Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024244 Escherichia coli O128:H27 strain 90-9281 plasmid unnamed, complete sequence 0 crisprs DEDDh 0 0 3 0
NZ_CP024243 Escherichia coli O128:H27 strain 90-9281 chromosome, complete genome 7 crisprs DinG,RT,DEDDh,WYL,cas3,csa3,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,c2c9_V-U4 0 28 359 0

Results visualization

1. NZ_CP024244
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2150 : 26042 24 Stx2-converting_phage(33.33%) transposase NA
DBSCAN-SWA_2 72656 : 110458 35 Stx2-converting_phage(21.43%) integrase,transposase attL 91663:91722|attR 110464:111723
DBSCAN-SWA_3 122213 : 128561 8 Stx2-converting_phage(50.0%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP024243
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024243_1 181975-182066 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024243_2 1382001-1382165 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024243_3 2804378-2804773 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024243_4 2819371-2819488 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024243_5 3211662-3213459 TypeI-E I-E
29 spacers
cas3,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024243_6 3228961-3229722 TypeI-E I-E
12 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024243_7 4484049-4484172 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024243_1 1.1|182001|40|NZ_CP024243|CRISPRCasFinder 182001-182040 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP024243_7 7.1|4484092|38|NZ_CP024243|CRISPRCasFinder 4484092-4484129 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP024243_5 5.44|3212545|32|NZ_CP024243|CRISPRCasFinder,CRT 3212545-3212576 32 MG592456 Vibrio phage 1.081.O._10N.286.52.C2, partial genome 219798-219829 6 0.812
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP019314 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence 71972-72003 6 0.812
NZ_CP024243_5 5.15|3212544|33|NZ_CP024243|PILER-CR 3212544-3212576 33 MG592456 Vibrio phage 1.081.O._10N.286.52.C2, partial genome 219798-219830 7 0.788
NZ_CP024243_5 5.36|3212057|32|NZ_CP024243|CRISPRCasFinder,CRT 3212057-3212088 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 555773-555804 7 0.781
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 207611-207642 7 0.781
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 222835-222866 7 0.781
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 131047-131078 7 0.781
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 349369-349400 7 0.781
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 116770-116801 7 0.781
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 349371-349402 7 0.781
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 141808-141839 7 0.781
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 348980-349011 7 0.781
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 66681-66712 7 0.781
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 207610-207642 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 222835-222867 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 131047-131079 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 349369-349401 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 116770-116802 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 349371-349403 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 141807-141839 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 348980-349012 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 MN434096 Klebsiella phage JIPh_Kp127, complete genome 8414-8446 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 MK630230 Klebsiella phage Spivey, complete genome 1814-1846 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 MN434094 Klebsiella phage AmPh_EK80, complete genome 8419-8451 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 MG459987 Klebsiella phage Sugarland, complete genome 8643-8675 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 MT380195 Klebsiella phage KP_LZD_B01, complete genome 3481-3513 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 8404-8436 8 0.758
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 121617-121649 8 0.758
NZ_CP024243_5 5.19|3212788|33|NZ_CP024243|PILER-CR 3212788-3212820 33 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 152763-152795 8 0.758
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 MN434096 Klebsiella phage JIPh_Kp127, complete genome 8414-8445 8 0.75
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 MK630230 Klebsiella phage Spivey, complete genome 1815-1846 8 0.75
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 MN434094 Klebsiella phage AmPh_EK80, complete genome 8419-8450 8 0.75
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 MG459987 Klebsiella phage Sugarland, complete genome 8643-8674 8 0.75
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 MT380195 Klebsiella phage KP_LZD_B01, complete genome 3481-3512 8 0.75
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 8404-8435 8 0.75
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 121617-121648 8 0.75
NZ_CP024243_5 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT 3212423-3212454 32 NZ_CP040783 Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence 254266-254297 8 0.75
NZ_CP024243_5 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT 3212423-3212454 32 NZ_CP031069 Bacillus sp. JAS24-2 plasmid pl626, complete sequence 402616-402647 8 0.75
NZ_CP024243_5 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT 3212423-3212454 32 NZ_CP053952 Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence 15995-16026 8 0.75
NZ_CP024243_5 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT 3212423-3212454 32 CP020755 Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence 160650-160681 8 0.75
NZ_CP024243_5 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT 3212423-3212454 32 NZ_CP011156 Bacillus cereus strain HN001 plasmid pRML01, complete sequence 58852-58883 8 0.75
NZ_CP024243_5 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT 3212423-3212454 32 NC_020385 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-328, complete sequence 58853-58884 8 0.75
NZ_CP024243_5 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT 3212423-3212454 32 NZ_CP021062 Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence 376005-376036 8 0.75
NZ_CP024243_5 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT 3212423-3212454 32 NZ_CP053949 Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence 146145-146176 8 0.75
NZ_CP024243_5 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT 3212728-3212759 32 NC_010180 Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence 223698-223729 8 0.75
NZ_CP024243_5 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT 3212728-3212759 32 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 221508-221539 8 0.75
NZ_CP024243_5 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT 3212728-3212759 32 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 147474-147505 8 0.75
NZ_CP024243_5 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT 3212728-3212759 32 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 374123-374154 8 0.75
NZ_CP024243_5 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT 3212728-3212759 32 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 74049-74080 8 0.75
NZ_CP024243_5 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT 3212728-3212759 32 NZ_CP009691 Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence 130803-130834 8 0.75
NZ_CP024243_5 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT 3212728-3212759 32 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 195225-195256 8 0.75
NZ_CP024243_5 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT 3212728-3212759 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 471476-471507 8 0.75
NZ_CP024243_5 5.48|3212789|32|NZ_CP024243|CRISPRCasFinder,CRT 3212789-3212820 32 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 152763-152794 8 0.75
NZ_CP024243_5 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT 3213033-3213064 32 NZ_CP038236 Leisingera sp. NJS201 plasmid unnamed2, complete sequence 2813-2844 8 0.75
NZ_CP024243_5 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT 3213033-3213064 32 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 353558-353589 8 0.75
NZ_CP024243_5 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT 3213216-3213247 32 NZ_CP038236 Leisingera sp. NJS201 plasmid unnamed2, complete sequence 2813-2844 8 0.75
NZ_CP024243_5 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT 3213216-3213247 32 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 353558-353589 8 0.75
NZ_CP024243_5 5.20|3212849|33|NZ_CP024243|PILER-CR 3212849-3212881 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5210758-5210790 9 0.727
NZ_CP024243_5 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT 3212362-3212393 32 HQ615693 Synechococcus phage S-CRM01, complete genome 2748-2779 9 0.719
NZ_CP024243_5 5.46|3212667|32|NZ_CP024243|CRISPRCasFinder,CRT 3212667-3212698 32 NC_019699 Chroococcidiopsis thermalis PCC 7203 plasmid pCHRO.01, complete sequence 59399-59430 9 0.719
NZ_CP024243_5 5.46|3212667|32|NZ_CP024243|CRISPRCasFinder,CRT 3212667-3212698 32 MK962627 Achromobacter phage vB_AxyS_19-32_Axy06, complete genome 21335-21366 9 0.719
NZ_CP024243_5 5.48|3212789|32|NZ_CP024243|CRISPRCasFinder,CRT 3212789-3212820 32 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 161129-161160 9 0.719
NZ_CP024243_5 5.49|3212850|32|NZ_CP024243|CRISPRCasFinder,CRT 3212850-3212881 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5210759-5210790 9 0.719
NZ_CP024243_5 5.49|3212850|32|NZ_CP024243|CRISPRCasFinder,CRT 3212850-3212881 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 191956-191987 9 0.719
NZ_CP024243_5 5.49|3212850|32|NZ_CP024243|CRISPRCasFinder,CRT 3212850-3212881 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1498191-1498222 9 0.719
NZ_CP024243_5 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT 3213033-3213064 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1036450-1036481 9 0.719
NZ_CP024243_5 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT 3213033-3213064 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1555010-1555041 9 0.719
NZ_CP024243_5 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT 3213033-3213064 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 619383-619414 9 0.719
NZ_CP024243_5 5.53|3213094|32|NZ_CP024243|CRISPRCasFinder,CRT 3213094-3213125 32 NC_017140 Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence 5097-5128 9 0.719
NZ_CP024243_5 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT 3213216-3213247 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1036450-1036481 9 0.719
NZ_CP024243_5 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT 3213216-3213247 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1555010-1555041 9 0.719
NZ_CP024243_5 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT 3213216-3213247 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 619383-619414 9 0.719
NZ_CP024243_5 5.56|3213277|32|NZ_CP024243|CRISPRCasFinder,CRT 3213277-3213308 32 NC_017140 Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence 5097-5128 9 0.719
NZ_CP024243_5 5.58|3213399|32|NZ_CP024243|CRISPRCasFinder,CRT 3213399-3213430 32 MK249151 Blackfly microvirus SF02 isolate 049, complete genome 1908-1939 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 46007-46038 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 125777-125808 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 134655-134686 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 68724-68755 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 166140-166171 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 103164-103195 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 36015-36046 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 125777-125808 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 103085-103116 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 103164-103195 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 103163-103194 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 103161-103192 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 103161-103192 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 103085-103116 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 92301-92332 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 100863-100894 9 0.719
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 97248-97279 9 0.719
NZ_CP024243_6 6.3|3229112|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229112-3229143 32 NZ_CP033139 Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence 115828-115859 9 0.719
NZ_CP024243_6 6.3|3229112|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229112-3229143 32 KY579375 Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome 4523-4554 9 0.719
NZ_CP024243_6 6.3|3229112|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229112-3229143 32 EU030939 Sulfolobus spindle-shaped virus 5, complete genome 8793-8824 9 0.719
NZ_CP024243_6 6.3|3229112|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229112-3229143 32 JF412294 EBPR podovirus 1, partial sequence 3991-4022 9 0.719
NZ_CP024243_6 6.5|3229234|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229234-3229265 32 AP014927 Ralstonia phage RSF1 DNA, complete genome 171005-171036 9 0.719
NZ_CP024243_5 5.12|3212361|33|NZ_CP024243|PILER-CR 3212361-3212393 33 HQ615693 Synechococcus phage S-CRM01, complete genome 2747-2779 10 0.697
NZ_CP024243_5 5.18|3212727|33|NZ_CP024243|PILER-CR 3212727-3212759 33 NC_010180 Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence 223697-223729 10 0.697
NZ_CP024243_5 5.18|3212727|33|NZ_CP024243|PILER-CR 3212727-3212759 33 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 221507-221539 10 0.697
NZ_CP024243_5 5.18|3212727|33|NZ_CP024243|PILER-CR 3212727-3212759 33 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 374122-374154 10 0.697
NZ_CP024243_5 5.18|3212727|33|NZ_CP024243|PILER-CR 3212727-3212759 33 NZ_CP009691 Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence 130802-130834 10 0.697
NZ_CP024243_5 5.18|3212727|33|NZ_CP024243|PILER-CR 3212727-3212759 33 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 195224-195256 10 0.697
NZ_CP024243_5 5.18|3212727|33|NZ_CP024243|PILER-CR 3212727-3212759 33 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 147474-147506 10 0.697
NZ_CP024243_5 5.18|3212727|33|NZ_CP024243|PILER-CR 3212727-3212759 33 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 74049-74081 10 0.697
NZ_CP024243_5 5.18|3212727|33|NZ_CP024243|PILER-CR 3212727-3212759 33 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 471476-471508 10 0.697
NZ_CP024243_5 5.23|3213032|33|NZ_CP024243|PILER-CR 3213032-3213064 33 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1036449-1036481 10 0.697
NZ_CP024243_5 5.26|3213215|33|NZ_CP024243|PILER-CR 3213215-3213247 33 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1036449-1036481 10 0.697
NZ_CP024243_5 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT 3213033-3213064 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 823434-823465 10 0.688
NZ_CP024243_5 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT 3213033-3213064 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 682589-682620 10 0.688
NZ_CP024243_5 5.54|3213155|32|NZ_CP024243|CRISPRCasFinder,CRT 3213155-3213186 32 NZ_CP039902 Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence 33041-33072 10 0.688
NZ_CP024243_5 5.54|3213155|32|NZ_CP024243|CRISPRCasFinder,CRT 3213155-3213186 32 NZ_CP039893 Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence 217865-217896 10 0.688
NZ_CP024243_5 5.54|3213155|32|NZ_CP024243|CRISPRCasFinder,CRT 3213155-3213186 32 NZ_KY000025 Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence 208000-208031 10 0.688
NZ_CP024243_5 5.54|3213155|32|NZ_CP024243|CRISPRCasFinder,CRT 3213155-3213186 32 NZ_KY000029 Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence 208000-208031 10 0.688
NZ_CP024243_5 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT 3213216-3213247 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 823434-823465 10 0.688
NZ_CP024243_5 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT 3213216-3213247 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 682589-682620 10 0.688
NZ_CP024243_5 5.57|3213338|32|NZ_CP024243|CRISPRCasFinder,CRT 3213338-3213369 32 NZ_CP039902 Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence 33041-33072 10 0.688
NZ_CP024243_5 5.57|3213338|32|NZ_CP024243|CRISPRCasFinder,CRT 3213338-3213369 32 NZ_CP039893 Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence 217865-217896 10 0.688
NZ_CP024243_5 5.57|3213338|32|NZ_CP024243|CRISPRCasFinder,CRT 3213338-3213369 32 NZ_KY000025 Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence 208000-208031 10 0.688
NZ_CP024243_5 5.57|3213338|32|NZ_CP024243|CRISPRCasFinder,CRT 3213338-3213369 32 NZ_KY000029 Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence 208000-208031 10 0.688
NZ_CP024243_5 5.58|3213399|32|NZ_CP024243|CRISPRCasFinder,CRT 3213399-3213430 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 450688-450719 10 0.688
NZ_CP024243_6 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT 3229051-3229082 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1679246-1679277 10 0.688
NZ_CP024243_5 5.33|3211874|32|NZ_CP024243|CRISPRCasFinder,CRT 3211874-3211905 32 NZ_AP018282 Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome 109485-109516 11 0.656
NZ_CP024243_5 5.46|3212667|32|NZ_CP024243|CRISPRCasFinder,CRT 3212667-3212698 32 NZ_KY000056 Agrobacterium vitis strain Tun201 plasmid pTi_Tun201, complete sequence 141208-141239 11 0.656
NZ_CP024243_5 5.46|3212667|32|NZ_CP024243|CRISPRCasFinder,CRT 3212667-3212698 32 NZ_KY000060 Agrobacterium tumefaciens strain CFBP2407 plasmid pTi_CFBP2407, complete sequence 186805-186836 11 0.656

1. spacer 1.1|182001|40|NZ_CP024243|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

gcgctgcgggtcattcttgaaattccccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
************************ ***************

2. spacer 7.1|4484092|38|NZ_CP024243|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 5.44|3212545|32|NZ_CP024243|CRISPRCasFinder,CRT matches to MG592456 (Vibrio phage 1.081.O._10N.286.52.C2, partial genome) position: , mismatch: 6, identity: 0.812 

attcttgatcacgcttttaccgaagt--aatggt	CRISPR spacer
attgttgatcacgcttttactgaagttcgacg--	Protospacer
*** ****************.*****  .*.*

4. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812 

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
gcaccgttctcgcccaacagggcg-acaatctc	Protospacer
 *******.******* ******* ****.*.

5. spacer 5.15|3212544|33|NZ_CP024243|PILER-CR matches to MG592456 (Vibrio phage 1.081.O._10N.286.52.C2, partial genome) position: , mismatch: 7, identity: 0.788 

gattcttgatcacgcttttaccgaagt--aatggt	CRISPR spacer
cattgttgatcacgcttttactgaagttcgacg--	Protospacer
 *** ****************.*****  .*.*

6. spacer 5.36|3212057|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

-gtctgtgatggcctgctcgtgagtccgcggcg	CRISPR spacer
cgcgtg-gatggcctgctcgtcagttcgcgcct	Protospacer
 *. ** ************** ***.**** *

7. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 7, identity: 0.781 

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ******

8. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ******

9. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781 

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ******

10. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 7, identity: 0.781 

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ******

11. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ******

12. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781 

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ******

13. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781 

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ******

14. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ******

15. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
ccaccgtcttcgccgaccagggca-acgtcctc	Protospacer
*******.****** ********. **. **.

16. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ******

17. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ******

18. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ******

19. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ******

20. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ******

21. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ******

22. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ******

23. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
cttatagctatatctttgtgcattagagaaatc	Protospacer
  * ..************ ****** ******

24. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to MN434096 (Klebsiella phage JIPh_Kp127, complete genome) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*.

25. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*.

26. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to MN434094 (Klebsiella phage AmPh_EK80, complete genome) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*.

27. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*.

28. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*.

29. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*.

30. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.758 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
gatccggctatgcctttgagcattgccgtgact	Protospacer
***********..***********.* * .*.

31. spacer 5.19|3212788|33|NZ_CP024243|PILER-CR matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 8, identity: 0.758 

gagcgtcaatcagcgcgtctatcgcgtcacttt	CRISPR spacer
gggcgtcaatgagcgcgtcgatcgcggcgggat	Protospacer
*.******** ******** ****** *.   *

32. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to MN434096 (Klebsiella phage JIPh_Kp127, complete genome) position: , mismatch: 8, identity: 0.75 

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*.

33. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 8, identity: 0.75 

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*.

34. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to MN434094 (Klebsiella phage AmPh_EK80, complete genome) position: , mismatch: 8, identity: 0.75 

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*.

35. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 8, identity: 0.75 

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*.

36. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 8, identity: 0.75 

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*.

37. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75 

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*.

38. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75 

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*.

39. spacer 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP040783 (Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcttacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

40. spacer 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 8, identity: 0.75 

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

41. spacer 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP053952 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

42. spacer 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 8, identity: 0.75 

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

43. spacer 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 8, identity: 0.75 

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

44. spacer 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NC_020385 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-328, complete sequence) position: , mismatch: 8, identity: 0.75 

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

45. spacer 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP021062 (Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence) position: , mismatch: 8, identity: 0.75 

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

46. spacer 5.42|3212423|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP053949 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

47. spacer 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NC_010180 (Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

48. spacer 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

49. spacer 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

50. spacer 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

51. spacer 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

52. spacer 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

53. spacer 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

54. spacer 5.47|3212728|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  *******

55. spacer 5.48|3212789|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 8, identity: 0.75 

agcgtcaatcagcgcgtctatcgcgtcacttt	CRISPR spacer
ggcgtcaatgagcgcgtcgatcgcggcgggat	Protospacer
.******** ******** ****** *.   *

56. spacer 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP038236 (Leisingera sp. NJS201 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tcgagcccgatcatcggcatcagcagttccgg	Protospacer
.**********.******** ***..* * *.

57. spacer 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tcgaccccgattatcgggatgagctcggcgtg	Protospacer
.*** ************ ******   *** .

58. spacer 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP038236 (Leisingera sp. NJS201 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tcgagcccgatcatcggcatcagcagttccgg	Protospacer
.**********.******** ***..* * *.

59. spacer 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tcgaccccgattatcgggatgagctcggcgtg	Protospacer
.*** ************ ******   *** .

60. spacer 5.20|3212849|33|NZ_CP024243|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727 

gatttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
ggtcgaacggtatgcgggcgccgagccgttcga	Protospacer
*.*. .. ****** *.***************.

61. spacer 5.41|3212362|32|NZ_CP024243|CRISPRCasFinder,CRT matches to HQ615693 (Synechococcus phage S-CRM01, complete genome) position: , mismatch: 9, identity: 0.719 

atccggctatatctttgagcattacagaaata	CRISPR spacer
gcctcaatatatcattgagcaatacagaaatt	Protospacer
..*. . ****** ******* *********

62. spacer 5.46|3212667|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NC_019699 (Chroococcidiopsis thermalis PCC 7203 plasmid pCHRO.01, complete sequence) position: , mismatch: 9, identity: 0.719 

cggcgttccgtgcggcaattggaatcacacca	CRISPR spacer
agagaatccctgcggcaattggaatcccagcc	Protospacer
 *. . *** **************** ** *

63. spacer 5.46|3212667|32|NZ_CP024243|CRISPRCasFinder,CRT matches to MK962627 (Achromobacter phage vB_AxyS_19-32_Axy06, complete genome) position: , mismatch: 9, identity: 0.719 

cggcgttccgtgcggcaattggaatcacacca	CRISPR spacer
cggcgttccgtccggcaactggatgcccttgt	Protospacer
*********** ******.****  * * .

64. spacer 5.48|3212789|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

agcgtcaatcagcgcgtctatcgcgtcacttt	CRISPR spacer
gaactcaatcagcgcgttcatcgcgtcgcgat	Protospacer
..  *************..********.*  *

65. spacer 5.49|3212850|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
gtcgaacggtatgcgggcgccgagccgttcga	Protospacer
.*. .. ****** *.***************.

66. spacer 5.49|3212850|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt	Protospacer
*  .*   ******* ********.******

67. spacer 5.49|3212850|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719 

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt	Protospacer
*  .*   ******* ********.******

68. spacer 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tgaattaggattatcgacatgagcgatacgga	Protospacer
. .* .  ********.**********.****

69. spacer 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct	Protospacer
 **********.*********.**  .* *

70. spacer 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct	Protospacer
 **********.*********.**  .* *

71. spacer 5.53|3213094|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NC_017140 (Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaagaagaaagggaaataatgcgaggaacg	CRISPR spacer
atggagaagaaagggaaacaaagcgagcgcgg	Protospacer
 .*.**************.** ***** .  *

72. spacer 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tgaattaggattatcgacatgagcgatacgga	Protospacer
. .* .  ********.**********.****

73. spacer 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct	Protospacer
 **********.*********.**  .* *

74. spacer 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct	Protospacer
 **********.*********.**  .* *

75. spacer 5.56|3213277|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NC_017140 (Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgaagaagaaagggaaataatgcgaggaacg	CRISPR spacer
atggagaagaaagggaaacaaagcgagcgcgg	Protospacer
 .*.**************.** ***** .  *

76. spacer 5.58|3213399|32|NZ_CP024243|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719 

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat	Protospacer
  *. *  ***.************* *****

77. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

78. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

79. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

80. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

81. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gcaccgttttcgccgatcagggcggtgacctt	Protospacer
 ************* *.*******   * *..

82. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

83. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

84. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

85. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

86. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

87. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

88. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

89. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

90. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

91. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

92. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

93. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

94. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

95. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

96. spacer 6.3|3229112|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033139 (Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gaaaaagagaatgtagaggaagcgtttttctt	Protospacer
*********** ******.*****   *..

97. spacer 6.3|3229112|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to KY579375 (Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gacaaagagaaagtagagaaagcgattttctt	Protospacer
** ********.************.  *..

98. spacer 6.3|3229112|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to EU030939 (Sulfolobus spindle-shaped virus 5, complete genome) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gacaaagagaaagtagagaaagcgattttctt	Protospacer
** ********.************.  *..

99. spacer 6.3|3229112|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to JF412294 (EBPR podovirus 1, partial sequence) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gaaaaagagaaggccgagaaagcagcgaaggc	Protospacer
*************. ********.* .   *

100. spacer 6.5|3229234|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to AP014927 (Ralstonia phage RSF1 DNA, complete genome) position: , mismatch: 9, identity: 0.719 

gcgcaccgttgcgtcgaaaaggcgctggagat	CRISPR spacer
cagacccgtttcgtcgaacaggcgctggcgtg	Protospacer
  *  ***** ******* ********* *

101. spacer 5.12|3212361|33|NZ_CP024243|PILER-CR matches to HQ615693 (Synechococcus phage S-CRM01, complete genome) position: , mismatch: 10, identity: 0.697 

gatccggctatatctttgagcattacagaaata	CRISPR spacer
tgcctcaatatatcattgagcaatacagaaatt	Protospacer
 ..*. . ****** ******* *********

102. spacer 5.18|3212727|33|NZ_CP024243|PILER-CR matches to NC_010180 (Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  *******

103. spacer 5.18|3212727|33|NZ_CP024243|PILER-CR matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  *******

104. spacer 5.18|3212727|33|NZ_CP024243|PILER-CR matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  *******

105. spacer 5.18|3212727|33|NZ_CP024243|PILER-CR matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  *******

106. spacer 5.18|3212727|33|NZ_CP024243|PILER-CR matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  *******

107. spacer 5.18|3212727|33|NZ_CP024243|PILER-CR matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  *******

108. spacer 5.18|3212727|33|NZ_CP024243|PILER-CR matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  *******

109. spacer 5.18|3212727|33|NZ_CP024243|PILER-CR matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 10, identity: 0.697 

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  *******

110. spacer 5.23|3213032|33|NZ_CP024243|PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.697 

gccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
ttgaattaggattatcgacatgagcgatacgga	Protospacer
 . .* .  ********.**********.****

111. spacer 5.26|3213215|33|NZ_CP024243|PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.697 

gccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
ttgaattaggattatcgacatgagcgatacgga	Protospacer
 . .* .  ********.**********.****

112. spacer 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta	Protospacer
 . .   ****.*********.******** *

113. spacer 5.52|3213033|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta	Protospacer
 . .   ****.*********.******** *

114. spacer 5.54|3213155|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

115. spacer 5.54|3213155|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

116. spacer 5.54|3213155|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

117. spacer 5.54|3213155|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

118. spacer 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta	Protospacer
 . .   ****.*********.******** *

119. spacer 5.55|3213216|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta	Protospacer
 . .   ****.*********.******** *

120. spacer 5.57|3213338|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

121. spacer 5.57|3213338|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

122. spacer 5.57|3213338|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

123. spacer 5.57|3213338|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

124. spacer 5.58|3213399|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt	Protospacer
 * ..***** *****.*********** ..

125. spacer 6.2|3229051|32|NZ_CP024243|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
ccaccgtattcgccaaccagggcggcagggaa	Protospacer
******* ****** *********   ..

126. spacer 5.33|3211874|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_AP018282 (Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome) position: , mismatch: 11, identity: 0.656 

acggcgtggattgagggacgggtatttggtcc	CRISPR spacer
gcggagtggattgaggtacgggtaaagaagga	Protospacer
.*** *********** *******   ..

127. spacer 5.46|3212667|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_KY000056 (Agrobacterium vitis strain Tun201 plasmid pTi_Tun201, complete sequence) position: , mismatch: 11, identity: 0.656 

cggcgttccgtgcggcaattggaatcacacca	CRISPR spacer
ttttcttccgtgcggcaattcgtatcacggat	Protospacer
.  . *************** * *****.

128. spacer 5.46|3212667|32|NZ_CP024243|CRISPRCasFinder,CRT matches to NZ_KY000060 (Agrobacterium tumefaciens strain CFBP2407 plasmid pTi_CFBP2407, complete sequence) position: , mismatch: 11, identity: 0.656 

cggcgttccgtgcggcaattggaatcacacca	CRISPR spacer
ttttcttccgtgcggcaattcgtatcacggat	Protospacer
.  . *************** * *****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6801 5 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_2 33561 : 35249 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_3 43785 : 46107 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_4 51974 : 55703 5 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_5 58839 : 60210 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_6 65330 : 67308 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_7 70584 : 74307 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_8 81596 : 81854 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_9 94185 : 95828 2 Streptococcus_virus(50.0%) NA NA
DBSCAN-SWA_10 99100 : 100282 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_11 112640 : 113582 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_12 129428 : 129674 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_13 134336 : 135257 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_14 144565 : 145099 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_15 149232 : 150066 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_16 154936 : 157498 2 Acinetobacter_phage(50.0%) transposase NA
DBSCAN-SWA_17 164317 : 165241 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_18 180017 : 182117 3 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_19 186420 : 198675 13 Klosneuvirus(20.0%) NA NA
DBSCAN-SWA_20 217940 : 218600 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_21 222833 : 224888 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_22 237498 : 239406 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_23 255328 : 266461 8 Bacillus_virus(20.0%) tRNA NA
DBSCAN-SWA_24 281166 : 285707 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_25 290793 : 291882 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_26 295980 : 299195 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_27 305504 : 329302 16 Escherichia_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_28 338599 : 340318 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_29 343905 : 346643 4 Roseobacter_phage(50.0%) NA NA
DBSCAN-SWA_30 349980 : 359131 11 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_31 367697 : 368900 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_32 380234 : 382106 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_33 385424 : 490242 118 Enterobacteria_phage(40.85%) transposase,lysis,integrase,portal,terminase,capsid,head,tail attL 418472:418507|attR 491676:491711
DBSCAN-SWA_34 499953 : 506527 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_35 510883 : 514403 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_36 550443 : 551235 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_37 554613 : 557555 2 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_38 562018 : 574739 8 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_39 581394 : 582159 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_40 586308 : 590122 2 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_41 594748 : 596413 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_42 600509 : 601589 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_43 609485 : 613018 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_44 619956 : 622539 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_45 629549 : 631989 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_46 636804 : 637451 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_47 652875 : 654990 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_48 658057 : 659880 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_49 674426 : 680469 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_50 691394 : 694538 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_51 697683 : 707813 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_52 724147 : 727278 4 Enterococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_53 738698 : 739844 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_54 746034 : 747816 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_55 754723 : 755410 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_56 758546 : 759224 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_57 763763 : 766723 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_58 774917 : 783479 8 Acanthamoeba_polyphaga_moumouvirus(25.0%) NA NA
DBSCAN-SWA_59 790487 : 793637 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_60 802472 : 806019 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_61 809342 : 810038 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_62 813166 : 818213 4 Bacillus_phage(25.0%) protease NA
DBSCAN-SWA_63 842044 : 851025 10 uncultured_Mediterranean_phage(60.0%) tRNA NA
DBSCAN-SWA_64 857977 : 867949 7 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_65 872292 : 873408 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_66 880823 : 885599 3 uncultured_Caudovirales_phage(50.0%) transposase NA
DBSCAN-SWA_67 890135 : 890903 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_68 896199 : 897309 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_69 900387 : 902348 2 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_70 907759 : 912039 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_71 916580 : 922175 4 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_72 930555 : 935093 4 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_73 947087 : 1055603 105 Shigella_phage(57.38%) transposase,integrase,plate,portal,terminase,protease,holin,capsid,head,tail attL 1008422:1008467|attR 1051702:1051747
DBSCAN-SWA_74 1060280 : 1061447 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_75 1066498 : 1070417 6 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_76 1081321 : 1083463 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_77 1087179 : 1151008 53 Enterobacteria_phage(11.11%) protease,transposase,tRNA,plate NA
DBSCAN-SWA_78 1162891 : 1164316 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_79 1168245 : 1168590 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_80 1174501 : 1175299 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_81 1180542 : 1187348 6 Acanthamoeba_polyphaga_mimivirus(50.0%) tRNA NA
DBSCAN-SWA_82 1197254 : 1198157 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_83 1201419 : 1203694 3 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_84 1207770 : 1209321 1 Mamastrovirus(100.0%) NA NA
DBSCAN-SWA_85 1216970 : 1218395 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_86 1227022 : 1227574 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_87 1231819 : 1232863 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_88 1258836 : 1260561 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_89 1273263 : 1273962 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_90 1280294 : 1285717 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_91 1293461 : 1294861 2 Microcystis_phage(50.0%) NA NA
DBSCAN-SWA_92 1302756 : 1308415 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_93 1313885 : 1315034 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_94 1319440 : 1322257 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_95 1329290 : 1338359 9 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_96 1351406 : 1353520 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_97 1356751 : 1362106 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_98 1368826 : 1370149 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_99 1376286 : 1379162 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_100 1387169 : 1388449 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_101 1391673 : 1397038 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_102 1402821 : 1412641 7 Bodo_saltans_virus(25.0%) transposase NA
DBSCAN-SWA_103 1420141 : 1420696 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_104 1427219 : 1428680 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_105 1435407 : 1439752 5 Stx2-converting_phage(75.0%) transposase NA
DBSCAN-SWA_106 1446910 : 1451609 4 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_107 1457262 : 1460553 2 Acinetobacter_phage(50.0%) transposase NA
DBSCAN-SWA_108 1471387 : 1475647 2 Nostoc_phage(50.0%) NA NA
DBSCAN-SWA_109 1483506 : 1484526 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_110 1489655 : 1498697 6 Klebsiella_phage(33.33%) tRNA NA
DBSCAN-SWA_111 1507749 : 1514206 7 Paramecium_bursaria_Chlorella_virus(66.67%) transposase NA
DBSCAN-SWA_112 1517844 : 1520605 2 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_113 1524847 : 1531505 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_114 1573539 : 1574703 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_115 1578635 : 1591666 11 Lactococcus_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_116 1595581 : 1596127 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_117 1603555 : 1604533 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_118 1609453 : 1609987 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_119 1615777 : 1617761 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_120 1626074 : 1627265 1 Enterobacteria_phage(100.0%) integrase attL 1621043:1621056|attR 1631747:1631760
DBSCAN-SWA_121 1638214 : 1638996 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_122 1658247 : 1658724 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_123 1667052 : 1672926 9 Yersinia_phage(25.0%) transposase NA
DBSCAN-SWA_124 1680189 : 1683401 2 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_125 1704598 : 1706101 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_126 1710940 : 1711729 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_127 1717352 : 1718902 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_128 1722887 : 1724873 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_129 1730118 : 1732266 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_130 1741548 : 1743507 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_131 1749090 : 1750440 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_132 1754257 : 1757870 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_133 1762077 : 1764625 2 Yellowstone_lake_mimivirus(50.0%) NA NA
DBSCAN-SWA_134 1771221 : 1771830 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_135 1781045 : 1782161 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_136 1797968 : 1798760 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_137 1804410 : 1808094 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_138 1823472 : 1825062 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_139 1830430 : 1832194 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_140 1841409 : 1849738 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_141 1853854 : 1856907 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_142 1865413 : 1867258 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_143 1874008 : 1875223 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_144 1887340 : 1894587 5 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_145 1907579 : 1911764 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_146 1917401 : 1921905 5 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_147 1933480 : 1938341 5 Feldmannia_irregularis_virus(33.33%) NA NA
DBSCAN-SWA_148 1953049 : 1956100 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_149 1964974 : 1967754 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_150 1984122 : 1986593 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_151 1990671 : 1993458 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_152 2007145 : 2007760 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_153 2016550 : 2019837 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_154 2032248 : 2034078 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_155 2041562 : 2045421 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_156 2048457 : 2051245 2 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_157 2067548 : 2073692 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_158 2077734 : 2083146 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_159 2092898 : 2094545 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_160 2107938 : 2113791 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_161 2116959 : 2117952 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_162 2129904 : 2133266 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_163 2138797 : 2142638 4 Cyanophage(50.0%) NA NA
DBSCAN-SWA_164 2153627 : 2154965 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_165 2165164 : 2172533 8 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_166 2177239 : 2178388 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_167 2182815 : 2183769 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_168 2190122 : 2199284 10 Aeromonas_phage(25.0%) NA NA
DBSCAN-SWA_169 2206588 : 2207923 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_170 2221185 : 2222577 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_171 2227698 : 2234449 6 Bordetella_phage(25.0%) NA NA
DBSCAN-SWA_172 2237821 : 2242384 7 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_173 2249822 : 2251916 2 Archaeal_BJ1_virus(50.0%) NA NA
DBSCAN-SWA_174 2255315 : 2264821 9 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_175 2286917 : 2297608 7 uncultured_Caudovirales_phage(66.67%) tRNA NA
DBSCAN-SWA_176 2326032 : 2327574 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_177 2332892 : 2333888 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_178 2338112 : 2338325 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_179 2341979 : 2344313 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_180 2354527 : 2356512 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_181 2403492 : 2404140 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_182 2409020 : 2411155 3 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_183 2414500 : 2416543 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_184 2433591 : 2436920 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_185 2444092 : 2449703 5 Stx2-converting_phage(75.0%) transposase NA
DBSCAN-SWA_186 2455350 : 2457428 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_187 2465112 : 2470995 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_188 2478888 : 2483020 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_189 2486026 : 2488845 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_190 2495326 : 2496809 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_191 2500349 : 2502160 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_192 2522168 : 2524616 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_193 2534797 : 2535847 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_194 2540226 : 2542620 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_195 2548589 : 2549468 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_196 2556031 : 2560543 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_197 2577521 : 2578358 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_198 2602593 : 2612134 9 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_199 2617704 : 2623278 7 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_200 2643155 : 2644627 2 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_201 2655130 : 2659284 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_202 2665788 : 2666673 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_203 2677238 : 2678282 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_204 2694777 : 2697302 2 uncultured_archaeal_virus(50.0%) protease NA
DBSCAN-SWA_205 2701268 : 2701766 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_206 2705470 : 2710218 5 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_207 2716967 : 2731761 17 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_208 2735829 : 2737307 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_209 2743935 : 2746808 2 Micromonas_pusilla_virus(50.0%) protease NA
DBSCAN-SWA_210 2750890 : 2757529 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_211 2763010 : 2764900 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_212 2772006 : 2779799 10 Diadromus_pulchellus_ascovirus(25.0%) NA NA
DBSCAN-SWA_213 2802807 : 2803953 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_214 2812272 : 2814567 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_215 2840800 : 2841766 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_216 2854187 : 2870382 12 Herpes_simplex_virus(16.67%) tRNA NA
DBSCAN-SWA_217 2876764 : 2878003 1 Sinorhizobium_phage(100.0%) tRNA NA
DBSCAN-SWA_218 2883140 : 2884574 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_219 2894089 : 2905051 12 Staphylococcus_phage(20.0%) NA NA
DBSCAN-SWA_220 2917163 : 2927986 9 Stx_converting_phage(25.0%) NA NA
DBSCAN-SWA_221 2935348 : 2936233 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_222 2959731 : 2960904 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_223 3015744 : 3016899 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_224 3030613 : 3031153 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_225 3049089 : 3050322 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_226 3058849 : 3064217 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_227 3068022 : 3083414 14 Brevibacillus_phage(14.29%) tRNA NA
DBSCAN-SWA_228 3107693 : 3108449 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_229 3131276 : 3133764 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_230 3143395 : 3150168 6 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_231 3155645 : 3171032 9 Klosneuvirus(16.67%) tRNA NA
DBSCAN-SWA_232 3182558 : 3183314 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_233 3188172 : 3189021 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_234 3200145 : 3201447 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_235 3205479 : 3211322 6 Only_Syngen_Nebraska_virus(33.33%) NA NA
DBSCAN-SWA_236 3232003 : 3234036 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_237 3237148 : 3240864 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_238 3246078 : 3253218 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_239 3271043 : 3272057 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_240 3279630 : 3280596 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_241 3286062 : 3291622 5 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_242 3304805 : 3310101 5 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_243 3314036 : 3318087 4 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_244 3327568 : 3341033 13 Acinetobacter_phage(28.57%) transposase,integrase attL 3314580:3314593|attR 3341343:3341356
DBSCAN-SWA_245 3354667 : 3355738 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_246 3361644 : 3364218 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_247 3370085 : 3371384 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_248 3376677 : 3382935 7 Achromobacter_phage(25.0%) tRNA NA
DBSCAN-SWA_249 3388706 : 3392449 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_250 3395907 : 3396168 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_251 3400288 : 3411596 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_252 3417354 : 3418866 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_253 3434030 : 3440487 8 Faustovirus(20.0%) NA NA
DBSCAN-SWA_254 3450372 : 3450804 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_255 3459633 : 3465928 6 Escherichia_phage(60.0%) NA NA
DBSCAN-SWA_256 3472362 : 3476364 4 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_257 3497406 : 3498120 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_258 3516167 : 3517118 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_259 3535672 : 3540610 6 Deep-sea_thermophilic_phage(33.33%) NA NA
DBSCAN-SWA_260 3544088 : 3559458 15 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_261 3585307 : 3586042 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_262 3589860 : 3590781 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_263 3594510 : 3602087 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_264 3608728 : 3654191 63 Enterobacteria_phage(55.0%) lysis,integrase,terminase,coat,protease,holin attL 3606260:3606276|attR 3656201:3656217
DBSCAN-SWA_265 3672054 : 3673140 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_266 3681722 : 3682859 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_267 3689335 : 3690853 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_268 3695064 : 3696937 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_269 3707496 : 3710724 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_270 3745138 : 3750142 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_271 3753294 : 3754197 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_272 3760090 : 3766092 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_273 3771518 : 3774146 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_274 3783845 : 3786695 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_275 3790972 : 3796771 5 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_276 3805538 : 3806156 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_277 3817855 : 3825503 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_278 3831257 : 3835558 4 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_279 3850056 : 3850914 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_280 3854983 : 3858769 3 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_281 3862463 : 3863984 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_282 3884296 : 3893738 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_283 3906303 : 4002112 92 Escherichia_phage(41.51%) lysis,transposase,integrase,tRNA,plate,portal,terminase,holin,capsid,head,tail attL 3933543:3933569|attR 3967261:3967287
DBSCAN-SWA_284 4006355 : 4013149 6 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_285 4018657 : 4040187 19 Bacillus_phage(15.38%) NA NA
DBSCAN-SWA_286 4047541 : 4048441 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_287 4056086 : 4057253 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_288 4061570 : 4068443 7 Stx2-converting_phage(71.43%) transposase NA
DBSCAN-SWA_289 4079628 : 4082038 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_290 4104410 : 4104629 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_291 4112025 : 4112445 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_292 4121453 : 4127772 3 Erysipelothrix_phage(66.67%) integrase attL 4124498:4124512|attR 4129992:4130006
DBSCAN-SWA_293 4164263 : 4173701 7 Bacillus_phage(50.0%) integrase attL 4169534:4169548|attR 4177333:4177347
DBSCAN-SWA_294 4178129 : 4178867 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_295 4192380 : 4195249 3 Leptospira_phage(50.0%) integrase attL 4189169:4189182|attR 4200310:4200323
DBSCAN-SWA_296 4200456 : 4208855 8 Burkholderia_phage(40.0%) NA NA
DBSCAN-SWA_297 4227062 : 4227731 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_298 4239528 : 4240281 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_299 4252272 : 4253787 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_300 4263873 : 4269517 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_301 4274769 : 4276503 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_302 4284398 : 4286449 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_303 4290467 : 4297531 9 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_304 4301529 : 4303005 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_305 4311061 : 4315531 7 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_306 4323027 : 4325076 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_307 4330407 : 4330617 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_308 4336257 : 4337814 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_309 4341676 : 4349783 8 Pandoravirus(33.33%) tRNA NA
DBSCAN-SWA_310 4359126 : 4360335 1 Salmonella_phage(100.0%) transposase NA
DBSCAN-SWA_311 4366286 : 4370863 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_312 4374181 : 4375036 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_313 4378279 : 4378921 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_314 4383847 : 4385809 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_315 4391407 : 4392061 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_316 4398825 : 4400046 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_317 4407522 : 4408350 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_318 4414477 : 4416739 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_319 4428040 : 4447634 19 Tupanvirus(22.22%) tRNA NA
DBSCAN-SWA_320 4466226 : 4471310 5 Lake_Baikal_phage(33.33%) NA NA
DBSCAN-SWA_321 4479600 : 4481867 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_322 4487371 : 4496163 9 Orpheovirus(20.0%) NA NA
DBSCAN-SWA_323 4504966 : 4506465 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_324 4513376 : 4514651 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_325 4534438 : 4536250 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_326 4546326 : 4547628 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_327 4557728 : 4622784 74 Enterobacteria_phage(46.94%) transposase,lysis,integrase,portal,terminase,protease,tail attL 4565304:4565320|attR 4595820:4595836
DBSCAN-SWA_328 4625889 : 4627589 2 Micromonas_pusilla_virus(50.0%) NA NA
DBSCAN-SWA_329 4632955 : 4633846 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_330 4643096 : 4643480 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_331 4651224 : 4652643 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_332 4660524 : 4662060 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_333 4665463 : 4670884 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_334 4687473 : 4694409 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_335 4699683 : 4703490 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_336 4707806 : 4709712 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_337 4712986 : 4714428 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_338 4720440 : 4720731 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_339 4727616 : 4729161 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_340 4736365 : 4741319 5 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_341 4747487 : 4751696 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_342 4758778 : 4760881 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_343 4768013 : 4769027 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_344 4772696 : 4778964 7 Cronobacter_phage(25.0%) transposase NA
DBSCAN-SWA_345 4790770 : 4791719 2 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_346 4795658 : 4799561 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_347 4830846 : 4831836 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_348 4836795 : 4844065 6 Enterobacteria_phage(20.0%) tRNA NA
DBSCAN-SWA_349 4850391 : 4850907 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_350 4867524 : 4868607 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_351 4882610 : 4883876 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_352 4896791 : 4902451 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_353 4910266 : 4910857 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_354 4915781 : 4921073 4 Tupanvirus(33.33%) protease NA
DBSCAN-SWA_355 4926006 : 4928964 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_356 4940621 : 4942636 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_357 4951045 : 4961055 10 Citrobacter_phage(25.0%) NA NA
DBSCAN-SWA_358 4972186 : 4972417 1 Spodoptera_litura_granulovirus(100.0%) NA NA
DBSCAN-SWA_359 4975518 : 4976373 1 Cafeteria_roenbergensis_virus(100.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage