Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024246 Escherichia coli O27:H7 strain B4103-1 plasmid unnamed1 0 crisprs NA 0 0 0 0
NZ_CP024247 Escherichia coli O27:H7 strain B4103-1 plasmid unnamed2 1 crisprs NA 0 2 0 0
NZ_CP024245 Escherichia coli O27:H7 strain B4103-1 chromosome, complete genome 8 crisprs RT,c2c9_V-U4,DEDDh,cas3,csa3,cas8e,cas5,cas6e,cas1,cas2,DinG 0 19 9 0
NZ_CP024248 Escherichia coli O27:H7 strain B4103-1 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP024245
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024245_1 198325-198474 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024245_2 1441164-1441281 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024245_3 1834553-1835069 TypeI-E I-E
8 spacers
cas3,cas8e,cas5,cas6e,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024245_4 1849157-1850345 TypeI-E I-E
19 spacers
cas2,cas1,cas6e,cas5,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024245_5 2993523-2993646 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024245_6 3694060-3694151 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024245_7 3956832-3956976 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024245_8 4386636-4386780 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024245_6 6.1|3694086|40|NZ_CP024245|CRISPRCasFinder 3694086-3694125 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP024245_4 4.6|1849492|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849492-1849523 32 MK972713 Salmonella phage SW5, complete genome 13980-14011 2 0.938
NZ_CP024245_4 4.6|1849492|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849492-1849523 32 MK972714 Salmonella phage SW3, complete genome 14202-14233 2 0.938
NZ_CP024245_4 4.6|1849492|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849492-1849523 32 NC_049460 Salmonella phage SI7, complete genome 4422-4453 2 0.938
NZ_CP024245_5 5.1|2993566|38|NZ_CP024245|CRISPRCasFinder 2993566-2993603 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 NZ_CP034578 Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08E, complete sequence 2106-2137 6 0.812
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 NZ_AP017930 Lactobacillus sakei subsp. sakei DSM 20017 = JCM 1157 strain LT-13 plasmid pLs13-a, complete sequence 4021-4052 6 0.812
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 NZ_CP043525 Lactococcus lactis subsp. lactis bv. diacetylactis strain SD96 plasmid pSD96_01, complete sequence 3312-3343 6 0.812
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 NZ_CP014889 Lactobacillus backii strain TMW 1.1991 plasmid pL11991-8, complete sequence 1082-1113 6 0.812
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 NC_015860 Lactococcus lactis subsp. lactis plasmid pIL1, complete sequence 3081-3112 6 0.812
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 143632-143663 6 0.812
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 NZ_CP044372 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-4, complete sequence 5474-5505 6 0.812
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 NZ_MG674581 Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence 148696-148727 6 0.812
NZ_CP024245_4 4.7|1849553|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849553-1849584 32 MN096267 Pseudomonas phage vB_PaS_IME307, complete genome 25909-25940 6 0.812
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NC_017804 Borreliella garinii BgVir plasmid lp54, complete sequence 27596-27627 7 0.781
NZ_CP024245_4 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849431-1849462 32 CP022460 Shigella sonnei strain 2015C-3807 plasmid unnamed1, complete sequence 32099-32130 7 0.781
NZ_CP024245_4 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849431-1849462 32 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 112025-112056 7 0.781
NZ_CP024245_4 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849431-1849462 32 NZ_LR027555 Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence 90457-90488 7 0.781
NZ_CP024245_4 4.14|1849980|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849980-1850011 32 NC_030948 Ralstonia phage RSP15 DNA, complete genome 100984-101015 7 0.781
NZ_CP024245_4 4.16|1850102|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1850102-1850133 32 MH572327 Microviridae sp. isolate SD_SC_83, complete genome 2441-2472 7 0.781
NZ_CP024245_4 4.17|1850163|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1850163-1850194 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 464898-464929 7 0.781
NZ_CP024245_4 4.17|1850163|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1850163-1850194 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 582322-582353 7 0.781
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229180-229234 7 0.873
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229281-229335 7 0.873
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239674-239728 7 0.873
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239775-239829 7 0.873
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230586-230640 7 0.873
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230687-230741 7 0.873
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211556-211610 7 0.873
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211657-211711 7 0.873
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NZ_CP014203 Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence 11893-11924 8 0.75
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NC_015254 Brochothrix phage BL3, complete genome 25082-25113 8 0.75
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 8127-8158 8 0.75
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NZ_CP010112 Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-6, complete sequence 87042-87073 8 0.75
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NC_018688 Bacillus thuringiensis MC28 plasmid pMC319, complete sequence 169690-169721 8 0.75
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 MK064565 Sulfolobales Beppu rod-shaped virus 1 clone D, complete genome 8044-8075 8 0.75
NZ_CP024245_4 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849431-1849462 32 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 81256-81287 8 0.75
NZ_CP024245_4 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849614-1849645 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 97634-97665 8 0.75
NZ_CP024245_4 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849614-1849645 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 97634-97665 8 0.75
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229382-229436 8 0.855
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239876-239930 8 0.855
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230788-230842 8 0.855
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211758-211812 8 0.855
NZ_CP024245_3 3.14|1834887|32|NZ_CP024245|CRISPRCasFinder,CRT 1834887-1834918 32 NC_017140 Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence 5097-5128 9 0.719
NZ_CP024245_3 3.16|1835009|32|NZ_CP024245|CRISPRCasFinder,CRT 1835009-1835040 32 MK249151 Blackfly microvirus SF02 isolate 049, complete genome 1908-1939 9 0.719
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 CP002494 Enterococcus faecalis 62 plasmid EF62pC, complete sequence 29844-29875 9 0.719
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NZ_CP036247 Enterococcus faecalis R712 plasmid pR712_01, complete sequence 74124-74155 9 0.719
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NC_012654 Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence 14309-14340 9 0.719
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NZ_CP031095 Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence 97821-97852 9 0.719
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 173597-173628 9 0.719
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NZ_CP027191 Lactobacillus sp. CBA3605 plasmid pCBA3605-1, complete sequence 35304-35335 9 0.719
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 NZ_CP013682 Clostridium botulinum strain 1169 plasmid pRSJ8_1, complete sequence 145876-145907 9 0.719
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 NZ_CP013295 Clostridium botulinum strain CDC_54064 plasmid pNPD1_1, complete sequence 156592-156623 9 0.719
NZ_CP024245_4 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849309-1849340 32 MN694366 Marine virus AFVG_250M1050, complete genome 2162-2193 9 0.719
NZ_CP024245_4 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849431-1849462 32 NZ_CP010647 Phaeobacter piscinae strain P36 plasmid pP36_d, complete sequence 70883-70914 9 0.719
NZ_CP024245_4 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849431-1849462 32 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 312646-312677 9 0.719
NZ_CP024245_4 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849614-1849645 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1077625-1077656 9 0.719
NZ_CP024245_4 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849614-1849645 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 146647-146678 9 0.719
NZ_CP024245_4 4.17|1850163|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1850163-1850194 32 MK279899 Arthrobacter phage Maja, complete genome 2068-2099 9 0.719
NZ_CP024245_4 4.17|1850163|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1850163-1850194 32 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 412875-412906 9 0.719
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87169-87223 9 0.836
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 158418-158472 9 0.836
NZ_CP024245_3 3.15|1834948|32|NZ_CP024245|CRISPRCasFinder,CRT 1834948-1834979 32 NZ_CP039902 Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence 33041-33072 10 0.688
NZ_CP024245_3 3.15|1834948|32|NZ_CP024245|CRISPRCasFinder,CRT 1834948-1834979 32 NZ_CP039893 Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence 217865-217896 10 0.688
NZ_CP024245_3 3.15|1834948|32|NZ_CP024245|CRISPRCasFinder,CRT 1834948-1834979 32 NZ_KY000025 Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence 208000-208031 10 0.688
NZ_CP024245_3 3.15|1834948|32|NZ_CP024245|CRISPRCasFinder,CRT 1834948-1834979 32 NZ_KY000029 Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence 208000-208031 10 0.688
NZ_CP024245_3 3.16|1835009|32|NZ_CP024245|CRISPRCasFinder,CRT 1835009-1835040 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 450688-450719 10 0.688
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 HG796351 Uncultured bacterium plasmid pRGI00631 201-232 10 0.688
NZ_CP024245_4 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849186-1849217 32 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 343912-343943 10 0.688
NZ_CP024245_4 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849431-1849462 32 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 699305-699336 10 0.688
NZ_CP024245_4 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849431-1849462 32 NC_015724 Cupriavidus necator N-1 plasmid pBB2, complete sequence 169020-169051 10 0.688
NZ_CP024245_4 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849614-1849645 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 233657-233688 10 0.688
NZ_CP024245_4 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849614-1849645 32 MH779515 Mycobacterium phage Sweets, complete genome 8986-9017 10 0.688
NZ_CP024245_4 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849614-1849645 32 MW119570 Mycobacterium phage Lang, complete genome 9011-9042 10 0.688
NZ_CP024245_4 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849614-1849645 32 NC_008202 Mycobacterium phage Halo, complete genome 8986-9017 10 0.688
NZ_CP024245_4 4.9|1849675|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849675-1849706 32 NZ_CP016891 Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence 23119-23150 10 0.688
NZ_CP024245_4 4.17|1850163|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1850163-1850194 32 NC_009939 Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence 70016-70047 10 0.688
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229079-229133 10 0.818
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239573-239627 10 0.818
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230485-230539 10 0.818
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211455-211509 10 0.818
NZ_CP024245_3 3.10|1834643|32|NZ_CP024245|CRISPRCasFinder,CRT 1834643-1834674 32 NZ_AP018282 Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome 109485-109516 11 0.656
NZ_CP024245_4 4.11|1849797|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1849797-1849828 32 NZ_CP043940 Lactobacillus nenjiangensis strain SH-Y15 plasmid pHY011, complete sequence 27381-27412 11 0.656
NZ_CP024245_4 4.15|1850041|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1850041-1850072 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1438103-1438134 11 0.656
NZ_CP024245_4 4.15|1850041|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT 1850041-1850072 32 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1587834-1587865 11 0.656
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194092-194146 11 0.8
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204586-204640 11 0.8
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195420-195474 11 0.8
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176375-176429 11 0.8
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27377-27431 11 0.8
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14103-14157 11 0.8
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194185-194239 12 0.782
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194278-194332 12 0.782
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204679-204733 12 0.782
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204772-204826 12 0.782
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195513-195567 12 0.782
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195606-195660 12 0.782
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176468-176522 12 0.782
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176561-176615 12 0.782
NZ_CP024245_8 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder 4386681-4386735 55 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27278-27332 12 0.782

1. spacer 6.1|3694086|40|NZ_CP024245|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 4.6|1849492|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 2, identity: 0.938

ccagcccttgttaacgtcttcgccgttcgggt	CRISPR spacer
ccagccgatgttaacgtcttcgccgttcgggt	Protospacer
******  ************************

3. spacer 4.6|1849492|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 2, identity: 0.938

ccagcccttgttaacgtcttcgccgttcgggt	CRISPR spacer
ccagccgatgttaacgtcttcgccgttcgggt	Protospacer
******  ************************

4. spacer 4.6|1849492|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 2, identity: 0.938

ccagcccttgttaacgtcttcgccgttcgggt	CRISPR spacer
ccagccgatgttaacgtcttcgccgttcgggt	Protospacer
******  ************************

5. spacer 5.1|2993566|38|NZ_CP024245|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

6. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034578 (Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08E, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

7. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017930 (Lactobacillus sakei subsp. sakei DSM 20017 = JCM 1157 strain LT-13 plasmid pLs13-a, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

8. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043525 (Lactococcus lactis subsp. lactis bv. diacetylactis strain SD96 plasmid pSD96_01, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

9. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014889 (Lactobacillus backii strain TMW 1.1991 plasmid pL11991-8, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

10. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_015860 (Lactococcus lactis subsp. lactis plasmid pIL1, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

11. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

12. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044372 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-4, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

13. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 6, identity: 0.812

caaaaaaatagattggaaaacatttagattca-	CRISPR spacer
taaaaaaataaattggaaaaaattt-gatgaat	Protospacer
.*********.********* **** ***  * 

14. spacer 4.7|1849553|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to MN096267 (Pseudomonas phage vB_PaS_IME307, complete genome) position: , mismatch: 6, identity: 0.812

ggggattcgcgtacctgcgcgccagttccccg-	CRISPR spacer
agggtttcgcgtatctgcgcgcca-ttcagcgc	Protospacer
.*** ********.********** ***  ** 

15. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_017804 (Borreliella garinii BgVir plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
aaagtttaaaaaaaatcaagttcaaaaaattg	Protospacer
**  *.*..****** ***.************

16. spacer 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to CP022460 (Shigella sonnei strain 2015C-3807 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gccgcgccgcactggcgctggcacggtatgca	CRISPR spacer
accgcgccgcactggcgctggcgcggtcgatg	Protospacer
.*********************.****  ...

17. spacer 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

gccgcgccgcactggcgctggcacggtatgca	CRISPR spacer
ggcgcgccgcaaaggcgctggcacggtctcgg	Protospacer
* *********  ************** *  .

18. spacer 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR027555 (Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781

gccgcgccgcactggcgctggcacggtatgca	CRISPR spacer
ggcgcgccgcaaaggcgctggcacggtctcgg	Protospacer
* *********  ************** *  .

19. spacer 4.14|1849980|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_030948 (Ralstonia phage RSP15 DNA, complete genome) position: , mismatch: 7, identity: 0.781

acaaaacgcgatcaatacagttttgttttgca	CRISPR spacer
ccgaaagaagatcaatacagttttgttcttca	Protospacer
 *.*** . ******************.* **

20. spacer 4.16|1850102|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to MH572327 (Microviridae sp. isolate SD_SC_83, complete genome) position: , mismatch: 7, identity: 0.781

ggatttgcattaacgcggcgtgaacattattt	CRISPR spacer
ggagttgcatgaacgcggcgtgagcctcgtta	Protospacer
*** ****** ************.* *..** 

21. spacer 4.17|1850163|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

ctgcaatcaccagcggcgcggc--gtggtttggt	CRISPR spacer
cggcaatcatcagcggcgcggcttgcggatcg--	Protospacer
* *******.************  *.** *.*  

22. spacer 4.17|1850163|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.781

ctgcaatcaccagcggcgcggc--gtggtttggt	CRISPR spacer
cggcaatcatcagcggcgcggcttgcggatcg--	Protospacer
* *******.************  *.** *.*  

23. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

24. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

25. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

26. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

27. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

28. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

29. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

30. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

31. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014203 (Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence) position: , mismatch: 8, identity: 0.75

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
tatgattggaaaaaaacaattttaaaaaataa	Protospacer
 **  .************* **.******* .

32. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_015254 (Brochothrix phage BL3, complete genome) position: , mismatch: 8, identity: 0.75

aatttctggaaaaaaacaaattca----aaaaattg	CRISPR spacer
aatttctcaaaaaaaacaaattcatcctgaag----	Protospacer
******* .***************    .**.    

33. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 8, identity: 0.75

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
tcttgttttaaaaaaaataattcaaaaaattg	Protospacer
  ** .*  *******  **************

34. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010112 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-6, complete sequence) position: , mismatch: 8, identity: 0.75

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
aatcaatggaaaaaaccaaatacaaaaaacaa	Protospacer
***.  ********* ***** *******. .

35. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_018688 (Bacillus thuringiensis MC28 plasmid pMC319, complete sequence) position: , mismatch: 8, identity: 0.75

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
aggagctacaaaaaaacaaattagaaaaattg	Protospacer
*.   **. ************* .********

36. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to MK064565 (Sulfolobales Beppu rod-shaped virus 1 clone D, complete genome) position: , mismatch: 8, identity: 0.75

caaaaaaatagattggaaaacatttagattca---	CRISPR spacer
acaaaaaagagactggaaaacattt---tttaatt	Protospacer
  ****** ***.************   **.*   

37. spacer 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 8, identity: 0.75

gccgcgccgcactggcgctggcacggtatgca	CRISPR spacer
gcgtcgccgcactggcgctgacactgttcgtg	Protospacer
**  ****************.*** ** .*..

38. spacer 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 8, identity: 0.75

atcactatcgtgatgctgacggcgcacagctc	CRISPR spacer
acgcccatcctgatgctgacggcgcgcagcga	Protospacer
*.  *.*** ***************.****  

39. spacer 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 8, identity: 0.75

atcactatcgtgatgctgacggcgcacagctc	CRISPR spacer
acgcccatcctgatgctgacggcgcgcagcga	Protospacer
*.  *.*** ***************.****  

40. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

41. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

42. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

43. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

44. spacer 3.14|1834887|32|NZ_CP024245|CRISPRCasFinder,CRT matches to NC_017140 (Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaagaagaaagggaaataatgcgaggaacg	CRISPR spacer
atggagaagaaagggaaacaaagcgagcgcgg	Protospacer
 .*.**************.** ***** .  *

45. spacer 3.16|1835009|32|NZ_CP024245|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat	Protospacer
  *. *  ***.************* ***** 

46. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to CP002494 (Enterococcus faecalis 62 plasmid EF62pC, complete sequence) position: , mismatch: 9, identity: 0.719

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
caacaaaagaaaaaaacagattcaaaaaaatg	Protospacer
 * .   .**********.********** **

47. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036247 (Enterococcus faecalis R712 plasmid pR712_01, complete sequence) position: , mismatch: 9, identity: 0.719

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
caacaaaagaaaaaaacagattcaaaaaaatg	Protospacer
 * .   .**********.********** **

48. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 9, identity: 0.719

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
tacgattggaaaaaaacaacctcaaaaaatgc	Protospacer
 *.  .************* .*********  

49. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 9, identity: 0.719

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
tacgattggaaaaaaacaacctcaaaaaatgc	Protospacer
 *.  .************* .*********  

50. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 9, identity: 0.719

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
taaaatggcaaaaaaagaaattcaaagaattg	Protospacer
 *   . * ******* *********.*****

51. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027191 (Lactobacillus sp. CBA3605 plasmid pCBA3605-1, complete sequence) position: , mismatch: 9, identity: 0.719

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
tgcctattgaaaaaaaaatattcaaaaaatta	Protospacer
 ...* * ******** * ************.

52. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013682 (Clostridium botulinum strain 1169 plasmid pRSJ8_1, complete sequence) position: , mismatch: 9, identity: 0.719

caaaaaaatagattggaaaacatttagattca	CRISPR spacer
agataaaatagattataaaacatttagaagac	Protospacer
 .* **********. ************    

53. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013295 (Clostridium botulinum strain CDC_54064 plasmid pNPD1_1, complete sequence) position: , mismatch: 9, identity: 0.719

caaaaaaatagattggaaaacatttagattca	CRISPR spacer
agataaaatagattataaaacatttagaagac	Protospacer
 .* **********. ************    

54. spacer 4.3|1849309|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to MN694366 (Marine virus AFVG_250M1050, complete genome) position: , mismatch: 9, identity: 0.719

caaaaaaatagattggaaaacatttagattca	CRISPR spacer
caaaaaaatagatttgaacacataaaaggcaa	Protospacer
************** *** ****  *.. . *

55. spacer 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010647 (Phaeobacter piscinae strain P36 plasmid pP36_d, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcgccgcactggcgctggcacggtatgca	CRISPR spacer
gctgcgccgccctggcgctggcaggctgcaag	Protospacer
**.******* ************ * *... .

56. spacer 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcgccgcactggcgctggcacggtatgca	CRISPR spacer
gcggcgcagcactggcgctggcagcaggcgta	Protospacer
** **** ***************  . ..*.*

57. spacer 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719

atcactatcgtgatgctgacggcgcacagctc	CRISPR spacer
ttctggcaggtgatgccgacggcgcccagctc	Protospacer
 **      *******.******** ******

58. spacer 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

atcactatcgtgatgctgacggcgcacagctc	CRISPR spacer
ttctggcaggtgatgccgacggcgcccagctc	Protospacer
 **      *******.******** ******

59. spacer 4.17|1850163|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to MK279899 (Arthrobacter phage Maja, complete genome) position: , mismatch: 9, identity: 0.719

ctgcaatcaccagcggcgcggcgtggtttggt	CRISPR spacer
tcactgccaccagcggcgcggcgtcgttgggc	Protospacer
...* ..***************** *** **.

60. spacer 4.17|1850163|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaatcaccagcggcgcggcgtggtttggt	CRISPR spacer
tggtagataccagcggcgcggcgaggttcggg	Protospacer
. *.*. .*************** ****.** 

61. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.836

ggcgca-cgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca--	CRISPR spacer
-gtgcaccgaatgccggatgcggcgtgaacgccttatccgtcctacaat--gcctgat	Protospacer
 *.*** *** ***************************** ****** *  ***..  

62. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.836

ggcgcacgactgccggatgcggcgtgaacgccttatccggc--ctacacttcgccca	CRISPR spacer
ggcgcacaattgccggatgcggcgtgaacgccttatccgcctaccgaactgcgcc--	Protospacer
*******.*.***************************** *  *.. *** ****  

63. spacer 3.15|1834948|32|NZ_CP024245|CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

64. spacer 3.15|1834948|32|NZ_CP024245|CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

65. spacer 3.15|1834948|32|NZ_CP024245|CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

66. spacer 3.15|1834948|32|NZ_CP024245|CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

67. spacer 3.16|1835009|32|NZ_CP024245|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt	Protospacer
 * ..***** *****.*********** .. 

68. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to HG796351 (Uncultured bacterium plasmid pRGI00631) position: , mismatch: 10, identity: 0.688

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
cggctctgtaaaaaagcaaattcaaaaataca	Protospacer
 . .**** ******.************  ..

69. spacer 4.1|1849186|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 10, identity: 0.688

aatttctggaaaaaaacaaattcaaaaaattg	CRISPR spacer
aggagttggaaaaaaataaaatcaaaaaaaga	Protospacer
*.   .**********.*** ********  .

70. spacer 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcgccgcactggcgctggcacggtatgca	CRISPR spacer
tgcgcgccgaactggcggtggcacgcagcgag	Protospacer
  ******* ******* *******  ..* .

71. spacer 4.5|1849431|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcgccgcactggcgctggcacggtatgca	CRISPR spacer
tgcgcgccgaactggcggtggcacgcagcgag	Protospacer
  ******* ******* *******  ..* .

72. spacer 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688

atcactatcgtgatgctgacggcgcacagctc	CRISPR spacer
gtgctcggcgtggtgctgacggcgcagagctg	Protospacer
.*  ... ****.************* **** 

73. spacer 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to MH779515 (Mycobacterium phage Sweets, complete genome) position: , mismatch: 10, identity: 0.688

atcactatcgtgatgctgacggcgcacagctc	CRISPR spacer
acagaactcgtgatgctgaccgcgcacggcga	Protospacer
*. .   ************* ******.**  

74. spacer 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to MW119570 (Mycobacterium phage Lang, complete genome) position: , mismatch: 10, identity: 0.688

atcactatcgtgatgctgacggcgcacagctc	CRISPR spacer
acagaactcgtgatgctgaccgcgcacggcga	Protospacer
*. .   ************* ******.**  

75. spacer 4.8|1849614|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_008202 (Mycobacterium phage Halo, complete genome) position: , mismatch: 10, identity: 0.688

atcactatcgtgatgctgacggcgcacagctc	CRISPR spacer
acagaactcgtgatgctgaccgcgcacggcga	Protospacer
*. .   ************* ******.**  

76. spacer 4.9|1849675|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016891 (Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ccaccaccgccccgacaccacatatagtagcg	CRISPR spacer
aaaagcccgccccggcacaacatatagtatgc	Protospacer
  *   ********.*** **********   

77. spacer 4.17|1850163|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NC_009939 (Deinococcus geothermalis DSM 11300 plasmid pDGEO02, complete sequence) position: , mismatch: 10, identity: 0.688

ctgcaatcaccagcggcgcggcgtggtttggt	CRISPR spacer
tggcgatcaccagcggcgcggcgcggcggctc	Protospacer
. **.******************.**.    .

78. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

79. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

80. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

81. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

82. spacer 3.10|1834643|32|NZ_CP024245|CRISPRCasFinder,CRT matches to NZ_AP018282 (Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome) position: , mismatch: 11, identity: 0.656

acggcgtggattgagggacgggtatttggtcc	CRISPR spacer
gcggagtggattgaggtacgggtaaagaagga	Protospacer
.*** *********** *******   ..   

83. spacer 4.11|1849797|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043940 (Lactobacillus nenjiangensis strain SH-Y15 plasmid pHY011, complete sequence) position: , mismatch: 11, identity: 0.656

gctgtttgtaaatttagaattgctgactgagc	CRISPR spacer
attgttagtaaatttagacttgctggaattat	Protospacer
..**** *********** ******.    ..

84. spacer 4.15|1850041|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 11, identity: 0.656

ataccccagcgtttcgttatatgacggaagat	CRISPR spacer
gattttcagcgttccgttctatgacggaaaga	Protospacer
.  ...*******.**** **********.. 

85. spacer 4.15|1850041|32|NZ_CP024245|PILER-CR,CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 11, identity: 0.656

ataccccagcgtttcgttatatgacggaagat	CRISPR spacer
ggtgttcagcgttccgttctatgacggaaaga	Protospacer
.   ..*******.**** **********.. 

86. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

87. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

88. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

89. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

90. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ggcgcacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagtgc	Protospacer
*******.**.**********************************.  * . .  

91. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.8

-ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
aggcgt-tgattgccggatgcggcgtaaacgccttatccggcctacattcggcaag	Protospacer
 ****. .**.***************.********************.*. **  .

92. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

93. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

94. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

95. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

96. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

97. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

98. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

99. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

100. spacer 8.1|4386681|55|NZ_CP024245|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ggtacacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagcac	Protospacer
**..***.**.**********************************.  * . *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 223211 : 281083 59 Klosneuvirus(11.11%) transposase,protease NA
DBSCAN-SWA_2 871747 : 879050 8 Sodalis_phage(33.33%) NA NA
DBSCAN-SWA_3 1866699 : 1873839 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_4 2262342 : 2271690 13 Enterobacteria_phage(45.45%) integrase attL 2255462:2255478|attR 2274944:2274960
DBSCAN-SWA_5 2511299 : 2520741 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_6 3079400 : 3099345 25 Enterobacteria_phage(28.57%) lysis,integrase attL 3077104:3077117|attR 3089469:3089482
DBSCAN-SWA_7 3301901 : 3337521 44 Escherichia_phage(80.0%) tail,integrase,tRNA attL 3299612:3299627|attR 3336682:3336697
DBSCAN-SWA_8 3540137 : 3577428 50 Enterobacteria_phage(28.12%) holin,tail,tRNA NA
DBSCAN-SWA_9 4173487 : 4205373 34 Enterobacteria_phage(45.45%) transposase,lysis,protease,integrase,tail attL 4181968:4182014|attR 4205387:4205433
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP024247
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024247_1 64719-64858 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_KX774387 Providencia rettgeri strain 30905 plasmid pC131, complete sequence 10387-10419 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP053895 Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence 72648-72680 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_KU963389 Escherichia coli strain ECO37 plasmid ECO37P1, complete sequence 15133-15165 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP047288 Proteus cibarius strain G11 plasmid p152, complete sequence 62060-62092 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP044485 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence 28402-28434 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP025853 Escherichia coli strain 510016 plasmid p510016_36, complete sequence 25816-25848 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_KT754165 Shigella dysenteriae 1 strain 93-531-1 plasmid p93-531-1, complete sequence 23240-23272 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP053372 Proteus cibarius strain G32 plasmid pG32-177, complete sequence 57315-57347 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP024247 Escherichia coli O27:H7 strain B4103-1 plasmid unnamed2 64739-64771 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP053043 Proteus cibarius strain HNCF44W plasmid pHNCF44W_NDM-1, complete sequence 95158-95190 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 JX469830 Uncultured bacterium plasmid pG527, complete sequence 41349-41381 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP013819 Piscirickettsia salmonis strain AY3800B plasmid p3PS10, complete sequence 10767-10799 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP025925 Escherichia coli strain 520873 plasmid p520873_36, complete sequence 13633-13665 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP025875 Escherichia coli strain 503458 plasmid p503458_37, complete sequence 10830-10862 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP013795 Piscirickettsia salmonis strain AY6297B plasmid p4PS8, complete sequence 10767-10799 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP023380 Escherichia coli strain 127 plasmid p43, complete sequence 15396-15428 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 172056-172088 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NC_008357 Pseudomonas aeruginosa plasmid pBS228, complete sequence 68063-68095 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 74789-74821 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP022673 Shigella sonnei strain 866 plasmid p866, complete sequence 78315-78347 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP045128 Acinetobacter indicus strain XG03 plasmid pXG03-X3, complete sequence 89271-89303 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_LT985250 Escherichia coli strain 170 plasmid RCS38_p, complete sequence 152291-152323 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 17850-17882 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP053897 Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence 75880-75912 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_MF150120 Klebsiella pneumoniae strain A64477 plasmid pKP64477d, complete sequence 40084-40116 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_KX756453 Klebsiella pneumoniae strain 1194/11 plasmid pKP1194a, complete sequence 42453-42485 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NC_015472 Escherichia coli plasmid pECTm80, complete sequence 13464-13496 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP013800 Piscirickettsia salmonis strain AY6532B plasmid p4PS9, complete sequence 12090-12122 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 MG516911 Proteus mirabilis plasmid pPm60, complete sequence 57128-57160 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP003997 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13d, complete sequence 42619-42651 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP054380 Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence 38153-38185 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NC_002525 Escherichia coli K-12 plasmid R721, complete sequence 10525-10557 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP048015 Acinetobacter towneri strain 205 plasmid pAT205, complete sequence 49215-49247 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 140941-140973 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP047114 Proteus mirabilis strain SCBX1.1 plasmid plas1.1.2, complete sequence 46467-46499 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 150963-150995 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP027700 Klebsiella pneumoniae strain KP30835 plasmid unnamed5, complete sequence 7471-7503 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP053899 Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence 116699-116731 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_MK264770 Klebsiella pneumoniae strain KP89 plasmid pKP89, complete sequence 42620-42652 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_KX774387 Providencia rettgeri strain 30905 plasmid pC131, complete sequence 10443-10483 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_MF150120 Klebsiella pneumoniae strain A64477 plasmid pKP64477d, complete sequence 40020-40060 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP053895 Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence 72704-72744 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_KX756453 Klebsiella pneumoniae strain 1194/11 plasmid pKP1194a, complete sequence 42389-42429 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_KU963389 Escherichia coli strain ECO37 plasmid ECO37P1, complete sequence 15189-15229 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP047288 Proteus cibarius strain G11 plasmid p152, complete sequence 62116-62156 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NC_015472 Escherichia coli plasmid pECTm80, complete sequence 13400-13440 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP044485 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence 28458-28498 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP025853 Escherichia coli strain 510016 plasmid p510016_36, complete sequence 25872-25912 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_KT754165 Shigella dysenteriae 1 strain 93-531-1 plasmid p93-531-1, complete sequence 23296-23336 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP013800 Piscirickettsia salmonis strain AY6532B plasmid p4PS9, complete sequence 12026-12066 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP053372 Proteus cibarius strain G32 plasmid pG32-177, complete sequence 57371-57411 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP024247 Escherichia coli O27:H7 strain B4103-1 plasmid unnamed2 64795-64835 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP053043 Proteus cibarius strain HNCF44W plasmid pHNCF44W_NDM-1, complete sequence 95214-95254 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 MG516911 Proteus mirabilis plasmid pPm60, complete sequence 57064-57104 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 JX469830 Uncultured bacterium plasmid pG527, complete sequence 41405-41445 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP013819 Piscirickettsia salmonis strain AY3800B plasmid p3PS10, complete sequence 10823-10863 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP003997 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13d, complete sequence 42555-42595 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 CP025925 Escherichia coli strain 520873 plasmid p520873_36, complete sequence 13689-13729 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 CP025875 Escherichia coli strain 503458 plasmid p503458_37, complete sequence 10886-10926 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP013795 Piscirickettsia salmonis strain AY6297B plasmid p4PS8, complete sequence 10823-10863 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 CP054380 Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence 38089-38129 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NC_002525 Escherichia coli K-12 plasmid R721, complete sequence 10461-10501 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP023380 Escherichia coli strain 127 plasmid p43, complete sequence 15452-15492 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 172112-172152 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NC_008357 Pseudomonas aeruginosa plasmid pBS228, complete sequence 68119-68159 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 74845-74885 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP022673 Shigella sonnei strain 866 plasmid p866, complete sequence 78371-78411 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP048015 Acinetobacter towneri strain 205 plasmid pAT205, complete sequence 49151-49191 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 140877-140917 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP047114 Proteus mirabilis strain SCBX1.1 plasmid plas1.1.2, complete sequence 46403-46443 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 150899-150939 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP045128 Acinetobacter indicus strain XG03 plasmid pXG03-X3, complete sequence 89327-89367 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP027700 Klebsiella pneumoniae strain KP30835 plasmid unnamed5, complete sequence 7407-7447 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_LT985250 Escherichia coli strain 170 plasmid RCS38_p, complete sequence 152347-152387 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 17906-17946 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP053899 Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence 116635-116675 0 1.0
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_MK264770 Klebsiella pneumoniae strain KP89 plasmid pKP89, complete sequence 42556-42596 0 1.0
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052804 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence 113091-113123 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP038508 Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence 228634-228666 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052788 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence 321488-321520 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052786 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence 10079-10111 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052838 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence 13470-13502 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP051676 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence 201786-201818 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052779 Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence 212524-212556 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052832 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence 277011-277043 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 MN310378 Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence 73380-73412 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052806 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence 282696-282728 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052818 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence 1788-1820 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_MH476540 Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence 87104-87136 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052795 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence 166287-166319 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP047882 Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence 264306-264338 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052802 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence 197576-197608 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052840 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence 9544-9576 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052836 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence 222743-222775 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052828 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence 8856-8888 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052826 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence 292607-292639 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP016409 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence 299316-299348 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP016407 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence 299920-299952 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP016413 Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence 295999-296031 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_CP016411 Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence 293612-293644 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 CP052814 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence 281790-281822 2 0.939
NZ_CP024247_1 1.1|64742|33|NZ_CP024247|PILER-CR 64742-64774 33 NZ_MG764552 Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence 61314-61346 2 0.939
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_CP053897 Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence 75936-75976 2 0.951
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 MN310378 Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence 73436-73476 2 0.951
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_MH476540 Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence 87160-87200 2 0.951
NZ_CP024247_1 1.2|64798|41|NZ_CP024247|PILER-CR 64798-64838 41 NZ_MG764552 Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence 61250-61290 2 0.951

1. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_KX774387 (Providencia rettgeri strain 30905 plasmid pC131, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

2. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

3. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_KU963389 (Escherichia coli strain ECO37 plasmid ECO37P1, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

4. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP047288 (Proteus cibarius strain G11 plasmid p152, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

5. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

6. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP025853 (Escherichia coli strain 510016 plasmid p510016_36, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

7. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_KT754165 (Shigella dysenteriae 1 strain 93-531-1 plasmid p93-531-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

8. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP053372 (Proteus cibarius strain G32 plasmid pG32-177, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

9. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP024247 (Escherichia coli O27:H7 strain B4103-1 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

10. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP053043 (Proteus cibarius strain HNCF44W plasmid pHNCF44W_NDM-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

11. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to JX469830 (Uncultured bacterium plasmid pG527, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

12. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP013819 (Piscirickettsia salmonis strain AY3800B plasmid p3PS10, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

13. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP025925 (Escherichia coli strain 520873 plasmid p520873_36, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

14. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP025875 (Escherichia coli strain 503458 plasmid p503458_37, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

15. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP013795 (Piscirickettsia salmonis strain AY6297B plasmid p4PS8, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

16. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP023380 (Escherichia coli strain 127 plasmid p43, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

17. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

18. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NC_008357 (Pseudomonas aeruginosa plasmid pBS228, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

19. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

20. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP022673 (Shigella sonnei strain 866 plasmid p866, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

21. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP045128 (Acinetobacter indicus strain XG03 plasmid pXG03-X3, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

22. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

23. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

24. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

25. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_MF150120 (Klebsiella pneumoniae strain A64477 plasmid pKP64477d, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

26. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_KX756453 (Klebsiella pneumoniae strain 1194/11 plasmid pKP1194a, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

27. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NC_015472 (Escherichia coli plasmid pECTm80, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

28. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP013800 (Piscirickettsia salmonis strain AY6532B plasmid p4PS9, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

29. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to MG516911 (Proteus mirabilis plasmid pPm60, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

30. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP003997 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13d, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

31. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP054380 (Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

32. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NC_002525 (Escherichia coli K-12 plasmid R721, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

33. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP048015 (Acinetobacter towneri strain 205 plasmid pAT205, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

34. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

35. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP047114 (Proteus mirabilis strain SCBX1.1 plasmid plas1.1.2, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

36. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

37. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP027700 (Klebsiella pneumoniae strain KP30835 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

38. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

39. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_MK264770 (Klebsiella pneumoniae strain KP89 plasmid pKP89, complete sequence) position: , mismatch: 0, identity: 1.0

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgtattagcttacgacgctaca	Protospacer
*********************************

40. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_KX774387 (Providencia rettgeri strain 30905 plasmid pC131, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

41. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_MF150120 (Klebsiella pneumoniae strain A64477 plasmid pKP64477d, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

42. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

43. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_KX756453 (Klebsiella pneumoniae strain 1194/11 plasmid pKP1194a, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

44. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_KU963389 (Escherichia coli strain ECO37 plasmid ECO37P1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

45. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP047288 (Proteus cibarius strain G11 plasmid p152, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

46. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NC_015472 (Escherichia coli plasmid pECTm80, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

47. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

48. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP025853 (Escherichia coli strain 510016 plasmid p510016_36, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

49. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_KT754165 (Shigella dysenteriae 1 strain 93-531-1 plasmid p93-531-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

50. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP013800 (Piscirickettsia salmonis strain AY6532B plasmid p4PS9, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

51. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP053372 (Proteus cibarius strain G32 plasmid pG32-177, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

52. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP024247 (Escherichia coli O27:H7 strain B4103-1 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

53. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP053043 (Proteus cibarius strain HNCF44W plasmid pHNCF44W_NDM-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

54. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to MG516911 (Proteus mirabilis plasmid pPm60, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

55. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to JX469830 (Uncultured bacterium plasmid pG527, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

56. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP013819 (Piscirickettsia salmonis strain AY3800B plasmid p3PS10, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

57. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP003997 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13d, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

58. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to CP025925 (Escherichia coli strain 520873 plasmid p520873_36, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

59. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to CP025875 (Escherichia coli strain 503458 plasmid p503458_37, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

60. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP013795 (Piscirickettsia salmonis strain AY6297B plasmid p4PS8, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

61. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to CP054380 (Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

62. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NC_002525 (Escherichia coli K-12 plasmid R721, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

63. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP023380 (Escherichia coli strain 127 plasmid p43, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

64. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

65. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NC_008357 (Pseudomonas aeruginosa plasmid pBS228, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

66. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

67. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP022673 (Shigella sonnei strain 866 plasmid p866, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

68. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP048015 (Acinetobacter towneri strain 205 plasmid pAT205, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

69. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

70. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP047114 (Proteus mirabilis strain SCBX1.1 plasmid plas1.1.2, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

71. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

72. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP045128 (Acinetobacter indicus strain XG03 plasmid pXG03-X3, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

73. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP027700 (Klebsiella pneumoniae strain KP30835 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

74. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

75. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

76. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

77. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_MK264770 (Klebsiella pneumoniae strain KP89 plasmid pKP89, complete sequence) position: , mismatch: 0, identity: 1.0

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccacccct	Protospacer
*****************************************

78. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

79. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP038508 (Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

80. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052788 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

81. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052786 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

82. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052838 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

83. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP051676 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

84. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052779 (Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

85. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052832 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

86. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

87. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052806 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

88. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052818 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

89. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_MH476540 (Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

90. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

91. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP047882 (Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

92. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052802 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

93. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052840 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

94. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052836 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

95. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052828 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

96. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052826 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

97. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP016409 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

98. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP016407 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

99. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP016413 (Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

100. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_CP016411 (Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

101. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to CP052814 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

102. spacer 1.1|64742|33|NZ_CP024247|PILER-CR matches to NZ_MG764552 (Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence) position: , mismatch: 2, identity: 0.939

tttttaattttcgtattagcttacgacgctaca	CRISPR spacer
tttttaattttcgcattagcttgcgacgctaca	Protospacer
*************.********.**********

103. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 2, identity: 0.951

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctcttccctaaataatccttaaaaactccatttccaccctc	Protospacer
***************************************..

104. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 2, identity: 0.951

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctctcccctaaataatccttaaaaaccccatttccacccct	Protospacer
****.*********************.**************

105. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_MH476540 (Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence) position: , mismatch: 2, identity: 0.951

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctctcccctaaataatccttaaaaaccccatttccacccct	Protospacer
****.*********************.**************

106. spacer 1.2|64798|41|NZ_CP024247|PILER-CR matches to NZ_MG764552 (Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence) position: , mismatch: 2, identity: 0.951

ctcttccctaaataatccttaaaaactccatttccacccct	CRISPR spacer
ctctcccctaaataatccttaaaaaccccatttccacccct	Protospacer
****.*********************.**************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP024248
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7615 : 52711 41 Stx2-converting_phage(38.46%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage