phage(25.71%) protease,portal,plate,holin,tail NA
DBSCAN-SWA_324 4356570 : 4359198 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_325 4370358 : 4392804 24 Bacillus_virus(18.18%) tRNA NA
DBSCAN-SWA_326 4396531 : 4398510 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_327 4409519 : 4410281 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_328 4416174 : 4417377 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_329 4424145 : 4426203 3 Yellowstone_lake_mimivirus(50.0%) NA NA
DBSCAN-SWA_330 4444653 : 4445538 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_331 4457040 : 4458162 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_332 4462332 : 4463262 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_333 4479347 : 4487306 9 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_334 4508772 : 4509558 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_335 4527563 : 4529444 1 Acanthamoeba_polyphaga_lentillevirus(100.0%) NA NA
DBSCAN-SWA_336 4537130 : 4538084 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_337 4542998 : 4547445 6 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_338 4556132 : 4562714 4 Tupanvirus(66.67%) tRNA NA
DBSCAN-SWA_339 4568664 : 4571034 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_340 4579931 : 4581570 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_341 4588033 : 4596181 6 Pandoravirus(25.0%) tRNA NA
DBSCAN-SWA_342 4600075 : 4603992 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_343 4610793 : 4626992 14 Enterobacteria_phage(12.5%) tRNA NA
DBSCAN-SWA_344 4639240 : 4639990 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_345 4644218 : 4644824 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_346 4654675 : 4655443 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_347 4663410 : 4671280 6 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_348 4676386 : 4681165 5 Clostridium_phage(25.0%) NA NA
DBSCAN-SWA_349 4696033 : 4698081 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_350 4712400 : 4716788 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_351 4724716 : 4746327 19 Bacillus_phage(45.45%) NA NA
DBSCAN-SWA_352 4750704 : 4752486 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_353 4779662 : 4780631 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_354 4801696 : 4803514 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_355 4816057 : 4821136 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_356 4824752 : 4827421 2 Cronobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_357 4833508 : 4837153 2 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_358 4840566 : 4841927 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_359 4846492 : 4847596 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_360 4852322 : 4853243 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_361 4866003 : 4866702 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_362 4906002 : 4913810 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_363 4928418 : 4932945 5 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_364 4938340 : 4939480 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_365 4952829 : 4956003 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_366 4965080 : 4978142 8 uncultured_Mediterranean_phage(20.0%) NA NA
DBSCAN-SWA_367 5006014 : 5006728 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_368 5011838 : 5012594 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_369 5032218 : 5039335 8 Arthrobacter_phage(33.33%) NA NA
DBSCAN-SWA_370 5044458 : 5053229 10 Acanthocystis_turfacea_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_371 5059439 : 5062161 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_372 5068222 : 5076529 8 Ostreococcus_tauri_virus(20.0%) NA NA
DBSCAN-SWA_373 5118730 : 5120371 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_374 5128344 : 5129151 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_375 5132528 : 5137543 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_376 5151887 : 5152370 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_377 5174184 : 5174610 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_378 5179598 : 5180762 1 Bacillus_virus(100.0%) holin NA
DBSCAN-SWA_379 5196096 : 5200676 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_380 5219264 : 5223396 5 Cedratvirus(33.33%) NA NA
DBSCAN-SWA_381 5239084 : 5239873 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_382 5262253 : 5262757 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_383 5288948 : 5289761 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_384 5297174 : 5303371 6 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_385 5315082 : 5315421 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_386 5325485 : 5326274 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_387 5340023 : 5342736 4 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_388 5349322 : 5352658 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_389 5362301 : 5364035 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_390 5387375 : 5388626 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_391 5392807 : 5395453 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_392 5421448 : 5425704 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_393 5429046 : 5433061 5 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_394 5440104 : 5440620 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_395 5448894 : 5452102 4 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_396 5461180 : 5462296 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_397 5478963 : 5485753 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_398 5509546 : 5516230 5 Thermus_phage(33.33%) protease,tRNA NA
DBSCAN-SWA_399 5551731 : 5570426 15 Tupanvirus(33.33%) protease,tRNA NA
DBSCAN-SWA_400 5574722 : 5576412 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_401 5583933 : 5586573 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_402 5593770 : 5597288 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_403 5603956 : 5605018 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_404 5608843 : 5609104 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_405 5613448 : 5616356 3 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_406 5624960 : 5636203 10 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_407 5646180 : 5650173 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_408 5658872 : 5661386 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_409 5670194 : 5672879 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_410 5695753 : 5696653 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_411 5708213 : 5709008 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_412 5719328 : 5720261 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_413 5730835 : 5731684 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_414 5749857 : 5750808 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_415 5756674 : 5757421 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_416 5766323 : 5767367 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_417 5799691 : 5801551 2 Geobacillus_phage(50.0%) NA NA
DBSCAN-SWA_418 5813014 : 5819172 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_419 5837252 : 5843702 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_420 5855218 : 5855752 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_421 5869689 : 5876390 5 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_422 5886476 : 5888401 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_423 5913701 : 5917802 5 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_424 5931607 : 5932870 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_425 5946440 : 5947325 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_426 5954482 : 5955214 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_427 5962135 : 5965241 3 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_428 5971634 : 5973395 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_429 5985425 : 5986157 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_430 5992712 : 5993531 1 Acidianus_two-tailed_virus(100.0%) NA NA
DBSCAN-SWA_431 6000231 : 6006023 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_432 6010889 : 6011345 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_433 6016676 : 6018434 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_434 6063916 : 6068975 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_435 6095442 : 6095970 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_436 6112914 : 6126148 10 Herpes_simplex_virus(16.67%) integrase attL 6112970:6112985|attR 6123370:6123385
DBSCAN-SWA_437 6133769 : 6134684 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_438 6141933 : 6143379 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_439 6146701 : 6152538 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_440 6161092 : 6174589 10 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_441 6180143 : 6182201 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_442 6187626 : 6188355 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_443 6193745 : 6195035 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_444 6203598 : 6204375 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_445 6214741 : 6215470 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_446 6233151 : 6237432 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_447 6254835 : 6255432 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_448 6266566 : 6271920 6 Microcystis_phage(33.33%) NA NA
DBSCAN-SWA_449 6275832 : 6291104 14 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_450 6295585 : 6296464 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_451 6299524 : 6300934 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_452 6308712 : 6309615 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_453 6336722 : 6338069 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_454 6341150 : 6349845 8 Hokovirus(50.0%) NA NA
DBSCAN-SWA_455 6353422 : 6355330 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_456 6364783 : 6367460 3 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_457 6380193 : 6382665 2 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_458 6404212 : 6405442 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_459 6413370 : 6414138 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_460 6418831 : 6420960 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_461 6424294 : 6425248 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_462 6447055 : 6456668 10 Staphylococcus_phage(60.0%) NA NA
DBSCAN-SWA_463 6479393 : 6483896 4 Phaeocystis_globosa_virus(50.0%) transposase NA
DBSCAN-SWA_464 6515144 : 6518094 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_465 6532739 : 6533621 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_466 6536857 : 6537790 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_467 6541146 : 6541767 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_468 6554142 : 6556164 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_469 6563803 : 6565516 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_470 6572046 : 6572718 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_471 6585527 : 6586379 1 Staphylococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage