Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020975 Xanthomonas phaseoli pv. phaseoli strain CFBP6982 chromosome, complete genome 3 crisprs cas3,WYL,csa3,DinG,PD-DExK,DEDDh 0 7 13 0
NZ_CP020978 Xanthomonas phaseoli pv. phaseoli strain CFBP6982 plasmid pD 0 crisprs NA 0 0 0 0
NZ_CP020977 Xanthomonas phaseoli pv. phaseoli strain CFBP6982 plasmid pC 1 crisprs NA 0 1 0 0
NZ_CP020976 Xanthomonas phaseoli pv. phaseoli strain CFBP6982 plasmid pA 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP020975
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020975_1 2170329-2170473 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020975_2 2478674-2478799 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020975_3 2568130-2568430 Orphan NA
5 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 AP014684 Pseudomonas phage PS-1 DNA, complete sequence 18354-18376 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP010856 Marinovum algicola DG 898 plasmid pMaD1, complete sequence 77518-77540 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1178658-1178680 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 321631-321653 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 375222-375244 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 399631-399653 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 646131-646153 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 1241206-1241228 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 1620878-1620900 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 434818-434840 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1145573-1145595 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 836226-836248 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1245811-1245833 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 149316-149338 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 558565-558587 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 303663-303685 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1020114-1020136 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 66860-66882 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 744775-744797 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 616946-616968 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 109485-109507 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 507889-507911 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 293673-293695 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 269641-269663 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 321293-321315 2 0.913
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 150779-150801 3 0.87
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NC_012521 Rhodococcus opacus B4 plasmid pROB02, complete sequence 129021-129043 3 0.87
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP018464 Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence 6640-6662 3 0.87
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP017427 Methylobacterium sp. XJLW plasmid unnamed1, complete sequence 63851-63873 3 0.87
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NZ_CP029174 Methylobacterium sp. DM1 plasmid pLVM1, complete sequence 13004-13026 3 0.87
NZ_CP020975_3 3.7|2568326|23|NZ_CP020975|PILER-CR 2568326-2568348 23 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 187810-187832 3 0.87
NZ_CP020975_3 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder 2568377-2568405 29 NZ_CP023712 Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence 83287-83315 4 0.862
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1178658-1178689 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 321622-321653 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 375213-375244 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 399631-399662 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 646122-646153 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 1241206-1241237 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 434809-434840 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1145573-1145604 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 836226-836257 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1245811-1245842 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 149316-149347 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 558556-558587 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 303663-303694 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 66860-66891 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 616937-616968 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 507880-507911 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 293664-293695 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 269632-269663 5 0.844
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 321284-321315 5 0.844
NZ_CP020975_3 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder 2568377-2568405 29 NC_009806 Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence 119513-119541 5 0.828
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 841352-841380 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 841098-841126 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 741217-741245 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 811283-811311 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 740332-740360 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 742910-742938 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 742899-742927 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 741204-741232 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 741223-741251 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 741201-741229 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 841421-841449 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 841420-841448 6 0.793
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 841405-841433 6 0.793
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 934480-934508 6 0.793
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 150330-150358 6 0.793
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 81613-81641 6 0.793
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 459536-459564 6 0.793
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 301597-301625 6 0.793
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_AP017656 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence 289141-289169 6 0.793
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP016283 Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_1, complete sequence 25870-25898 6 0.793
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP040642 Agrobacterium sp. T29 plasmid unnamed2, complete sequence 87631-87659 6 0.793
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 91527-91555 6 0.793
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 366610-366641 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010612 Phaeobacter inhibens strain P92 plasmid pP92_b, complete sequence 212717-212748 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010624 Phaeobacter inhibens strain P51 plasmid pP51_a, complete sequence 205484-205515 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010669 Phaeobacter inhibens strain P57 plasmid pP57_a, complete sequence 205484-205515 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_018291 Phaeobacter inhibens DSM 17395 plasmid pPGA1_262, complete sequence 246988-247019 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010596 Phaeobacter inhibens strain P10 plasmid pP10_a, complete sequence 248146-248177 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010630 Phaeobacter inhibens strain P78 plasmid pP78_a, complete sequence 242159-242190 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP031953 Phaeobacter inhibens strain 2.10 plasmid unnamed1, complete sequence 223021-223052 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_018421 Phaeobacter inhibens 2.10 plasmid pPGA2_239, complete sequence 222928-222959 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010600 Phaeobacter inhibens strain P83 plasmid pP83_a, complete sequence 213262-213293 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP031949 Phaeobacter inhibens strain BS107 plasmid unnamed1, complete sequence 246989-247020 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010742 Phaeobacter inhibens strain P59 plasmid pP59_a, complete sequence 225238-225269 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010618 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_a, complete sequence 226970-227001 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010726 Phaeobacter inhibens strain P88 plasmid pP88_a, complete sequence 213258-213289 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010651 Phaeobacter inhibens strain P54 plasmid pP54_a, complete sequence 228318-228349 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010706 Phaeobacter inhibens strain P66 plasmid pP66_a, complete sequence 213262-213293 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010697 Phaeobacter inhibens strain P24 plasmid pP24_a, complete sequence 205484-205515 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010746 Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_a, complete sequence 220374-220405 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP019308 Phaeobacter inhibens strain DOK1-1 plasmid pDOK1-1-1, complete sequence 56399-56430 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010736 Phaeobacter inhibens strain P72 plasmid pP72_a, complete sequence 213287-213318 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 282459-282490 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 26856-26887 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 434343-434374 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 107441-107472 6 0.812
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 621141-621172 6 0.812
NZ_CP020975_3 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder 2568377-2568405 29 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 322119-322147 6 0.793
NZ_CP020975_3 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder 2568377-2568405 29 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 23695-23723 6 0.793
NZ_CP020975_3 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder 2568377-2568405 29 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 135211-135239 6 0.793
NZ_CP020975_3 3.6|2568264|28|NZ_CP020975|PILER-CR 2568264-2568291 28 MF979563 Pectobacterium phage DU_PP_IV, complete genome 51601-51628 6 0.786
NZ_CP020975_3 3.6|2568264|28|NZ_CP020975|PILER-CR 2568264-2568291 28 MF979560 Pectobacterium phage DU_PP_I, complete genome 51290-51317 6 0.786
NZ_CP020975_3 3.6|2568264|28|NZ_CP020975|PILER-CR 2568264-2568291 28 KC954774 Cronobacter phage CR8, complete genome 59212-59239 6 0.786
NZ_CP020975_3 3.6|2568264|28|NZ_CP020975|PILER-CR 2568264-2568291 28 NC_028672 Cronobacter phage PBES 02, complete genome 115237-115264 6 0.786
NZ_CP020975_3 3.6|2568264|28|NZ_CP020975|PILER-CR 2568264-2568291 28 NC_017974 Cronobacter phage CR3, complete genome 58339-58366 6 0.786
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_AP017604 Sphingopyxis sp. EG6 plasmid pSREG01, complete sequence 1760-1788 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1198564-1198592 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1356828-1356856 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP049751 Rhodococcus fascians A21d2 plasmid unnamed2, complete sequence 17157-17185 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 11884-11912 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 MN657146 Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence 27647-27675 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP005192 Sphingobium sp. MI1205 plasmid pMI3, complete sequence 57721-57749 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 934611-934639 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 43704-43732 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 242596-242624 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 50479-50507 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 AB244976 Uncultured bacterium plasmid pLB1 DNA, complete sequence 33886-33914 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 40824-40852 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP039426 Citricoccus sp. SGAir0253 plasmid unnamed2, complete sequence 5012-5040 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_AP014580 Burkholderia sp. RPE67 plasmid p2, complete sequence 467859-467887 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 371410-371438 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 13263-13291 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 19257-19285 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP016821 Rhodococcus sp. p52 plasmid pDF01, complete sequence 84356-84384 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP039431 Citricoccus sp. SGAir0453 plasmid unnamed2, complete sequence 5012-5040 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 97656-97684 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 MN062720 Microbacterium phage FuzzBuster, complete genome 21152-21180 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 MT114163 Mycobacterium phage Settecandela, complete genome 56497-56525 7 0.759
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 MK937592 Mycobacterium phage Phrappuccino, complete genome 56497-56525 7 0.759
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 171414-171445 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1821303-1821334 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1837992-1838023 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 171423-171454 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 181011-181042 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 181009-181040 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1799977-1800008 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010589 Phaeobacter gallaeciensis strain P11 plasmid pP11_a, complete sequence 242385-242416 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 150779-150810 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010674 Phaeobacter gallaeciensis strain P75 plasmid pP75_a, complete sequence 242385-242416 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_023138 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_A255, complete sequence 241893-241924 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP010637 Phaeobacter gallaeciensis strain P73 plasmid pP73_a, complete sequence 242385-242416 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 AY357582 Burkholderia cepacia phage BcepNazgul, complete genome 4533-4564 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_005091 Burkholderia phage BcepNazgul, complete genome 4533-4564 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 524814-524845 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 9283-9314 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 685990-686021 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 MF417942 Uncultured Caudovirales phage clone 7F_6, partial genome 5829-5860 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 MF417876 Uncultured Caudovirales phage clone 3F_6, partial genome 49416-49447 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 MF417869 Uncultured Caudovirales phage clone 3S_4, partial genome 48603-48634 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 MF417877 Uncultured Caudovirales phage clone 9F_7, partial genome 30274-30305 7 0.781
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 MF417878 Uncultured Caudovirales phage clone 8S_7, partial genome 45965-45996 7 0.781
NZ_CP020975_3 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder 2568377-2568405 29 NZ_CP011053 Halomonas sp. KO116 plasmid unnamed1, complete sequence 303459-303487 7 0.759
NZ_CP020975_3 3.6|2568264|28|NZ_CP020975|PILER-CR 2568264-2568291 28 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 29247-29274 7 0.75
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 98027-98055 8 0.724
NZ_CP020975_3 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder 2568155-2568183 29 NZ_CP013739 Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence 114528-114556 8 0.724
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NC_012527 Deinococcus deserti VCD115 plasmid 1, complete sequence 285867-285895 8 0.724
NZ_CP020975_3 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder 2568209-2568237 29 NZ_CP015740 Shinella sp. HZN7 plasmid pShin-04, complete sequence 60814-60842 8 0.724
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 366577-366608 8 0.75
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021041 Phaeobacter gallaeciensis strain P129 plasmid pP129_a, complete sequence 242888-242919 8 0.75
NZ_CP020975_3 3.3|2568263|32|NZ_CP020975|CRISPRCasFinder 2568263-2568294 32 MT591577 Yersinia phage vB_YpM_Tongde, complete genome 15888-15919 9 0.719
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 116468-116499 9 0.719
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 22146-22177 9 0.719
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1480046-1480077 10 0.688
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_008382 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL7, complete sequence 104578-104609 10 0.688
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 1620869-1620900 10 0.688
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1020114-1020145 10 0.688
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 744766-744797 10 0.688
NZ_CP020975_3 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder 2568320-2568351 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 109476-109507 10 0.688

1. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to AP014684 (Pseudomonas phage PS-1 DNA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctggccgagcgcggcagccgtt	Protospacer
*********************  

2. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP010856 (Marinovum algicola DG 898 plasmid pMaD1, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctggccgagcgcggctgccggc	Protospacer
**************** ***** 

3. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

4. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

5. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

6. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

7. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

8. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

9. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
ccaggccgaacgcggcagccgga	Protospacer
** ******.*************

10. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

11. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

12. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

13. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

14. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

15. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

16. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

17. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
ccaggccgaacgcggcagccgga	Protospacer
** ******.*************

18. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

19. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
ccaggccgaacgcggcagccgga	Protospacer
** ******.*************

20. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

21. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
ccaggccgaacgcggcagccgga	Protospacer
** ******.*************

22. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

23. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

24. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

25. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 2, identity: 0.913

cctggccgagcgcggcagccgga	CRISPR spacer
cctcgccgggcgcggcagccgga	Protospacer
*** ****.**************

26. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 3, identity: 0.87

cctggccgagcgcggcagccgga	CRISPR spacer
gctggccgagcgcggccgccggt	Protospacer
 *************** ***** 

27. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NC_012521 (Rhodococcus opacus B4 plasmid pROB02, complete sequence) position: , mismatch: 3, identity: 0.87

cctggccgagcgcggcagccgga	CRISPR spacer
cctggccgagcacggcagccgcc	Protospacer
***********.*********  

28. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP018464 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence) position: , mismatch: 3, identity: 0.87

cctggccgagcgcggcagccgga	CRISPR spacer
gctggccgagcgcggcaaccggg	Protospacer
 ****************.****.

29. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP017427 (Methylobacterium sp. XJLW plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.87

cctggccgagcgcggcagccgga	CRISPR spacer
gctggccgagcgcggcggccggc	Protospacer
 ***************.***** 

30. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NZ_CP029174 (Methylobacterium sp. DM1 plasmid pLVM1, complete sequence) position: , mismatch: 3, identity: 0.87

cctggccgagcgcggcagccgga	CRISPR spacer
gctggccgagcgcggcggccggc	Protospacer
 ***************.***** 

31. spacer 3.7|2568326|23|NZ_CP020975|PILER-CR matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 3, identity: 0.87

cctggccgagcgcggcagccgga	CRISPR spacer
gctggccgagcgcggcggccggc	Protospacer
 ***************.***** 

32. spacer 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP023712 (Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.862

tgggctgg-tggggaccgagctcggcaagg	CRISPR spacer
-gggcgagctgggcaccgagctcggcaagg	Protospacer
 **** .* **** ****************

33. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

34. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

35. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

36. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

37. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

38. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

39. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

40. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

41. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

42. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

43. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

44. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

45. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

46. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

47. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

48. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

49. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

50. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

51. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.844

cctggccgagcgcggcagccggatcagcggcg-	CRISPR spacer
cctcgccgggcgcggcagccggat-aaaggcgt	Protospacer
*** ****.*************** *. **** 

52. spacer 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 5, identity: 0.828

tgggctggtggggaccgagctcggcaagg	CRISPR spacer
gcggctggtggggaccggtctcggcaacg	Protospacer
  ***************. ******** *

53. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

54. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

55. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

56. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

57. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

58. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

59. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

60. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

61. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

62. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

63. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

64. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

65. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
ggagaccggtgccggcgcgcaaacctacg	Protospacer
 ****.*********.********* * .

66. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 6, identity: 0.793

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gcgcagcggcgacaacgcgcgcaccatct	Protospacer
 **** *******************. . 

67. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 6, identity: 0.793

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gatcaccggcgacaacgcgcgcaccgccg	Protospacer
   **.******************** .*

68. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 6, identity: 0.793

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gatcaccggcgacaacgcgcgcaccgccg	Protospacer
   **.******************** .*

69. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.793

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
cggcagcgccgacaacgcgcgcaccgcgc	Protospacer
* *** ** *****************   

70. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 6, identity: 0.793

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
cggcagcgccgacaacgcgcgcaccgcgc	Protospacer
* *** ** *****************   

71. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 6, identity: 0.793

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
ctgcagcgtcgacaacgcgcgcacccatt	Protospacer
*.*** ** **************** .* 

72. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP016283 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_1, complete sequence) position: , mismatch: 6, identity: 0.793

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gctcaccggcgacaacgggcgcaccgccg	Protospacer
 * **.*********** ******** .*

73. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP040642 (Agrobacterium sp. T29 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
cgagatcggcgccaacgcgcgcatcggcg	Protospacer
* . ******* ***********.***.*

74. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.793

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
cagccacgacgacaacgcgcgcaccggca	Protospacer
* **  **.******************..

75. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgtcgtcgagcgcggcggccggatcaccggct	Protospacer
* * *.**********.********* **** 

76. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010612 (Phaeobacter inhibens strain P92 plasmid pP92_b, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

77. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010624 (Phaeobacter inhibens strain P51 plasmid pP51_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

78. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010669 (Phaeobacter inhibens strain P57 plasmid pP57_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

79. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_018291 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_262, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

80. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010596 (Phaeobacter inhibens strain P10 plasmid pP10_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

81. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010630 (Phaeobacter inhibens strain P78 plasmid pP78_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

82. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP031953 (Phaeobacter inhibens strain 2.10 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

83. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_018421 (Phaeobacter inhibens 2.10 plasmid pPGA2_239, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

84. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010600 (Phaeobacter inhibens strain P83 plasmid pP83_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

85. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP031949 (Phaeobacter inhibens strain BS107 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

86. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010742 (Phaeobacter inhibens strain P59 plasmid pP59_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

87. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010618 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

88. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010726 (Phaeobacter inhibens strain P88 plasmid pP88_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

89. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010651 (Phaeobacter inhibens strain P54 plasmid pP54_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

90. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010706 (Phaeobacter inhibens strain P66 plasmid pP66_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

91. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010697 (Phaeobacter inhibens strain P24 plasmid pP24_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

92. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010746 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

93. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP019308 (Phaeobacter inhibens strain DOK1-1 plasmid pDOK1-1-1, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

94. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010736 (Phaeobacter inhibens strain P72 plasmid pP72_a, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtg	Protospacer
* * *.************* * ********.*

95. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccg-agcgcggcagccggatcagcggcg	CRISPR spacer
-cgggtcgtcgcgcagcagccggatcagcgccg	Protospacer
 * **.**  ****.*************** **

96. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccg-agcgcggcagccggatcagcggcg	CRISPR spacer
-cgggtcgtcgcgcagcagccggatcagcgccg	Protospacer
 * **.**  ****.*************** **

97. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccg-agcgcggcagccggatcagcggcg	CRISPR spacer
-cgggtcgtcgcgcagcagccggatcagcgccg	Protospacer
 * **.**  ****.*************** **

98. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccg-agcgcggcagccggatcagcggcg	CRISPR spacer
-cgggtcgtcgcgcagcagccggatcagcgccg	Protospacer
 * **.**  ****.*************** **

99. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.812

cctggccg-agcgcggcagccggatcagcggcg	CRISPR spacer
-cgggtcgtcgcgcagcagccggatcagcgccg	Protospacer
 * **.**  ****.*************** **

100. spacer 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.793

tgggctggtggggaccgagctcggcaagg	CRISPR spacer
cgtgctggcggggaccgggctcggcatcg	Protospacer
.* *****.********.********  *

101. spacer 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.793

tgggctggtggggaccgagctcggcaagg	CRISPR spacer
cgtgctggcggggaccgggctcggcatcg	Protospacer
.* *****.********.********  *

102. spacer 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.793

tgggctggtggggaccgagctcggcaagg	CRISPR spacer
cgtgctggcggggaccgggctcggcatcg	Protospacer
.* *****.********.********  *

103. spacer 3.6|2568264|28|NZ_CP020975|PILER-CR matches to MF979563 (Pectobacterium phage DU_PP_IV, complete genome) position: , mismatch: 6, identity: 0.786

tcgatcacgctgggccagaaagtgacgg	CRISPR spacer
cagatcacgcagggccagaaggtgactc	Protospacer
. ******** *********.*****  

104. spacer 3.6|2568264|28|NZ_CP020975|PILER-CR matches to MF979560 (Pectobacterium phage DU_PP_I, complete genome) position: , mismatch: 6, identity: 0.786

tcgatcacgctgggccagaaagtgacgg	CRISPR spacer
cagatcacgcagggccagaaggtgactc	Protospacer
. ******** *********.*****  

105. spacer 3.6|2568264|28|NZ_CP020975|PILER-CR matches to KC954774 (Cronobacter phage CR8, complete genome) position: , mismatch: 6, identity: 0.786

tcgatcacgctgggccagaaagtgacgg	CRISPR spacer
cagatcacgcagggccagaaggtgactc	Protospacer
. ******** *********.*****  

106. spacer 3.6|2568264|28|NZ_CP020975|PILER-CR matches to NC_028672 (Cronobacter phage PBES 02, complete genome) position: , mismatch: 6, identity: 0.786

tcgatcacgctgggccagaaagtgacgg	CRISPR spacer
cagatcacgcagggccagaaggtgactc	Protospacer
. ******** *********.*****  

107. spacer 3.6|2568264|28|NZ_CP020975|PILER-CR matches to NC_017974 (Cronobacter phage CR3, complete genome) position: , mismatch: 6, identity: 0.786

tcgatcacgctgggccagaaagtgacgg	CRISPR spacer
cagatcacgcagggccagaaggtgactc	Protospacer
. ******** *********.*****  

108. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_AP017604 (Sphingopyxis sp. EG6 plasmid pSREG01, complete sequence) position: , mismatch: 7, identity: 0.759

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
cgcgatcggtgccggtgcgcagcacctgg	Protospacer
** ******************.  *  *.

109. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gcgcagcggcgacaacgcgcacaccatct	Protospacer
 **** **************.****. . 

110. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gcgcagcggcgacaaggcgcgcaccatct	Protospacer
 **** ********* *********. . 

111. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP049751 (Rhodococcus fascians A21d2 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
ggacatcggtgacagcgcgcgcaccgcag	Protospacer
  .******.****.***********  *

112. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
cgaggccggagacagcgcgcgcaccggtg	Protospacer
* . ..*** ****.**************

113. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to MN657146 (Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gctcaccggcgacaacgctcgcaccgccc	Protospacer
 * **.************ ******* . 

114. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP005192 (Sphingobium sp. MI1205 plasmid pMI3, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
ctgaatcggcaacaacgcgcgcacctcct	Protospacer
*.* ******.**************  . 

115. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gcacatcggcgacagcgcgcgcagcgtcc	Protospacer
 *.***********.******** ** . 

116. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gatcaccggcgataacgcgcgcaccgcgg	Protospacer
   **.******.*************  *

117. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gctcaccggcgacaacgagcgcaccgcac	Protospacer
 * **.*********** ********   

118. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gctcaccggcgacaacgagcgcaccgcac	Protospacer
 * **.*********** ********   

119. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to AB244976 (Uncultured bacterium plasmid pLB1 DNA, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
ctgaatcggcaacaacgcgcgcacctcct	Protospacer
*.* ******.**************  . 

120. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gctcaccggcgacaacgagcgcaccgcca	Protospacer
 * **.*********** ******** ..

121. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP039426 (Citricoccus sp. SGAir0253 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gctcaccggcgacaacgcccgcaccgccc	Protospacer
 * **.************ ******* . 

122. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
cttcatcggcgacaaggcgcgcagcgaca	Protospacer
*. ************ ******* **...

123. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gctcaccggtgacaacgcgcgcaccgcac	Protospacer
 * **.***.****************   

124. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gatcaccggcgacaacgcccgcaccgccg	Protospacer
   **.************ ******* .*

125. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gatcaccggcgacaacgcccgcaccgcta	Protospacer
   **.************ ******* *.

126. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gctcaccggcgacaacgagcgcaccgcac	Protospacer
 * **.*********** ********   

127. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP039431 (Citricoccus sp. SGAir0453 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gctcaccggcgacaacgcccgcaccgccc	Protospacer
 * **.************ ******* . 

128. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gatcaccggcgataacgcgcgcaccgcgg	Protospacer
   **.******.*************  *

129. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
caccatcggcggcatcgcgcgcaccgcct	Protospacer
*  ********.** *********** . 

130. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to MT114163 (Mycobacterium phage Settecandela, complete genome) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
cgtcgtcggcggcaacgcgcgcaccgtct	Protospacer
*  *.******.************** . 

131. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to MK937592 (Mycobacterium phage Phrappuccino, complete genome) position: , mismatch: 7, identity: 0.759

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
cgtcgtcggcggcaacgcgcgcaccgtct	Protospacer
*  *.******.************** . 

132. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgtcgccgcgcccggcagccggatcagcgcga	Protospacer
* * **** ** *****************  .

133. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgtcgccgcgcccggcagccggatcagcgcga	Protospacer
* * **** ** *****************  .

134. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgtcgccgcgcccggcagccggatcagcgcga	Protospacer
* * **** ** *****************  .

135. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgtcgccgcgcccggcagccggatcagcgcga	Protospacer
* * **** ** *****************  .

136. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgtcgccgcgcccggcagccggatcagcgcga	Protospacer
* * **** ** *****************  .

137. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgtcgccgcgcccggcagccggatcagcgcga	Protospacer
* * **** ** *****************  .

138. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgtcgccgcgcccggcagccggatcagcgcga	Protospacer
* * **** ** *****************  .

139. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010589 (Phaeobacter gallaeciensis strain P11 plasmid pP11_a, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtc	Protospacer
* * *.************* * ********. 

140. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
gctggccgagcgcggccgccggttccacaccg	Protospacer
 *************** ***** ** .*. **

141. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010674 (Phaeobacter gallaeciensis strain P75 plasmid pP75_a, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtc	Protospacer
* * *.************* * ********. 

142. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_023138 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_A255, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtc	Protospacer
* * *.************* * ********. 

143. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP010637 (Phaeobacter gallaeciensis strain P73 plasmid pP73_a, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
catcgtcgagcgcggcagcggcatcagcggtc	Protospacer
* * *.************* * ********. 

144. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to AY357582 (Burkholderia cepacia phage BcepNazgul, complete genome) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cttgacccagcgcggcagccggatcaaatccg	Protospacer
*.**.** ******************.   **

145. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_005091 (Burkholderia phage BcepNazgul, complete genome) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cttgacccagcgcggcagccggatcaaatccg	Protospacer
*.**.** ******************.   **

146. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
acggtcagtgcgcggcggccggatcaacggcg	Protospacer
 * * * * *******.*********.*****

147. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cagggcgatgcccggcagcgggatcagcggcg	Protospacer
*  *** . ** ******* ************

148. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
acggtcagtgcgcggcggccggatcaacggcg	Protospacer
 * * * * *******.*********.*****

149. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to MF417942 (Uncultured Caudovirales phage clone 7F_6, partial genome) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
gctttccgagggcggcaaccggatcagctacg	Protospacer
 **  ***** ******.********** .**

150. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to MF417876 (Uncultured Caudovirales phage clone 3F_6, partial genome) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
gctttccgagggcggcaaccggatcagctacg	Protospacer
 **  ***** ******.********** .**

151. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to MF417869 (Uncultured Caudovirales phage clone 3S_4, partial genome) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
gctttccgagggcggcaaccggatcagctacg	Protospacer
 **  ***** ******.********** .**

152. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to MF417877 (Uncultured Caudovirales phage clone 9F_7, partial genome) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
gctttccgagggcggcaaccggatcagctacg	Protospacer
 **  ***** ******.********** .**

153. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to MF417878 (Uncultured Caudovirales phage clone 8S_7, partial genome) position: , mismatch: 7, identity: 0.781

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
gctttccgagggcggcaaccggatcagctacg	Protospacer
 **  ***** ******.********** .**

154. spacer 3.5|2568377|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP011053 (Halomonas sp. KO116 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

tgggctggtggggaccgagctcggcaagg	CRISPR spacer
tgggctggtggggatcgacctcgacctac	Protospacer
**************.*** ****.*  . 

155. spacer 3.6|2568264|28|NZ_CP020975|PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 7, identity: 0.75

tcgatcacgctgggccagaaagtgacgg	CRISPR spacer
acgatcacgctgggccagcaactggacc	Protospacer
 ***************** ** **.   

156. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
cgagatcggtgccggtgagcagggcgccg	Protospacer
***************** ***.. *.  .

157. spacer 3.1|2568155|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 8, identity: 0.724

cgagatcggtgccggtgcgcaaaccaaga	CRISPR spacer
gcagagcggtgccggtgcgcatacctctg	Protospacer
  *** *************** ***   .

158. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NC_012527 (Deinococcus deserti VCD115 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.724

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gatcaccggcgacaacgggcgcaccgccc	Protospacer
   **.*********** ******** . 

159. spacer 3.2|2568209|29|NZ_CP020975|CRISPRCasFinder matches to NZ_CP015740 (Shinella sp. HZN7 plasmid pShin-04, complete sequence) position: , mismatch: 8, identity: 0.724

ccgcatcggcgacaacgcgcgcaccggtg	CRISPR spacer
gatcaccggcgacaacgcgcgcacggcca	Protospacer
   **.****************** * ..

160. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
gggagaagagcgcggcagcgggatgagcggcg	Protospacer
   .*  ************ **** *******

161. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021041 (Phaeobacter gallaeciensis strain P129 plasmid pP129_a, complete sequence) position: , mismatch: 8, identity: 0.75

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
tatcgtcgagcgcggcagcggcatcagcggtc	Protospacer
. * *.************* * ********. 

162. spacer 3.3|2568263|32|NZ_CP020975|CRISPRCasFinder matches to MT591577 (Yersinia phage vB_YpM_Tongde, complete genome) position: , mismatch: 9, identity: 0.719

cacgctgggccagaaagtgacggtgtccggcg	CRISPR spacer
atggcggggccagaaagagacggtgtacatcc	Protospacer
   ** *********** ******** *. * 

163. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 9, identity: 0.719

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgccgccgagcgcagcagcccgatcagcccgt	Protospacer
* . *********.****** *******    

164. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 9, identity: 0.719

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgccgccgagcgcagcagcccgatcagcccgt	Protospacer
* . *********.****** *******    

165. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 10, identity: 0.688

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
ttgcgccgagcgcggcaaccggaccagtcaag	Protospacer
..  *************.*****.***. . *

166. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_008382 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL7, complete sequence) position: , mismatch: 10, identity: 0.688

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
cgccatgcggcgcgggagccggatcagccgcg	Protospacer
* . ..  .****** ************ ***

167. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 10, identity: 0.688

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
ccaggccgaacgcggcagccggaatccagatc	Protospacer
** ******.************* .   *.. 

168. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
ccaggccgaacgcggcagccggaatccagatc	Protospacer
** ******.************* .   *.. 

169. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
ccaggccgaacgcggcagccggaatccagatc	Protospacer
** ******.************* .   *.. 

170. spacer 3.4|2568320|32|NZ_CP020975|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688

cctggccgagcgcggcagccggatcagcggcg	CRISPR spacer
ccaggccgaacgcggcagccggaatccagatc	Protospacer
** ******.************* .   *.. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 381029 : 439381 50 uncultured_Mediterranean_phage(38.46%) integrase,transposase,tRNA attL 417041:417100|attR 444730:444796
DBSCAN-SWA_2 444755 : 477804 34 Stenotrophomonas_phage(51.72%) head,plate,portal,terminase,transposase,capsid,tail NA
DBSCAN-SWA_3 1521897 : 1529948 7 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_4 2016420 : 2106168 60 uncultured_virus(22.22%) transposase,protease,plate NA
DBSCAN-SWA_5 2274970 : 2359224 55 Leptospira_phage(27.27%) integrase,transposase attL 2280158:2280217|attR 2365807:2367135
DBSCAN-SWA_6 2383987 : 2451971 58 uncultured_virus(16.67%) integrase,transposase attL 2393188:2393208|attR 2459295:2459315
DBSCAN-SWA_7 2456926 : 2533213 56 Leptospira_phage(21.43%) protease,transposase,tRNA,tail NA
DBSCAN-SWA_8 2613491 : 2687622 57 Leptospira_phage(25.0%) transposase,protease NA
DBSCAN-SWA_9 3256955 : 3333900 52 Organic_Lake_phycodnavirus(18.18%) transposase,protease NA
DBSCAN-SWA_10 3871487 : 3946449 53 Leptospira_phage(20.0%) transposase,protease NA
DBSCAN-SWA_11 4171185 : 4247858 60 Vibrio_phage(10.0%) transposase,tRNA,coat,protease NA
DBSCAN-SWA_12 4550910 : 4561738 7 Micromonas_pusilla_virus(16.67%) tRNA NA
DBSCAN-SWA_13 4743887 : 4770956 9 uncultured_virus(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP020977
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020977_1 29248-29354 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 CP020973 Xanthomonas axonopodis pv. phaseoli strain CFBP6546R plasmid pC, complete sequence 7596-7654 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 CP020973 Xanthomonas axonopodis pv. phaseoli strain CFBP6546R plasmid pC, complete sequence 60114-60172 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 CP020974 Xanthomonas axonopodis pv. phaseoli strain CFBP6546R plasmid unnamed1, complete sequence 12126-12184 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP021007 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6975 plasmid pC, complete sequence 30443-30501 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP020994 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 plasmid pC, complete sequence 35166-35224 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP020969 Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid pC, complete sequence 11009-11067 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP021020 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pC, complete sequence 33204-33262 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP012062 Xanthomonas sp. ISO98C4 plasmid pNX47, complete sequence 38762-38820 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP020977 Xanthomonas phaseoli pv. phaseoli strain CFBP6982 plasmid pC 29272-29330 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP012056 Xanthomonas citri pv. fuscans strain ISO12C3 plasmid pXff45, complete sequence 36784-36842 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP012054 Xanthomonas citri pv. fuscans strain ISO118C1 plasmid pXff45, complete sequence 36784-36842 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP021003 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 plasmid pC, complete sequence 1706-1764 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP021003 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 plasmid pC, complete sequence 43758-43816 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP012052 Xanthomonas citri pv. fuscans strain ISO118C5 plasmid pXff45, complete sequence 36784-36842 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 CP021014 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP7767 plasmid pC, complete sequence 31907-31965 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP012059 Xanthomonas phaseoli pv. phaseoli strain ISO98C12 plasmid pXap47, complete sequence 38764-38822 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP012065 Xanthomonas phaseoli pv. phaseoli strain ISO18C8 plasmid pXap48, complete sequence 40165-40223 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NZ_CP012050 Xanthomonas phaseoli pv. phaseoli strain ISO18C2 plasmid pXap48, complete sequence 40159-40217 0 1.0
NZ_CP020977_1 1.1|29272|59|NZ_CP020977|CRISPRCasFinder 29272-29330 59 NC_022542 Xanthomonas citri pv. fuscans plasmid plc, complete sequence 33981-34039 0 1.0

1. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to CP020973 (Xanthomonas axonopodis pv. phaseoli strain CFBP6546R plasmid pC, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

2. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to CP020973 (Xanthomonas axonopodis pv. phaseoli strain CFBP6546R plasmid pC, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

3. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to CP020974 (Xanthomonas axonopodis pv. phaseoli strain CFBP6546R plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

4. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP021007 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6975 plasmid pC, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

5. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP020994 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP4885 plasmid pC, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

6. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP020969 (Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid pC, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

7. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP021020 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pC, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

8. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP012062 (Xanthomonas sp. ISO98C4 plasmid pNX47, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

9. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP020977 (Xanthomonas phaseoli pv. phaseoli strain CFBP6982 plasmid pC) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

10. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP012056 (Xanthomonas citri pv. fuscans strain ISO12C3 plasmid pXff45, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

11. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP012054 (Xanthomonas citri pv. fuscans strain ISO118C1 plasmid pXff45, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

12. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP021003 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 plasmid pC, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

13. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP021003 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6166 plasmid pC, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

14. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP012052 (Xanthomonas citri pv. fuscans strain ISO118C5 plasmid pXff45, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

15. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to CP021014 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP7767 plasmid pC, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

16. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP012059 (Xanthomonas phaseoli pv. phaseoli strain ISO98C12 plasmid pXap47, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

17. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP012065 (Xanthomonas phaseoli pv. phaseoli strain ISO18C8 plasmid pXap48, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

18. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NZ_CP012050 (Xanthomonas phaseoli pv. phaseoli strain ISO18C2 plasmid pXap48, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

19. spacer 1.1|29272|59|NZ_CP020977|CRISPRCasFinder matches to NC_022542 (Xanthomonas citri pv. fuscans plasmid plc, complete sequence) position: , mismatch: 0, identity: 1.0

agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	CRISPR spacer
agctgaccaatccagcatgagcgccggtatcgccggcactgctgatggcgctcagtgtg	Protospacer
***********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage