1. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 2, identity: 0.92
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgagatgacgacgatcgcgaccgc Protospacer
*** ********************
2. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.92
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccatggcgacgaccgcgaccgc Protospacer
********.******.*********
3. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 2, identity: 0.92
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccatgacgacgatcgcgccggc Protospacer
******************** * **
4. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906
tcgctcgc-cgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcgcgcacgcgctcggcggcggcttcgccgc Protospacer
*** *** **** *******************
5. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906
tcgctcgc-cgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcgcgcacgcgctcggcggcggcttcgccgc Protospacer
*** *** **** *******************
6. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccatgccgacgatcgcgaccgc Protospacer
****** ****************
7. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 3, identity: 0.88
ccgccatgacgacgatcgcgaccgc CRISPR spacer
gcgctatgacgacgaccgcgaccgc Protospacer
***.**********.*********
8. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP052758 (Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence) position: , mismatch: 3, identity: 0.88
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccatgacgacgagcgcggccga Protospacer
*************** ****.***
9. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 3, identity: 0.88
ccgccatgacgacgatcgcgaccgc CRISPR spacer
gcgccatgaagtcgatcgcgaccgc Protospacer
******** * *************
10. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 3, identity: 0.88
ccgccatgacgacgatcgcgaccgc CRISPR spacer
cggccatgacgatgatcgcgacctc Protospacer
* **********.********** *
11. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 3, identity: 0.88
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgctatgacgacgaccgcgaccac Protospacer
****.**********.*******.*
12. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to KX815338 (Streptomyces phage Joe, complete genome) position: , mismatch: 3, identity: 0.88
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccatgaacacgatcgcgaccac Protospacer
********* ************.*
13. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 3, identity: 0.88
ccgccatgacgacgatcgcgaccgc CRISPR spacer
cggccatgacggcgatcgcgaccac Protospacer
* *********.***********.*
14. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
15. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
16. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
17. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
18. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
19. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
20. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
21. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
22. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
23. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
24. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
25. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
26. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
27. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
28. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
29. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
30. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
31. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
32. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
33. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
34. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
35. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
36. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875
-cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gcgcg-cgacgccgcgccggcggcgtggctggc Protospacer
**** **.** *******************.*
37. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
38. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
39. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
40. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
41. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
42. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
43. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
44. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
45. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
46. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
47. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
48. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
49. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
50. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
51. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
52. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
53. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
54. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
55. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
56. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
57. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
58. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.875
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcatcgccac Protospacer
*** ******** *********** *****.*
59. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875
-cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gcgcg-cgacgccgcgccggcggcgtggctggc Protospacer
**** **.** *******************.*
60. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccatcacgacgatcgcggccag Protospacer
******* ************.**.
61. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccatggcgacgatcgcgaccgg Protospacer
******.***************
62. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccatggcgacgatcgcgaccgg Protospacer
******.***************
63. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccatggcgacgatcgcgaccgg Protospacer
******.***************
64. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccttgacgacgatcgcgaccgg Protospacer
*** ******************
65. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccttgacgacgatcgcgaccgg Protospacer
*** ******************
66. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP040762 (Paracoccus sp. 2251 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccggcatgacgacgatcgcgacaag Protospacer
*** ****************** .
67. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccttgacgacgatcgcgaccgg Protospacer
*** ******************
68. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccttgacgacgatcgcgaccgg Protospacer
*** ******************
69. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccttgacgacgatcgcgaccgg Protospacer
*** ******************
70. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NC_015313 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED03, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
acgccaggacgacgatcgcgaccag Protospacer
***** ****************.
71. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccttgacgacgatcgcgaccgg Protospacer
*** ******************
72. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccttgacgacgatcgcgaccgg Protospacer
*** ******************
73. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccttgacgacgatcgcgaccgg Protospacer
*** ******************
74. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccttgacgacgatcgcgaccgg Protospacer
*** ******************
75. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccttgacgacgatcgcgaccgg Protospacer
*** ******************
76. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
aggccatgccgacgatcgcgaccgg Protospacer
****** ***************
77. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
acgccttgacgacgatcgcaaccgg Protospacer
**** *************.****
78. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
acgccttgacgacgatcgcaaccgg Protospacer
**** *************.****
79. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccacgacgacgatcgcgatcag Protospacer
******.**************.*.
80. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
gcgccacgacgacgatcgcgacgcc Protospacer
*****.*************** *
81. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccacgacgacgatcgcgatcag Protospacer
******.**************.*.
82. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
acgccatggcgacgatcgcgatcgg Protospacer
*******.************.**
83. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccacgacgacgatcgcgatcag Protospacer
******.**************.*.
84. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccacgacgacgatcgcgatcag Protospacer
******.**************.*.
85. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccacgacgacgatcgcgatcag Protospacer
******.**************.*.
86. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccacgacgacgatcgcgatcag Protospacer
******.**************.*.
87. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccacgacgacgatcgcgatcag Protospacer
******.**************.*.
88. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP012699 (Microbacterium sp. No. 7 plasmid B, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccatgaacacgatcgcgaccaa Protospacer
********* ************.
89. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to MN010758 (Gordonia phage Dardanus, complete genome) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
gggccatgacgaagatcgagaccgc Protospacer
********** ***** ******
90. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccacgacgacgatcgcgatcag Protospacer
******.**************.*.
91. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
acgccatggcgacgatcgcgatcgg Protospacer
*******.************.**
92. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP035507 (Haematobacter massiliensis strain OT1 plasmid pOT1-7, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccacgacgacgatctcgaccat Protospacer
******.********** *****..
93. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP021803 (Sinorhizobium meliloti strain USDA1021 plasmid accessoryA, complete sequence) position: , mismatch: 4, identity: 0.84
ccgccatgacgacgatcgcgaccgc CRISPR spacer
gcgcgatgacgacgatcgcgagcgg Protospacer
*** **************** **
94. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
atcg-gcgccgcgatcgccggcgccttcgccga Protospacer
*** *********** ***** ********
95. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP047181 (Rathayibacter festucae strain VKM Ac-2802 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcg-gcgccgcgatcggcgtcggcatcgccgt Protospacer
*** ************** **** ******.
96. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcac-ggtcgcgatcggcggcggcttcgacgc Protospacer
**.* *.******************** ***
97. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP047184 (Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcg-gcgccgcgatcggcgtcggcatcgccgt Protospacer
*** ************** **** ******.
98. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcg-gcgccgcgatcggcgtcggcatcgccgt Protospacer
*** ************** **** ******.
99. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcgtcgcggt Protospacer
*** ******** *********** **** *.
100. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to MH371124 (Microbacterium phage VitulaEligans, complete genome) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcgct-gccgcgatcggcgtcggcgtcgccaa Protospacer
***** ************* **** *****.
101. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to MT316458 (Microbacterium phage McShie, complete genome) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcgct-gccgcgatcggcgtcggcgtcgccaa Protospacer
***** ************* **** *****.
102. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.844
cgcgac-ggcgacgcgccggcggcgtggctgac CRISPR spacer
-gtgacgggcgacgcgccggcggccgggctgcc Protospacer
*.*** ***************** ***** *
103. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 5, identity: 0.848
cagcttct--cgctgccgcgccgccgcaaggtgga CRISPR spacer
--gcttctgccgctggcgcgccgccgcaaggcggg Protospacer
****** ***** ***************.**.
104. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to MK737941 (Microbacterium phage Rachella, complete genome) position: , mismatch: 5, identity: 0.844
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccagaacctcgccagccg Protospacer
******************* **** **..**.
105. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NC_047986 (Microbacterium phage Krampus, complete genome) position: , mismatch: 5, identity: 0.844
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccagaacctcgccagccg Protospacer
******************* **** **..**.
106. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to MH271292 (Microbacterium phage AnnaSerena, complete genome) position: , mismatch: 5, identity: 0.844
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccagaacctcgccagccg Protospacer
******************* **** **..**.
107. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to MT522003 (Microbacterium phage Rie18, complete genome) position: , mismatch: 5, identity: 0.844
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccagaacctcgccagccg Protospacer
******************* **** **..**.
108. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 5, identity: 0.844
gccgccgacgccgaccagatcctctccgacca- CRISPR spacer
cccgcggacgccgacgagatcctc-gcgaccac Protospacer
**** ********* ******** ******
109. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NC_013417 (Streptomyces sp. x3 plasmid pTSC2, complete sequence) position: , mismatch: 5, identity: 0.844
gcgtg-ctgacgctcacgggcacgccgggcgtg CRISPR spacer
-cgtgaccgacgctcgcgggcacgccggtcgcg Protospacer
**** *.*******.************ **.*
110. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.844
tcgccgccgatgccgatgggcatgatcgtcgc- CRISPR spacer
tcgccgccgaggacgatgggcatgg-cgccgcg Protospacer
********** * ***********. **.***
111. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
atcg-gcgccgcgatcgccggcgccttcgccga Protospacer
*** *********** ***** ********
112. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP047181 (Rathayibacter festucae strain VKM Ac-2802 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcg-gcgccgcgatcggcgtcggcatcgccgt Protospacer
*** ************** **** ******.
113. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcac-ggtcgcgatcggcggcggcttcgacgc Protospacer
**.* *.******************** ***
114. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP047184 (Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcg-gcgccgcgatcggcgtcggcatcgccgt Protospacer
*** ************** **** ******.
115. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcg-gcgccgcgatcggcgtcggcatcgccgt Protospacer
*** ************** **** ******.
116. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
tcgc-tcgccgcgatcggcggcggcttcgccgc CRISPR spacer
-cgcatcgccgcgctcggcggcggcgtcgcggt Protospacer
*** ******** *********** **** *.
117. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MH371124 (Microbacterium phage VitulaEligans, complete genome) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcgct-gccgcgatcggcgtcggcgtcgccaa Protospacer
***** ************* **** *****.
118. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MT316458 (Microbacterium phage McShie, complete genome) position: , mismatch: 5, identity: 0.844
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcgct-gccgcgatcggcgtcggcgtcgccaa Protospacer
***** ************* **** *****.
119. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.844
cgcgac-ggcgacgcgccggcggcgtggctgac CRISPR spacer
-gtgacgggcgacgcgccggcggccgggctgcc Protospacer
*.*** ***************** ***** *
120. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 5, identity: 0.848
cagcttct--cgctgccgcgccgccgcaaggtgga CRISPR spacer
--gcttctgccgctggcgcgccgccgcaaggcggg Protospacer
****** ***** ***************.**.
121. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MK737941 (Microbacterium phage Rachella, complete genome) position: , mismatch: 5, identity: 0.844
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccagaacctcgccagccg Protospacer
******************* **** **..**.
122. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_047986 (Microbacterium phage Krampus, complete genome) position: , mismatch: 5, identity: 0.844
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccagaacctcgccagccg Protospacer
******************* **** **..**.
123. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MH271292 (Microbacterium phage AnnaSerena, complete genome) position: , mismatch: 5, identity: 0.844
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccagaacctcgccagccg Protospacer
******************* **** **..**.
124. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MT522003 (Microbacterium phage Rie18, complete genome) position: , mismatch: 5, identity: 0.844
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccagaacctcgccagccg Protospacer
******************* **** **..**.
125. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 5, identity: 0.844
gccgccgacgccgaccagatcctctccgacca- CRISPR spacer
cccgcggacgccgacgagatcctc-gcgaccac Protospacer
**** ********* ******** ******
126. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_013417 (Streptomyces sp. x3 plasmid pTSC2, complete sequence) position: , mismatch: 5, identity: 0.844
gcgtg-ctgacgctcacgggcacgccgggcgtg CRISPR spacer
-cgtgaccgacgctcgcgggcacgccggtcgcg Protospacer
**** *.*******.************ **.*
127. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.844
tcgccgccgatgccgatgggcatgatcgtcgc- CRISPR spacer
tcgccgccgaggacgatgggcatgg-cgccgcg Protospacer
********** * ***********. **.***
128. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 5, identity: 0.8
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccatgacgacgatcgccgtcca Protospacer
******************* ..*
129. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.8
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccatgacgacgatcgccgtcca Protospacer
******************* ..*
130. spacer 6.5|1059887|25|NZ_CP018044|CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 5, identity: 0.8
ccgccatgacgacgatcgcgaccgc CRISPR spacer
ccgccatgacgacgatcgccgtcca Protospacer
******************* ..*
131. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP045331 (Labrenzia sp. THAF191b plasmid pTHAF191b_c, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cccctcgccgcgatcggcggcggcttcatcaa Protospacer
.* ************************..*.
132. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP045347 (Labrenzia sp. THAF187b plasmid pTHAF187b_c, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cccctcgccgcgatcggcggcggcttcatcaa Protospacer
.* ************************..*.
133. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP045336 (Labrenzia sp. THAF191a plasmid pTHAF191a_c, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cccctcgccgcgatcggcggcggcttcatcaa Protospacer
.* ************************..*.
134. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP045382 (Labrenzia sp. THAF35 plasmid pTHAF35_b, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cccctcgccgcgatcggcggcggcttcatcaa Protospacer
.* ************************..*.
135. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gccgccgccgcgatcggcggaggcatcgccgc Protospacer
* .*************** *** *******
136. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcac-ggtcgcgatcggcggcggcttcacggc Protospacer
**.* *.*******************.* **
137. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP041042 (Paracoccus sp. AK26 plasmid pAK4, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttccgcgacgcgatccgcggcggcttcgccga Protospacer
*. * ** ******* ***************
138. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ccgctcgccgcgatcgacggcggcatgcgcgc Protospacer
.***************.******* * ***
139. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggc-ttcgccgc CRISPR spacer
ccgcgcgccgctatcggcggcggcggtcgcgg- Protospacer
.*** ****** ************ **** *
140. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgcgacggcgccgcgctggcggcggtgttgcc Protospacer
********** *****.******* *.** *
141. spacer 1.27|143516|32|NZ_CP018044|PILER-CR matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 6, identity: 0.812
gtctgtggctatcggcatgtcgttgtcatagg CRISPR spacer
gagagcggcgatcggcatgtcgttggcatagg Protospacer
* *.*** *************** ******
142. spacer 1.27|143516|32|NZ_CP018044|PILER-CR matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 6, identity: 0.812
gtctgtggctatcggcatgtcgttgtcatagg CRISPR spacer
gagagcggcgatcggcatgtcgttggcatagg Protospacer
* *.*** *************** ******
143. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to MT684592 (Microbacterium phage Aesir, complete genome) position: , mismatch: 6, identity: 0.812
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
tccgccgacgccgaccagaacctcaccagccg Protospacer
****************** **** **..**.
144. spacer 1.58|145410|32|NZ_CP018044|PILER-CR matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 6, identity: 0.812
atgcagaagttggcgtcgcttgaggcggacgt CRISPR spacer
atggcggggttggcggcgcttgaggcggccgt Protospacer
*** *..******* ************ ***
145. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 6, identity: 0.812
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
gcgaagacgaggccgatggccatgatcgtcgc Protospacer
** * *** ******** ************
146. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP015747 (Shinella sp. HZN7 plasmid pShin-11, complete sequence) position: , mismatch: 6, identity: 0.812
tcgccgccgatgccgatgggcatgatcgtcgc---- CRISPR spacer
tcgtcgccgatgtcgatgggcat----gtcgcaagg Protospacer
***.********.********** *****
147. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP034782 (Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence) position: , mismatch: 6, identity: 0.812
tcgccgccgatgccgatgggcatgatcgtcgc- CRISPR spacer
tcgccgccaatgccgatgggtatca-cgccact Protospacer
********.***********.** * **.*.*
148. spacer 1.76|146509|32|NZ_CP018044|PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.812
-acgcggcgaagcgcgcgcgacgccgtgcgtct CRISPR spacer
cacg-ggcgaagtgcgcgcggcgccgtgcagca Protospacer
*** *******.*******.********. *
149. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP045331 (Labrenzia sp. THAF191b plasmid pTHAF191b_c, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cccctcgccgcgatcggcggcggcttcatcaa Protospacer
.* ************************..*.
150. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP045347 (Labrenzia sp. THAF187b plasmid pTHAF187b_c, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cccctcgccgcgatcggcggcggcttcatcaa Protospacer
.* ************************..*.
151. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP045336 (Labrenzia sp. THAF191a plasmid pTHAF191a_c, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cccctcgccgcgatcggcggcggcttcatcaa Protospacer
.* ************************..*.
152. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP045382 (Labrenzia sp. THAF35 plasmid pTHAF35_b, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cccctcgccgcgatcggcggcggcttcatcaa Protospacer
.* ************************..*.
153. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gccgccgccgcgatcggcggaggcatcgccgc Protospacer
* .*************** *** *******
154. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcac-ggtcgcgatcggcggcggcttcacggc Protospacer
**.* *.*******************.* **
155. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP041042 (Paracoccus sp. AK26 plasmid pAK4, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttccgcgacgcgatccgcggcggcttcgccga Protospacer
*. * ** ******* ***************
156. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ccgctcgccgcgatcgacggcggcatgcgcgc Protospacer
.***************.******* * ***
157. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 6, identity: 0.812
tcgctcgccgcgatcggcggcggc-ttcgccgc CRISPR spacer
ccgcgcgccgctatcggcggcggcggtcgcgg- Protospacer
.*** ****** ************ **** *
158. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgcgacggcgccgcgctggcggcggtgttgcc Protospacer
********** *****.******* *.** *
159. spacer 1.102|143507|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 6, identity: 0.812
gtctgtggctatcggcatgtcgttgtcatagg CRISPR spacer
gagagcggcgatcggcatgtcgttggcatagg Protospacer
* *.*** *************** ******
160. spacer 1.102|143507|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 6, identity: 0.812
gtctgtggctatcggcatgtcgttgtcatagg CRISPR spacer
gagagcggcgatcggcatgtcgttggcatagg Protospacer
* *.*** *************** ******
161. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MT684592 (Microbacterium phage Aesir, complete genome) position: , mismatch: 6, identity: 0.812
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
tccgccgacgccgaccagaacctcaccagccg Protospacer
****************** **** **..**.
162. spacer 1.133|145398|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 6, identity: 0.812
atgcagaagttggcgtcgcttgaggcggacgt CRISPR spacer
atggcggggttggcggcgcttgaggcggccgt Protospacer
*** *..******* ************ ***
163. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 6, identity: 0.812
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
gcgaagacgaggccgatggccatgatcgtcgc Protospacer
** * *** ******** ************
164. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015747 (Shinella sp. HZN7 plasmid pShin-11, complete sequence) position: , mismatch: 6, identity: 0.812
tcgccgccgatgccgatgggcatgatcgtcgc---- CRISPR spacer
tcgtcgccgatgtcgatgggcat----gtcgcaagg Protospacer
***.********.********** *****
165. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP034782 (Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence) position: , mismatch: 6, identity: 0.812
tcgccgccgatgccgatgggcatgatcgtcgc- CRISPR spacer
tcgccgccaatgccgatgggtatca-cgccact Protospacer
********.***********.** * **.*.*
166. spacer 1.151|146497|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.812
-acgcggcgaagcgcgcgcgacgccgtgcgtct CRISPR spacer
cacg-ggcgaagtgcgcgcggcgccgtgcagca Protospacer
*** *******.*******.********. *
167. spacer 1.1|141922|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
gtcggcaccgatggtgatgaccgcgaccaccc CRISPR spacer
gtcggcaccggtggtgatgagcgccagtccgc Protospacer
**********.********* *** * . * *
168. spacer 1.3|142044|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018621 (Paenibacillus xylanexedens strain PAMC 22703 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tgatccca----cagattcaatgagttatgccagtc CRISPR spacer
----cccaagatcagattcaatgagttcggccagtt Protospacer
**** *************** ******.
169. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.781
gattgctgcgtacactgccgccgcc-gcgtact CRISPR spacer
gcatgctgcgcacaccgccgccgccggcgggc- Protospacer
* *******.****.********* *** .*
170. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022416 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence) position: , mismatch: 7, identity: 0.781
gattgctgcgtacactgccgccgcc-gcgtact CRISPR spacer
tgttgcgccgtacactgccgccgccagcgtgt- Protospacer
.**** ***************** ****..
171. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 7, identity: 0.781
gattgctgcgtacactgccgccgcc-gcgtact CRISPR spacer
gcatgctgcgcacaccgccgccgccggcgggc- Protospacer
* *******.****.********* *** .*
172. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgaggctgccgaggtcgcgcgccatcgtgagg Protospacer
***********. ********** . .****
173. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 7, identity: 0.781
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgacggtgccggtgtcgcgcgccatccggatg Protospacer
*** * ***************** .* ** *
174. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgggctcgccggtgtcgcgcgcccgttcgatg Protospacer
**.* ..****************.**.*** *
175. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
176. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
177. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
178. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
179. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
180. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
181. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
182. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
183. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
184. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
185. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
186. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
187. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
188. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
189. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cgccgcgccgcgatcggcggcggcgtctccga Protospacer
. * ******************* ** ***
190. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc- CRISPR spacer
ccgctccgcgcgatcggcggcggc-cggcggcc Protospacer
.***** **************** . ** **
191. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
--tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gatcgcc--tcgcgcgcggcggcggcttcgccgg Protospacer
****. .**** *****************
192. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcg-tgaccgccatcggcggcggctacgccct Protospacer
*** * .**** ************* **** .
193. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
194. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
195. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
196. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
tcctgcgccgcgatcggcggcggcagcgcctt Protospacer
** . ******************* **** .
197. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
198. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
199. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
200. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
201. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
202. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
203. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gggctcgccgagaacggcggcggcttccacgg Protospacer
******** ** ************* **
204. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
205. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
206. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
207. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
208. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
209. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
210. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
211. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
212. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
213. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
214. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgtccggggcgatgggcggcggctttgccgc Protospacer
**..** ***** ***********.*****
215. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgtccggggcgatgggcggcggctttgccgc Protospacer
**..** ***** ***********.*****
216. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc---- CRISPR spacer
ccgcacgccgcgatccgcggcggc----ccgcaatt Protospacer
.*** ********** ******** ****
217. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gctcccgccgtgatcggcggcgccttcgcgcc Protospacer
* *.*****.*********** ****** *
218. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to MH834619 (Arthrobacter phage Maureen, complete genome) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ccactcgacgcgatcggcggcggcgtcagcgt Protospacer
.*.**** **************** **. **.
219. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_048115 (Arthrobacter phage Liebe, complete genome) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ccactcgacgcgatcggcggcggcgtcagcgt Protospacer
.*.**** **************** **. **.
220. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgtccggggcgatgggcggcggctttgccgc Protospacer
**..** ***** ***********.*****
221. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgtccggggcgatgggcggcggctttgccgc Protospacer
**..** ***** ***********.*****
222. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
--tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gatcgcc--tcgcgcgcggcggcggcttcgccgg Protospacer
****. .**** *****************
223. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP024425 (Paracoccus yeei strain TT13 plasmid pTT13-3, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcg-gcaacgggatcggcggccgcttcgccga Protospacer
*** *. ** ********** *********
224. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
--tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gatcgcc--tcgcgcgcggcggcggcttcgccgg Protospacer
****. .**** *****************
225. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
--tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gatcgcc--tcgcgcgcggcggcggcttcgccgg Protospacer
****. .**** *****************
226. spacer 1.21|143150|32|NZ_CP018044|PILER-CR matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 7, identity: 0.781
gagcaggaagcgtcctacatcaccggcaagag CRISPR spacer
gctgacgaggcgtcctacatcaccggccagac Protospacer
* * **.****************** ***
227. spacer 1.21|143150|32|NZ_CP018044|PILER-CR matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 7, identity: 0.781
gagcaggaagcgtcctacatcaccggcaagag CRISPR spacer
gctgacgaggcgtcctacatcaccggccagac Protospacer
* * **.****************** ***
228. spacer 1.21|143150|32|NZ_CP018044|PILER-CR matches to NZ_CP033228 (Sphingobium yanoikuyae strain SJTF8 plasmid pF2, complete sequence) position: , mismatch: 7, identity: 0.781
gagcaggaagcgtcctacatcaccggcaagag CRISPR spacer
gctgacgaggcgtcctacatcaccggccagac Protospacer
* * **.****************** ***
229. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP048428 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acctatggcgaggcgccggcggcgtggcttcc Protospacer
* *.***** ***************** *
230. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgcgacggcgacggggcggcggcgttcttggg Protospacer
************* * ********* .**.
231. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP010630 (Phaeobacter inhibens strain P78 plasmid pP78_a, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgcgacagcgccgcgccggcggcgggtcccat Protospacer
******.*** ************* * *. *.
232. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgggacggcgacgcggcggcggccggggaggc Protospacer
** ************ ******* ** *.*
233. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgacggcgacgcgccggcggcg-tggctgac CRISPR spacer
ggcgacggcgacgcggcggccgcgctgagcga- Protospacer
************** **** *** **. .**
234. spacer 1.27|143516|32|NZ_CP018044|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.781
gtctgtggctatcggcatgtcgttgtcatagg CRISPR spacer
gtctgtggctatcggcatctcgatgtgcagcg Protospacer
****************** *** *** . *
235. spacer 1.36|144065|32|NZ_CP018044|PILER-CR matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.781
tcgtgcgtttgcgggcgggcaggtggagatct CRISPR spacer
tggcgcccttgcggtcgggccggtggagatcg Protospacer
* *.** .****** ***** **********
236. spacer 1.42|144434|32|NZ_CP018044|PILER-CR matches to NC_025028 (Uncultured bacterium pMCBF6 plasmid pMCBF6, complete sequence) position: , mismatch: 7, identity: 0.781
--aacgccgacgccattgaatcggaggcgaagaa CRISPR spacer
gtaatgac--cgccattgaatcggtggcgcagac Protospacer
**.* * ************** **** ***
237. spacer 1.44|144556|32|NZ_CP018044|PILER-CR matches to NZ_AP019633 (Enterobacter asburiae strain 1808-013 plasmid pEAS1808-013-1, complete sequence) position: , mismatch: 7, identity: 0.781
accacctgc-----cccgtcaaaaactgccagttgat CRISPR spacer
-----ctgcgaaatcccgtcaaaaacgtccagttgat Protospacer
**** ************ *********
238. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP010658 (Phaeobacter piscinae strain P71 plasmid pP71_b, complete sequence) position: , mismatch: 7, identity: 0.788
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
cggtctctcggtgccgcgccgccgcaaggcagc Protospacer
*.*..***** ******************..*
239. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 7, identity: 0.788
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
cggtctctcggtgccgcgccgccgcaaggcagc Protospacer
*.*..***** ******************..*
240. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 7, identity: 0.788
cagcttc--tcgctgccgcgccgccgcaaggtgga CRISPR spacer
--gctgccgccgctgccgcgccgccgcacggcggt Protospacer
*** * .****************** **.**
241. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP043044 (Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
ggctacgacgccgaccagatccgcgccgacat Protospacer
* * ***************** * *****
242. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
243. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
244. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgacgacgccgacccgatcctgccgcacga Protospacer
**** *********** ****** .* ** *
245. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
246. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
247. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
248. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
249. spacer 1.55|145227|32|NZ_CP018044|PILER-CR matches to NZ_CP030832 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence) position: , mismatch: 7, identity: 0.781
gtatccggcgtgccgaaaatcgagaagagagt CRISPR spacer
gtaaatggcatgccgaaaaccgagaagagcga Protospacer
*** .***.*********.********* *
250. spacer 1.57|145349|32|NZ_CP018044|PILER-CR matches to KR337643 (Propionibacterium phage MrAK, complete genome) position: , mismatch: 7, identity: 0.781
acctgcgtgagacgattcgacacctgctgcag CRISPR spacer
cactgcgtgggacgattcgacaccagcaacac Protospacer
*******.************** ** .**
251. spacer 1.59|145471|32|NZ_CP018044|PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cgcactgtggttcaccgccgcagcgtcgaact CRISPR spacer
cgcaccctggttcaccgccgcagccgtgtaat Protospacer
*****. ***************** .* * *
252. spacer 1.59|145471|32|NZ_CP018044|PILER-CR matches to NZ_KT935445 (Klebsiella pneumoniae strain Kp6411 plasmid 6411TF, complete sequence) position: , mismatch: 7, identity: 0.781
cgcactgtggttcaccgccgcagcgtcgaact CRISPR spacer
ccgattgacgttcagcgccgcagcgtcgagct Protospacer
* *.** ***** **************.**
253. spacer 1.59|145471|32|NZ_CP018044|PILER-CR matches to NZ_KT935445 (Klebsiella pneumoniae strain Kp6411 plasmid 6411TF, complete sequence) position: , mismatch: 7, identity: 0.781
cgcactgtggttcaccgccgcagcgtcgaact CRISPR spacer
ccgattgacgttcagcgccgcagcgtcgagct Protospacer
* *.** ***** **************.**
254. spacer 1.59|145471|32|NZ_CP018044|PILER-CR matches to NZ_KT935446 (Klebsiella pneumoniae strain Kp2964 plasmid 2964TF, complete sequence) position: , mismatch: 7, identity: 0.781
cgcactgtggttcaccgccgcagcgtcgaact CRISPR spacer
ccgattgacgttcagcgccgcagcgtcgagct Protospacer
* *.** ***** **************.**
255. spacer 1.59|145471|32|NZ_CP018044|PILER-CR matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 7, identity: 0.781
cgcactgtggttcaccgccgcagc--gtcgaact CRISPR spacer
agcactgttgttcaccgccgctgccggtccag-- Protospacer
******* ************ ** *** *.
256. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
gcacggtgacgctgaccggcacgccgggcgac Protospacer
**..* ******* ** *************
257. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
gcacggtgacgctgaccggcacgccgggcgac Protospacer
**..* ******* ** *************
258. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
tcgtggtgacgatcacgggcacgcggcccgcg Protospacer
**** ***** ************ * **.*
259. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
tcgtggtgacgatcacgggcacgcggcccgcg Protospacer
**** ***** ************ * **.*
260. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtgctgacgctcacgggcacg-ccgggcgtg CRISPR spacer
gcgtgctgacgctgacggtcacgttcaagctt- Protospacer
************* **** **** .*..** *
261. spacer 1.62|145654|32|NZ_CP018044|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gagacgatgctttccagagcggtcaggcggtc CRISPR spacer
catacgatgctgtccaaagcggtcagtcagcc Protospacer
* ******** ****.********* *.*.*
262. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 7, identity: 0.781
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
aaactcgccggcgccgtgtccggtatcgcgct Protospacer
* ****** ******* *********.* *
263. spacer 1.72|146265|32|NZ_CP018044|PILER-CR matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
gtgcggacagtgggcgcgctcgggatgcagtc CRISPR spacer
attcaaacagggggcgcgctcggtatgcagac Protospacer
.* *..**** ************ ****** *
264. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.781
tcgccgccgatgccgatgggcatgatcgtcgc- CRISPR spacer
tggccgccgatgccgatggccgtgat-gccatt Protospacer
* ***************** *.**** *.*..
265. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 7, identity: 0.781
tcgccgccgatgccgatgggcatgatcgtcgc- CRISPR spacer
tgcccgccgatgccgatggccgtgat-gccgtt Protospacer
* **************** *.**** *.**.
266. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
tcgccgc--cgatgccgatgggcatgatcgtcgc CRISPR spacer
--gccattacggtgccgatgggcaagatcgtctc Protospacer
***.. **.************ ******* *
267. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.781
tcgccgc--cgatgccgatgggcatgatcgtcgc CRISPR spacer
--gccattacggtgccgatgggcaagatcgtctc Protospacer
***.. **.************ ******* *
268. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 7, identity: 0.781
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
acgaagacgaggccgatggccatgatcgtcac Protospacer
** * *** ******** **********.*
269. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
270. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
271. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
272. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
273. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
274. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
275. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
276. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
277. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
278. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
279. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
280. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
281. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
282. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
283. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
284. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
285. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
286. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
287. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
288. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
289. spacer 1.76|146509|32|NZ_CP018044|PILER-CR matches to NC_007950 (Polaromonas sp. JS666 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
acgcggcgaagcgcgcgcgacgccgt-gcgtct CRISPR spacer
tgccggcgaagctcgcgcgaagccgtggcgac- Protospacer
********* ******* ***** *** *
290. spacer 1.79|146692|32|NZ_CP018044|PILER-CR matches to MN096367 (Microbacterium phage Nucci, complete genome) position: , mismatch: 7, identity: 0.781
ttcgt-tcgctgctgctggaaattaagccgggt CRISPR spacer
-ccgtggcgctgctgctggaactgaagccggtc Protospacer
.*** ************** * ******* .
291. spacer 1.81|142227|31|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 7, identity: 0.774
ccacgtcgctgcggcccagcgccgtc---atcca CRISPR spacer
tcacgtcgctgcgccccagcgcctcccggat--- Protospacer
.************ ********* .* **
292. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgaggctgccgaggtcgcgcgccatcgtgagg Protospacer
***********. ********** . .****
293. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 7, identity: 0.781
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgacggtgccggtgtcgcgcgccatccggatg Protospacer
*** * ***************** .* ** *
294. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgggctcgccggtgtcgcgcgcccgttcgatg Protospacer
**.* ..****************.**.*** *
295. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
296. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
297. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
298. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
299. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
300. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
301. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
302. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
303. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
304. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
305. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
306. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
307. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
308. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcaccgg Protospacer
******.****************.***
309. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cgccgcgccgcgatcggcggcggcgtctccga Protospacer
. * ******************* ** ***
310. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc- CRISPR spacer
ccgctccgcgcgatcggcggcggc-cggcggcc Protospacer
.***** **************** . ** **
311. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
--tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gatcgcc--tcgcgcgcggcggcggcttcgccgg Protospacer
****. .**** *****************
312. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcg-tgaccgccatcggcggcggctacgccct Protospacer
*** * .**** ************* **** .
313. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
314. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
315. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
316. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
tcctgcgccgcgatcggcggcggcagcgcctt Protospacer
** . ******************* **** .
317. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
318. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
319. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
320. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
321. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
322. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
323. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gggctcgccgagaacggcggcggcttccacgg Protospacer
******** ** ************* **
324. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
325. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
326. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
327. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
328. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
329. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
330. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
331. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
332. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
333. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aggctcgccgtcatcggcggcggcttcatcgg Protospacer
********. ***************..**
334. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgtccggggcgatgggcggcggctttgccgc Protospacer
**..** ***** ***********.*****
335. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgtccggggcgatgggcggcggctttgccgc Protospacer
**..** ***** ***********.*****
336. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc---- CRISPR spacer
ccgcacgccgcgatccgcggcggc----ccgcaatt Protospacer
.*** ********** ******** ****
337. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gctcccgccgtgatcggcggcgccttcgcgcc Protospacer
* *.*****.*********** ****** *
338. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MH834619 (Arthrobacter phage Maureen, complete genome) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ccactcgacgcgatcggcggcggcgtcagcgt Protospacer
.*.**** **************** **. **.
339. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_048115 (Arthrobacter phage Liebe, complete genome) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ccactcgacgcgatcggcggcggcgtcagcgt Protospacer
.*.**** **************** **. **.
340. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgtccggggcgatgggcggcggctttgccgc Protospacer
**..** ***** ***********.*****
341. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.781
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgtccggggcgatgggcggcggctttgccgc Protospacer
**..** ***** ***********.*****
342. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
--tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gatcgcc--tcgcgcgcggcggcggcttcgccgg Protospacer
****. .**** *****************
343. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP024425 (Paracoccus yeei strain TT13 plasmid pTT13-3, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtcg-gcaacgggatcggcggccgcttcgccga Protospacer
*** *. ** ********** *********
344. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
--tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gatcgcc--tcgcgcgcggcggcggcttcgccgg Protospacer
****. .**** *****************
345. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
--tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gatcgcc--tcgcgcgcggcggcggcttcgccgg Protospacer
****. .**** *****************
346. spacer 1.96|143141|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 7, identity: 0.781
gagcaggaagcgtcctacatcaccggcaagag CRISPR spacer
gctgacgaggcgtcctacatcaccggccagac Protospacer
* * **.****************** ***
347. spacer 1.96|143141|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 7, identity: 0.781
gagcaggaagcgtcctacatcaccggcaagag CRISPR spacer
gctgacgaggcgtcctacatcaccggccagac Protospacer
* * **.****************** ***
348. spacer 1.96|143141|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP033228 (Sphingobium yanoikuyae strain SJTF8 plasmid pF2, complete sequence) position: , mismatch: 7, identity: 0.781
gagcaggaagcgtcctacatcaccggcaagag CRISPR spacer
gctgacgaggcgtcctacatcaccggccagac Protospacer
* * **.****************** ***
349. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP048428 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acctatggcgaggcgccggcggcgtggcttcc Protospacer
* *.***** ***************** *
350. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgcgacggcgacggggcggcggcgttcttggg Protospacer
************* * ********* .**.
351. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP010630 (Phaeobacter inhibens strain P78 plasmid pP78_a, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgcgacagcgccgcgccggcggcgggtcccat Protospacer
******.*** ************* * *. *.
352. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgggacggcgacgcggcggcggccggggaggc Protospacer
** ************ ******* ** *.*
353. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781
cgcgacggcgacgcgccggcggcg-tggctgac CRISPR spacer
ggcgacggcgacgcggcggccgcgctgagcga- Protospacer
************** **** *** **. .**
354. spacer 1.102|143507|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.781
gtctgtggctatcggcatgtcgttgtcatagg CRISPR spacer
gtctgtggctatcggcatctcgatgtgcagcg Protospacer
****************** *** *** . *
355. spacer 1.111|144056|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.781
tcgtgcgtttgcgggcgggcaggtggagatct CRISPR spacer
tggcgcccttgcggtcgggccggtggagatcg Protospacer
* *.** .****** ***** **********
356. spacer 1.117|144422|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_025028 (Uncultured bacterium pMCBF6 plasmid pMCBF6, complete sequence) position: , mismatch: 7, identity: 0.781
--aacgccgacgccattgaatcggaggcgaagaa CRISPR spacer
gtaatgac--cgccattgaatcggtggcgcagac Protospacer
**.* * ************** **** ***
357. spacer 1.119|144544|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP019633 (Enterobacter asburiae strain 1808-013 plasmid pEAS1808-013-1, complete sequence) position: , mismatch: 7, identity: 0.781
accacctgc-----cccgtcaaaaactgccagttgat CRISPR spacer
-----ctgcgaaatcccgtcaaaaacgtccagttgat Protospacer
**** ************ *********
358. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP010658 (Phaeobacter piscinae strain P71 plasmid pP71_b, complete sequence) position: , mismatch: 7, identity: 0.788
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
cggtctctcggtgccgcgccgccgcaaggcagc Protospacer
*.*..***** ******************..*
359. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 7, identity: 0.788
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
cggtctctcggtgccgcgccgccgcaaggcagc Protospacer
*.*..***** ******************..*
360. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 7, identity: 0.788
cagcttc--tcgctgccgcgccgccgcaaggtgga CRISPR spacer
--gctgccgccgctgccgcgccgccgcacggcggt Protospacer
*** * .****************** **.**
361. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP043044 (Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
ggctacgacgccgaccagatccgcgccgacat Protospacer
* * ***************** * *****
362. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
363. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
364. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgacgacgccgacccgatcctgccgcacga Protospacer
**** *********** ****** .* ** *
365. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
366. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
367. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
368. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgagggcgaccagatcctgacggccaa Protospacer
******** * ************ * * * *
369. spacer 1.130|145215|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP030832 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence) position: , mismatch: 7, identity: 0.781
gtatccggcgtgccgaaaatcgagaagagagt CRISPR spacer
gtaaatggcatgccgaaaaccgagaagagcga Protospacer
*** .***.*********.********* *
370. spacer 1.132|145337|32|NZ_CP018044|CRISPRCasFinder,CRT matches to KR337643 (Propionibacterium phage MrAK, complete genome) position: , mismatch: 7, identity: 0.781
acctgcgtgagacgattcgacacctgctgcag CRISPR spacer
cactgcgtgggacgattcgacaccagcaacac Protospacer
*******.************** ** .**
371. spacer 1.134|145459|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cgcactgtggttcaccgccgcagcgtcgaact CRISPR spacer
cgcaccctggttcaccgccgcagccgtgtaat Protospacer
*****. ***************** .* * *
372. spacer 1.134|145459|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_KT935445 (Klebsiella pneumoniae strain Kp6411 plasmid 6411TF, complete sequence) position: , mismatch: 7, identity: 0.781
cgcactgtggttcaccgccgcagcgtcgaact CRISPR spacer
ccgattgacgttcagcgccgcagcgtcgagct Protospacer
* *.** ***** **************.**
373. spacer 1.134|145459|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_KT935445 (Klebsiella pneumoniae strain Kp6411 plasmid 6411TF, complete sequence) position: , mismatch: 7, identity: 0.781
cgcactgtggttcaccgccgcagcgtcgaact CRISPR spacer
ccgattgacgttcagcgccgcagcgtcgagct Protospacer
* *.** ***** **************.**
374. spacer 1.134|145459|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_KT935446 (Klebsiella pneumoniae strain Kp2964 plasmid 2964TF, complete sequence) position: , mismatch: 7, identity: 0.781
cgcactgtggttcaccgccgcagcgtcgaact CRISPR spacer
ccgattgacgttcagcgccgcagcgtcgagct Protospacer
* *.** ***** **************.**
375. spacer 1.134|145459|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 7, identity: 0.781
cgcactgtggttcaccgccgcagc--gtcgaact CRISPR spacer
agcactgttgttcaccgccgctgccggtccag-- Protospacer
******* ************ ** *** *.
376. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
gcacggtgacgctgaccggcacgccgggcgac Protospacer
**..* ******* ** *************
377. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
gcacggtgacgctgaccggcacgccgggcgac Protospacer
**..* ******* ** *************
378. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
tcgtggtgacgatcacgggcacgcggcccgcg Protospacer
**** ***** ************ * **.*
379. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
tcgtggtgacgatcacgggcacgcggcccgcg Protospacer
**** ***** ************ * **.*
380. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
gcgtgctgacgctcacgggcacg-ccgggcgtg CRISPR spacer
gcgtgctgacgctgacggtcacgttcaagctt- Protospacer
************* **** **** .*..** *
381. spacer 1.137|145642|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gagacgatgctttccagagcggtcaggcggtc CRISPR spacer
catacgatgctgtccaaagcggtcagtcagcc Protospacer
* ******** ****.********* *.*.*
382. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 7, identity: 0.781
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
aaactcgccggcgccgtgtccggtatcgcgct Protospacer
* ****** ******* *********.* *
383. spacer 1.147|146253|32|NZ_CP018044|CRISPRCasFinder,CRT matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
gtgcggacagtgggcgcgctcgggatgcagtc CRISPR spacer
attcaaacagggggcgcgctcggtatgcagac Protospacer
.* *..**** ************ ****** *
384. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.781
tcgccgccgatgccgatgggcatgatcgtcgc- CRISPR spacer
tggccgccgatgccgatggccgtgat-gccatt Protospacer
* ***************** *.**** *.*..
385. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 7, identity: 0.781
tcgccgccgatgccgatgggcatgatcgtcgc- CRISPR spacer
tgcccgccgatgccgatggccgtgat-gccgtt Protospacer
* **************** *.**** *.**.
386. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
tcgccgc--cgatgccgatgggcatgatcgtcgc CRISPR spacer
--gccattacggtgccgatgggcaagatcgtctc Protospacer
***.. **.************ ******* *
387. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.781
tcgccgc--cgatgccgatgggcatgatcgtcgc CRISPR spacer
--gccattacggtgccgatgggcaagatcgtctc Protospacer
***.. **.************ ******* *
388. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 7, identity: 0.781
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
acgaagacgaggccgatggccatgatcgtcac Protospacer
** * *** ******** **********.*
389. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
390. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
391. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
392. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
393. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
394. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
395. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
396. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
397. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
398. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
399. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
400. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
401. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
402. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
403. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
404. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
405. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
406. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
407. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
408. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gtgcccgccaccgacggcctgctgcccaccat Protospacer
*.* * . ********************.**
409. spacer 1.151|146497|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_007950 (Polaromonas sp. JS666 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
acgcggcgaagcgcgcgcgacgccgt-gcgtct CRISPR spacer
tgccggcgaagctcgcgcgaagccgtggcgac- Protospacer
********* ******* ***** *** *
410. spacer 1.154|146680|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MN096367 (Microbacterium phage Nucci, complete genome) position: , mismatch: 7, identity: 0.781
ttcgt-tcgctgctgctggaaattaagccgggt CRISPR spacer
-ccgtggcgctgctgctggaactgaagccggtc Protospacer
.*** ************** * ******* .
411. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 7, identity: 0.767
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
gaggcagcccgccatcgtcccgcgcgcgaa Protospacer
. ** ***** ****************
412. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to MF377442 (Arthrobacter phage Franzy, complete genome) position: , mismatch: 7, identity: 0.767
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
gaagctcgccgcgatcatcccgcgcgcttt Protospacer
. **** ********.********** *
413. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NC_041930 (Arthrobacter phage Brent, complete genome) position: , mismatch: 7, identity: 0.767
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
gaagctcgccgcgatcatcccgcgcgcttt Protospacer
. **** ********.********** *
414. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.767
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
gccgttgcccgcgatcgtgccgcgcgcgcc Protospacer
.*.*.* *********** ********* .
415. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
gccgttgcccgcgatcgtgccgcgcgcgcc Protospacer
.*.*.* *********** ********* .
416. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
gccgttgcccgcgatcgtgccgcgcgcgcc Protospacer
.*.*.* *********** ********* .
417. spacer 1.1|141922|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75
gtcggcaccgatggtgatgaccgcgaccaccc CRISPR spacer
ggcggtaccgatggtgatgactgcgcgggcgc Protospacer
* ***.***************.*** .* *
418. spacer 1.1|141922|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgg--caccgatggtgatgaccgcgaccaccc CRISPR spacer
--cagcccgccggtggtgaggaccgcgaccacgg Protospacer
*.* *.***.****** ************
419. spacer 1.1|141922|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025432 (Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence) position: , mismatch: 8, identity: 0.75
gtcggcaccgatggtgatgaccgcgaccaccc CRISPR spacer
gtcggcagcgatggtcatgaccgtttccgcag Protospacer
******* ******* *******. **.*
420. spacer 1.1|141922|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.75
gtcggcaccgatggtgatgaccgcgaccaccc CRISPR spacer
ggcggtaccgatggtgatgactgcgcgggcgc Protospacer
* ***.***************.*** .* *
421. spacer 1.1|141922|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.75
gtcggcaccgatggtgatgaccgcgaccaccc CRISPR spacer
ggcggtaccgatggtgatgactgcgcgggcgc Protospacer
* ***.***************.*** .* *
422. spacer 1.7|142293|32|NZ_CP018044|PILER-CR matches to NZ_CP024936 (Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcagccgacaagcagaaaccacagtccac--- CRISPR spacer
gacgcagccggcaagcagaagcca---ttcggata Protospacer
**********.*********.*** *.*.
423. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
agaggctggcggtatcgcgcgcctgcgcctgc Protospacer
******* ****.***********. * *
424. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.75
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgaggatgccggtgccgcgcgccatgcgccgg Protospacer
***** ********.******** * **
425. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgaggatgccggtgccgcgcgccatgcgccgg Protospacer
***** ********.******** * **
426. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.75
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgaggatgccggtgccgcgcgccatgcgccgg Protospacer
***** ********.******** * **
427. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgaggatgccggtgccgcgcgccatgcgccgg Protospacer
***** ********.******** * **
428. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcacggg Protospacer
******.****************.* *
429. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcacggg Protospacer
******.****************.* *
430. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcacggg Protospacer
******.****************.* *
431. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcacggg Protospacer
******.****************.* *
432. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
atccccttcgcgatcggcgccgggttcgccgc Protospacer
. *.* .*********** *** ********
433. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc- CRISPR spacer
gtgctcgccgcgctcggcggcggc-tggtggtg Protospacer
.********** *********** * *. *.
434. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ctgatcgccgcgatcgtcggcggcatcgtctg Protospacer
..* ************ ******* ***.*
435. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgtcgccgccatcgtcggcggcttcatcgt Protospacer
*. ******* **** **********..**.
436. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtggccgtgatcggcggcggcttcaccgg Protospacer
* ****.****************.***
437. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
atgaccgtggcgatcggcggtgtcttcgccgc Protospacer
.* .**. ***********.* *********
438. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gagcatctcgccatcgtcggcggcttcgccgc Protospacer
** . .*** **** ***************
439. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP045204 (Citrobacter sp. NMI7904_11 plasmid pCTEL-1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cggcccgccgcgatgggcggcggcttattctc Protospacer
. **.********* *********** .* *
440. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
acgctcgccgtggtcggcggcggcacgcgcgc Protospacer
*********.*.*********** . ***
441. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgtccgccgtgatcggcggcagcttcgggcc Protospacer
**..*****.**********.****** *
442. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
tcgctcgccgcgatcgtcggccgcgaagtgcc Protospacer
**************** **** ** *. *
443. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
caccacgccgcaatcgggggcggcttcgtggc Protospacer
. * ******.***** **********. **
444. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
caccacgccgcaatcgggggcggcttcgtggc Protospacer
. * ******.***** **********. **
445. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP020447 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtccacgccgcgaccggcggccgcttcgaccc Protospacer
. * ********.******* ****** * *
446. spacer 1.14|142723|32|NZ_CP018044|PILER-CR matches to MG603697 (Vibrio phage Vp_R1, complete genome) position: , mismatch: 8, identity: 0.75
ttagcgggacgccccaccatcgtgaggccctc CRISPR spacer
taaccctaacgccccacgaacgtgaggcccta Protospacer
* * * .********* * ***********
447. spacer 1.17|142906|32|NZ_CP018044|PILER-CR matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aagatcacgttgccgaccgaccggc-gtttgca CRISPR spacer
ccgaccccgttgccgaccgaccggctgctcgt- Protospacer
**.* ****************** *.*.*.
448. spacer 1.23|143272|32|NZ_CP018044|PILER-CR matches to NC_008739 (Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccacccggcgggcggtgtcttcgtggttg CRISPR spacer
caatttcgcggcgggctgtgtcttggtggttg Protospacer
*. .. * ******** ******* *******
449. spacer 1.23|143272|32|NZ_CP018044|PILER-CR matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccacccggcgggcggtgtcttcgtggttg CRISPR spacer
gcgccacccggcgggcggcttcttcgcctttg Protospacer
***************. ******. ***
450. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gccagcgccgacgcgccggcggcgtggttgcg Protospacer
*..** *******************.**
451. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcg--tggctgac CRISPR spacer
ggcgacggcggcgcgcccgcggcgatcagatg-- Protospacer
*********.****** ****** ..* **
452. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
453. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
454. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
455. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP015743 (Shinella sp. HZN7 plasmid pShin-07, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acctatggcgacgagccggccgcgtggctccc Protospacer
* *.******* ****** ******** *
456. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgcgccgccgacgcgccggcggccagcgagag Protospacer
**** ** *************** * **
457. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
458. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
459. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
460. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
461. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
462. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgattcggcgccgcgccagcggcgtggcgggg Protospacer
** ***** ******.********** *.
463. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cggcagagcgacgcgctggcggcgcggctgct Protospacer
** * .*********.*******.***** .
464. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggccacggcgacgcgcaggcggcgcagcaggt Protospacer
** ************ *******..** *..
465. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
466. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
467. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgcacgccggacgcgccgacggcgaggctgac Protospacer
***. *********.***** *******
468. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac----- CRISPR spacer
cgcgacgccgtcgcgccggc-----ggctgtcgccct Protospacer
******* ** ********* ***** *
469. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
470. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
471. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
472. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggctacggcggcgcgccggcggcgctggtcaa Protospacer
** ******.*************. * * *
473. spacer 1.33|143882|32|NZ_CP018044|PILER-CR matches to NZ_CP021459 (Lactobacillus brevis strain ZLB004 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
ttgtgacgccggaggttaaggcgtccattgac-- CRISPR spacer
ctgtgacgacggagattaaggcgt--atcaatca Protospacer
.******* *****.********* **..*.
474. spacer 1.42|144434|32|NZ_CP018044|PILER-CR matches to NZ_CP014199 (Escherichia coli strain MRE600 plasmid pMRE600-1, complete sequence) position: , mismatch: 8, identity: 0.75
aacgcc-gacgccattgaatcggaggcgaagaa CRISPR spacer
-ctgccggacgccattgaatcggaaccgaactt Protospacer
.*** *****************. ****
475. spacer 1.42|144434|32|NZ_CP018044|PILER-CR matches to NZ_CP014199 (Escherichia coli strain MRE600 plasmid pMRE600-1, complete sequence) position: , mismatch: 8, identity: 0.75
aacgcc-gacgccattgaatcggaggcgaagaa CRISPR spacer
-ctgccggacgccattgaatcggaaccgaactt Protospacer
.*** *****************. ****
476. spacer 1.42|144434|32|NZ_CP018044|PILER-CR matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccgacgccattgaatcggaggcgaagaa CRISPR spacer
gtcgccgccgccatcgaatcggaggaatggaa Protospacer
. ***** ******.********** . .***
477. spacer 1.42|144434|32|NZ_CP018044|PILER-CR matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccgacgccattgaatcggaggcgaagaa CRISPR spacer
gtcgccgccgccatcgaatcggaggaatggaa Protospacer
. ***** ******.********** . .***
478. spacer 1.42|144434|32|NZ_CP018044|PILER-CR matches to NZ_CP012501 (Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence) position: , mismatch: 8, identity: 0.75
aacgcc-gacgccattgaatcggaggcgaagaa CRISPR spacer
-ctgccggacgccattgaatcggaaccgaactt Protospacer
.*** *****************. ****
479. spacer 1.44|144556|32|NZ_CP018044|PILER-CR matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
480. spacer 1.44|144556|32|NZ_CP018044|PILER-CR matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
481. spacer 1.44|144556|32|NZ_CP018044|PILER-CR matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
482. spacer 1.44|144556|32|NZ_CP018044|PILER-CR matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
483. spacer 1.44|144556|32|NZ_CP018044|PILER-CR matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
484. spacer 1.44|144556|32|NZ_CP018044|PILER-CR matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
485. spacer 1.44|144556|32|NZ_CP018044|PILER-CR matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
486. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
gatataatcggtgccgagccgccgcaaggtggc Protospacer
* * *** ***** ***************
487. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP049248 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
gatgatggcgctgccgcgccgccggaagctgga Protospacer
* * **************** *** ****
488. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcctctcgctgccgccccgccgcatcctgca Protospacer
**.************ ******** ** *
489. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcttcccgctgccgccccgccgcatcctgca Protospacer
*****.********* ******** ** *
490. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcctctcgctgccgccccgccgcatcctgca Protospacer
**.************ ******** ** *
491. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcttcccgctgccgccccgccgcatcctgca Protospacer
*****.********* ******** ** *
492. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcttcccgctgccgccccgccgcatcctgca Protospacer
*****.********* ******** ** *
493. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcagcccgctgctgcgccgccgcatggtggc Protospacer
** *.******.*********** *****
494. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NC_010679 (Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
actggcgacgacgacaagatcctctccgatgt Protospacer
.*.* ***** **** *************.
495. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP017301 (Rhodococcus sp. YL-1 plasmid pYLC2, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgactacgaccagatcctcgatgtcgt Protospacer
********* ************* .* *
496. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP050127 (Rhodococcus erythropolis strain KB1 plasmid plas4, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgactacgaccagatcctcgatgtcgt Protospacer
********* ************* .* *
497. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccatatcgtcgtcccgga Protospacer
***************** *** ** .* *
498. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
499. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
500. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
501. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gttgcgattgccgcccagttcctctccgacca Protospacer
*..** . .**** **** *************
502. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
503. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
504. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gttgcgattgccgcccagttcctctccgacca Protospacer
*..** . .**** **** *************
505. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
506. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP047896 (Sphingomonas sp. C33 plasmid pC33, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctc-tccgacca CRISPR spacer
catcccggcgccgaccagatcctcacccgatc- Protospacer
. ***.**************** .****.*
507. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgacgtgatccttgcggtcgg Protospacer
*************** ******. * * * .
508. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
509. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
510. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gttgacgacgccgaccaggtcctctacgcacg Protospacer
*..* *************.****** ** *.
511. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
512. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
513. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
514. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
515. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
516. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
517. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
518. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
519. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
520. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
521. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
522. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
523. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccggcgacgacgaccagatcctgccccgcac Protospacer
**** ***** ************ .** .*
524. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
525. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
526. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
527. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
528. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
529. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
530. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
531. spacer 1.56|145288|32|NZ_CP018044|PILER-CR matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 8, identity: 0.75
ctcgtgacgatctgcttgatgcgaggaccggc CRISPR spacer
atcatgccgatctgcttgatgcgagactgcgc Protospacer
**.** ******************. . **
532. spacer 1.58|145410|32|NZ_CP018044|PILER-CR matches to NZ_CP053712 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75
atgcagaagttggcgtcgcttgaggcggacgt CRISPR spacer
gcggagaaggtggcgtcgcttgatgcgggtgc Protospacer
..* ***** ************* ****..*.
533. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcca-tccgggatgtcgagcgtcacctgatt CRISPR spacer
-agcaactccggcatgtcgagcgtcgcctgggc Protospacer
** * ***** ************.****. .
534. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctg---acgctcacgggcacgccgggcgtg CRISPR spacer
---cgccgagcacgatcacgggcacgccgagcgtc Protospacer
.**.* *** **************.****
535. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
gattgatgccgctcacgggcacgccgatgttg Protospacer
* ** ** *****************. **
536. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
ggacggtgacgctgaccggcacgccgggcgac Protospacer
* ..* ******* ** *************
537. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP013454 (Burkholderia vietnamiensis strain MSMB608WGS plasmid pMSMB608, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
tccccccgacgatcacgggcaagccgggcgag Protospacer
* . *.**** ********* ******** *
538. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
ggttgatgccgctcacgggcacgccgatgttg Protospacer
* ** ** *****************. **
539. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
gattgatgccgctcacgggcacgccgatgttg Protospacer
* ** ** *****************. **
540. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
tgggggagacgctcacggccacgctgggcgag Protospacer
* * *********** *****.***** *
541. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
ccgaccggacgctcaccggcacggcgggcgac Protospacer
** * ********* ****** ******
542. spacer 1.65|145837|32|NZ_CP018044|PILER-CR matches to NZ_CP034812 (Paracoccus sp. Arc7-R13 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgatgccgatgctcgtggtgttagcgtccca CRISPR spacer
tcgatgcctatgctcgtggtgtcagccatttt Protospacer
******** *************.*** ...
543. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
tacgtcgccgccgccttgaccggcgtggatgc Protospacer
**********.**** *******..* * *.
544. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
tacgtcgccgccgccttgaccggcgtggatgc Protospacer
**********.**** *******..* * *.
545. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
tacgtcgccgccgccttgaccggcgtggatgc Protospacer
**********.**** *******..* * *.
546. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
tacgtcgccgccgccttgaccggcgtggatgc Protospacer
**********.**** *******..* * *.
547. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
tacgtcgccgccgccttgaccggcgtggatgc Protospacer
**********.**** *******..* * *.
548. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgccgccgatgccgaaggccatgagcaccat Protospacer
.*************** ** ***** *..*..
549. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
gacctgccgatgccgctgggcctgatcgatgc Protospacer
*.********** ***** ****** .**
550. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.75
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
gacctgccgatgccgctgggcctgatcgatgc Protospacer
*.********** ***** ****** .**
551. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ttcatgcagatgccgatgggcatgctcggccc Protospacer
*. .** **************** *** * *
552. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
gcgccgacgatgccgatgggaatgcccagctc Protospacer
***** ************* *** .*. * *
553. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gacgccgacaccgagggcctgctgctcatcac Protospacer
* .* .******* **********.*****
554. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
555. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
556. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
557. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacga-acaccgacggcctgctgcccatcaa CRISPR spacer
-cgctggtacgccgacggcctgctgctcatcgg Protospacer
** .*. **.***************.****..
558. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
559. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
560. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
561. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
562. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
563. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
564. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
565. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
566. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
567. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
568. spacer 1.76|146509|32|NZ_CP018044|PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
acgcggcgaagcgcgcgcgacgccgtgcgtct CRISPR spacer
gcgcggccatgcgcgcgcgacgcccatcatcg Protospacer
.****** * ************** *.**
569. spacer 1.76|146509|32|NZ_CP018044|PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.75
acgcggcgaagcgcgcgcgacgccgtgcgtct CRISPR spacer
gcgcggccatgcgcgcgcgacgcccatcatcg Protospacer
.****** * ************** *.**
570. spacer 1.80|146753|32|NZ_CP018044|PILER-CR matches to NZ_AP019396 (Enterococcus faecium strain QU 50 plasmid pQS50, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcggttactgtcgcttcgcctatcgccgc CRISPR spacer
tcggcggttactgtcgcctcgcttagtggttt Protospacer
*****************.****.** .* . .
571. spacer 1.81|142227|31|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.742
ccacgtcgctgcggcccagcgccgtcatcca CRISPR spacer
cgaggtcgttgcgccccagcgccgtcaggat Protospacer
* * ****.**** *************
572. spacer 1.81|142227|31|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ccacgtcgctgcggcccagcgccgtcatcca CRISPR spacer
ccactttgctgcggcccagcgcctcgctctg Protospacer
**** *.**************** . **..
573. spacer 1.82|142287|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP024936 (Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcagccgacaagcagaaaccacagtccac--- CRISPR spacer
gacgcagccggcaagcagaagcca---ttcggata Protospacer
**********.*********.*** *.*.
574. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
agaggctggcggtatcgcgcgcctgcgcctgc Protospacer
******* ****.***********. * *
575. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.75
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgaggatgccggtgccgcgcgccatgcgccgg Protospacer
***** ********.******** * **
576. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgaggatgccggtgccgcgcgccatgcgccgg Protospacer
***** ********.******** * **
577. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.75
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgaggatgccggtgccgcgcgccatgcgccgg Protospacer
***** ********.******** * **
578. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgaggatgccggtgccgcgcgccatgcgccgg Protospacer
***** ********.******** * **
579. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcacggg Protospacer
******.****************.* *
580. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcacggg Protospacer
******.****************.* *
581. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcacggg Protospacer
******.****************.* *
582. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtgatcggcggcggcttcacggg Protospacer
******.****************.* *
583. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
atccccttcgcgatcggcgccgggttcgccgc Protospacer
. *.* .*********** *** ********
584. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc- CRISPR spacer
gtgctcgccgcgctcggcggcggc-tggtggtg Protospacer
.********** *********** * *. *.
585. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ctgatcgccgcgatcgtcggcggcatcgtctg Protospacer
..* ************ ******* ***.*
586. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgtcgccgccatcgtcggcggcttcatcgt Protospacer
*. ******* **** **********..**.
587. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtggccgtgatcggcggcggcttcaccgg Protospacer
* ****.****************.***
588. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
atgaccgtggcgatcggcggtgtcttcgccgc Protospacer
.* .**. ***********.* *********
589. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gagcatctcgccatcgtcggcggcttcgccgc Protospacer
** . .*** **** ***************
590. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP045204 (Citrobacter sp. NMI7904_11 plasmid pCTEL-1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cggcccgccgcgatgggcggcggcttattctc Protospacer
. **.********* *********** .* *
591. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
acgctcgccgtggtcggcggcggcacgcgcgc Protospacer
*********.*.*********** . ***
592. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgtccgccgtgatcggcggcagcttcgggcc Protospacer
**..*****.**********.****** *
593. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
tcgctcgccgcgatcgtcggccgcgaagtgcc Protospacer
**************** **** ** *. *
594. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
caccacgccgcaatcgggggcggcttcgtggc Protospacer
. * ******.***** **********. **
595. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
caccacgccgcaatcgggggcggcttcgtggc Protospacer
. * ******.***** **********. **
596. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP020447 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gtccacgccgcgaccggcggccgcttcgaccc Protospacer
. * ********.******* ****** * *
597. spacer 1.89|142714|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MG603697 (Vibrio phage Vp_R1, complete genome) position: , mismatch: 8, identity: 0.75
ttagcgggacgccccaccatcgtgaggccctc CRISPR spacer
taaccctaacgccccacgaacgtgaggcccta Protospacer
* * * .********* * ***********
598. spacer 1.92|142897|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aagatcacgttgccgaccgaccggc-gtttgca CRISPR spacer
ccgaccccgttgccgaccgaccggctgctcgt- Protospacer
**.* ****************** *.*.*.
599. spacer 1.98|143263|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_008739 (Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccacccggcgggcggtgtcttcgtggttg CRISPR spacer
caatttcgcggcgggctgtgtcttggtggttg Protospacer
*. .. * ******** ******* *******
600. spacer 1.98|143263|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccacccggcgggcggtgtcttcgtggttg CRISPR spacer
gcgccacccggcgggcggcttcttcgcctttg Protospacer
***************. ******. ***
601. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gccagcgccgacgcgccggcggcgtggttgcg Protospacer
*..** *******************.**
602. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcg--tggctgac CRISPR spacer
ggcgacggcggcgcgcccgcggcgatcagatg-- Protospacer
*********.****** ****** ..* **
603. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
604. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
605. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
606. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015743 (Shinella sp. HZN7 plasmid pShin-07, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acctatggcgacgagccggccgcgtggctccc Protospacer
* *.******* ****** ******** *
607. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgcgccgccgacgcgccggcggccagcgagag Protospacer
**** ** *************** * **
608. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
609. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
610. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
611. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
612. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
613. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgattcggcgccgcgccagcggcgtggcgggg Protospacer
** ***** ******.********** *.
614. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cggcagagcgacgcgctggcggcgcggctgct Protospacer
** * .*********.*******.***** .
615. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggccacggcgacgcgcaggcggcgcagcaggt Protospacer
** ************ *******..** *..
616. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
617. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
618. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
cgcacgccggacgcgccgacggcgaggctgac Protospacer
***. *********.***** *******
619. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac----- CRISPR spacer
cgcgacgccgtcgcgccggc-----ggctgtcgccct Protospacer
******* ** ********* ***** *
620. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
621. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
622. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gggaagtgcgacgcgccggcggcgtcgatggc Protospacer
* .* ****************** * **.*
623. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggctacggcggcgcgccggcggcgctggtcaa Protospacer
** ******.*************. * * *
624. spacer 1.108|143873|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021459 (Lactobacillus brevis strain ZLB004 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
ttgtgacgccggaggttaaggcgtccattgac-- CRISPR spacer
ctgtgacgacggagattaaggcgt--atcaatca Protospacer
.******* *****.********* **..*.
625. spacer 1.117|144422|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP014199 (Escherichia coli strain MRE600 plasmid pMRE600-1, complete sequence) position: , mismatch: 8, identity: 0.75
aacgcc-gacgccattgaatcggaggcgaagaa CRISPR spacer
-ctgccggacgccattgaatcggaaccgaactt Protospacer
.*** *****************. ****
626. spacer 1.117|144422|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP014199 (Escherichia coli strain MRE600 plasmid pMRE600-1, complete sequence) position: , mismatch: 8, identity: 0.75
aacgcc-gacgccattgaatcggaggcgaagaa CRISPR spacer
-ctgccggacgccattgaatcggaaccgaactt Protospacer
.*** *****************. ****
627. spacer 1.117|144422|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccgacgccattgaatcggaggcgaagaa CRISPR spacer
gtcgccgccgccatcgaatcggaggaatggaa Protospacer
. ***** ******.********** . .***
628. spacer 1.117|144422|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.75
aacgccgacgccattgaatcggaggcgaagaa CRISPR spacer
gtcgccgccgccatcgaatcggaggaatggaa Protospacer
. ***** ******.********** . .***
629. spacer 1.117|144422|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012501 (Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence) position: , mismatch: 8, identity: 0.75
aacgcc-gacgccattgaatcggaggcgaagaa CRISPR spacer
-ctgccggacgccattgaatcggaaccgaactt Protospacer
.*** *****************. ****
630. spacer 1.119|144544|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
631. spacer 1.119|144544|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
632. spacer 1.119|144544|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
633. spacer 1.119|144544|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
634. spacer 1.119|144544|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
635. spacer 1.119|144544|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
636. spacer 1.119|144544|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 8, identity: 0.75
accacctgccccgtcaaaaactgccagttgat CRISPR spacer
tccacctgcctcggcaaaaactgcgcatcgag Protospacer
*********.** ********** .*.**
637. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
gatataatcggtgccgagccgccgcaaggtggc Protospacer
* * *** ***** ***************
638. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP049248 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
gatgatggcgctgccgcgccgccggaagctgga Protospacer
* * **************** *** ****
639. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcctctcgctgccgccccgccgcatcctgca Protospacer
**.************ ******** ** *
640. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcttcccgctgccgccccgccgcatcctgca Protospacer
*****.********* ******** ** *
641. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcctctcgctgccgccccgccgcatcctgca Protospacer
**.************ ******** ** *
642. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcttcccgctgccgccccgccgcatcctgca Protospacer
*****.********* ******** ** *
643. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcttcccgctgccgccccgccgcatcctgca Protospacer
*****.********* ******** ** *
644. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcagcccgctgctgcgccgccgcatggtggc Protospacer
** *.******.*********** *****
645. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_010679 (Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
actggcgacgacgacaagatcctctccgatgt Protospacer
.*.* ***** **** *************.
646. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP017301 (Rhodococcus sp. YL-1 plasmid pYLC2, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgactacgaccagatcctcgatgtcgt Protospacer
********* ************* .* *
647. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP050127 (Rhodococcus erythropolis strain KB1 plasmid plas4, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgactacgaccagatcctcgatgtcgt Protospacer
********* ************* .* *
648. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccatatcgtcgtcccgga Protospacer
***************** *** ** .* *
649. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
650. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
651. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
652. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gttgcgattgccgcccagttcctctccgacca Protospacer
*..** . .**** **** *************
653. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
654. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
655. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gttgcgattgccgcccagttcctctccgacca Protospacer
*..** . .**** **** *************
656. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
657. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP047896 (Sphingomonas sp. C33 plasmid pC33, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctc-tccgacca CRISPR spacer
catcccggcgccgaccagatcctcacccgatc- Protospacer
. ***.**************** .****.*
658. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgacgtgatccttgcggtcgg Protospacer
*************** ******. * * * .
659. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
660. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
661. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gttgacgacgccgaccaggtcctctacgcacg Protospacer
*..* *************.****** ** *.
662. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
663. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
664. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
665. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
666. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
667. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
668. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
669. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
670. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
671. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
672. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
673. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
674. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccggcgacgacgaccagatcctgccccgcac Protospacer
**** ***** ************ .** .*
675. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
676. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
677. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
678. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgaagccgacctgatcctgatcgaagg Protospacer
******** ******* ****** .*** .
679. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
680. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
681. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgatgccgacctgatcctgatcgaagg Protospacer
********.******* ****** .*** .
682. spacer 1.131|145276|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 8, identity: 0.75
ctcgtgacgatctgcttgatgcgaggaccggc CRISPR spacer
atcatgccgatctgcttgatgcgagactgcgc Protospacer
**.** ******************. . **
683. spacer 1.133|145398|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP053712 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75
atgcagaagttggcgtcgcttgaggcggacgt CRISPR spacer
gcggagaaggtggcgtcgcttgatgcgggtgc Protospacer
..* ***** ************* ****..*.
684. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcca-tccgggatgtcgagcgtcacctgatt CRISPR spacer
-agcaactccggcatgtcgagcgtcgcctgggc Protospacer
** * ***** ************.****. .
685. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctg---acgctcacgggcacgccgggcgtg CRISPR spacer
---cgccgagcacgatcacgggcacgccgagcgtc Protospacer
.**.* *** **************.****
686. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
gattgatgccgctcacgggcacgccgatgttg Protospacer
* ** ** *****************. **
687. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
ggacggtgacgctgaccggcacgccgggcgac Protospacer
* ..* ******* ** *************
688. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013454 (Burkholderia vietnamiensis strain MSMB608WGS plasmid pMSMB608, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
tccccccgacgatcacgggcaagccgggcgag Protospacer
* . *.**** ********* ******** *
689. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
ggttgatgccgctcacgggcacgccgatgttg Protospacer
* ** ** *****************. **
690. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
gattgatgccgctcacgggcacgccgatgttg Protospacer
* ** ** *****************. **
691. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
tgggggagacgctcacggccacgctgggcgag Protospacer
* * *********** *****.***** *
692. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
ccgaccggacgctcaccggcacggcgggcgac Protospacer
** * ********* ****** ******
693. spacer 1.140|145825|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP034812 (Paracoccus sp. Arc7-R13 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgatgccgatgctcgtggtgttagcgtccca CRISPR spacer
tcgatgcctatgctcgtggtgtcagccatttt Protospacer
******** *************.*** ...
694. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
tacgtcgccgccgccttgaccggcgtggatgc Protospacer
**********.**** *******..* * *.
695. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
tacgtcgccgccgccttgaccggcgtggatgc Protospacer
**********.**** *******..* * *.
696. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
tacgtcgccgccgccttgaccggcgtggatgc Protospacer
**********.**** *******..* * *.
697. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
tacgtcgccgccgccttgaccggcgtggatgc Protospacer
**********.**** *******..* * *.
698. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
tacgtcgccgccgccttgaccggcgtggatgc Protospacer
**********.**** *******..* * *.
699. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgccgccgatgccgaaggccatgagcaccat Protospacer
.*************** ** ***** *..*..
700. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
gacctgccgatgccgctgggcctgatcgatgc Protospacer
*.********** ***** ****** .**
701. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.75
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
gacctgccgatgccgctgggcctgatcgatgc Protospacer
*.********** ***** ****** .**
702. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ttcatgcagatgccgatgggcatgctcggccc Protospacer
*. .** **************** *** * *
703. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
gcgccgacgatgccgatgggaatgcccagctc Protospacer
***** ************* *** .*. * *
704. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gacgccgacaccgagggcctgctgctcatcac Protospacer
* .* .******* **********.*****
705. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
706. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
707. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
708. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacga-acaccgacggcctgctgcccatcaa CRISPR spacer
-cgctggtacgccgacggcctgctgctcatcgg Protospacer
** .*. **.***************.****..
709. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
710. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
711. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
712. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
713. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
714. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
715. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
716. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
717. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
718. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gcacccgccaccgacggcctgctgccgaccat Protospacer
**. * . ****************** *.**
719. spacer 1.151|146497|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
acgcggcgaagcgcgcgcgacgccgtgcgtct CRISPR spacer
gcgcggccatgcgcgcgcgacgcccatcatcg Protospacer
.****** * ************** *.**
720. spacer 1.151|146497|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.75
acgcggcgaagcgcgcgcgacgccgtgcgtct CRISPR spacer
gcgcggccatgcgcgcgcgacgcccatcatcg Protospacer
.****** * ************** *.**
721. spacer 1.155|146741|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP019396 (Enterococcus faecium strain QU 50 plasmid pQS50, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcggttactgtcgcttcgcctatcgccgc CRISPR spacer
tcggcggttactgtcgcctcgcttagtggttt Protospacer
*****************.****.** .* . .
722. spacer 6.2|1059737|37|NZ_CP018044|CRT matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 8, identity: 0.784
cgatgaccgcgacgaccgccgtgccga---ccgtgactat CRISPR spacer
ggatgtccgtgacgaccgccgtgccgatggccggggc--- Protospacer
**** ***.***************** *** *.*
723. spacer 9.1|2122718|30|NZ_CP018044|CRISPRCasFinder matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 8, identity: 0.733
gggcctcttcgcgaccatcgcagacgcatc CRISPR spacer
gggcctcttcgcgatcatcgccctggccgt Protospacer
**************.****** ** .
724. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
gcgcgaacgcgcgatcggcccgcgcgcgat Protospacer
.* * ******** ************
725. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 8, identity: 0.733
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
gcgcgaacgcgcgatcggcccgcgcgcgat Protospacer
.* * ******** ************
726. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
cgtctaccccgagatcgtcgcgcgcgcgaa Protospacer
* . ***** ******* *********
727. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 8, identity: 0.733
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
catgccccccgcgatcgtcccgcccaccgc Protospacer
***.***************** *.* ..
728. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NZ_CP042333 (Bosea sp. F3-2 plasmid pB32-2, complete sequence) position: , mismatch: 8, identity: 0.733
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
actgctcccggcgatcatcccgccgatggg Protospacer
********* ******.****** ..*.
729. spacer 1.1|141922|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
gtcggcaccgatggtgatgaccgcgaccaccc CRISPR spacer
cacggcaccggtgttgatgaccgcgaagccgt Protospacer
********.** ************ * .
730. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
cgtggctgcgtacgctgccgccgctgcgcgtg Protospacer
.* *********.**********.***...
731. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
gcgcgctgcatacacggccgccgccgcgccgg Protospacer
* .*****.***** ************.
732. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
cgtggctgcgtacgctgccgccgctgcgcgtg Protospacer
.* *********.**********.***...
733. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
gcgcgctgcatacacggccgccgccgcgccgg Protospacer
* .*****.***** ************.
734. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
gcgcgctgcatacacggccgccgccgcgccgg Protospacer
* .*****.***** ************.
735. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgagggtgctggtgtcgcgcgccgtggcggcc Protospacer
***** ***.************* **.
736. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NZ_CP044550 (Hydrogenophaga sp. BPS33 plasmid pBPS33-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
acacgctgccgatgtcgcgcgcctttccatca Protospacer
* *******.************ ***. .
737. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 9, identity: 0.719
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
agaggctggcggtatcgcgcgcctgcgactgc Protospacer
******* ****.***********. *
738. spacer 1.8|142354|32|NZ_CP018044|PILER-CR matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 9, identity: 0.719
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
agaggctggccgtgtcgcgcgcctgcgactgc Protospacer
******* * **************. *
739. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcatcgcggcgatcgtcggcggcttcaacca Protospacer
*. **** ******* **********. *
740. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP015746 (Shinella sp. HZN7 plasmid pShin-10, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctcgccgcgttcggcggcggctcgatgct Protospacer
*********** ************. .. .
741. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gatctcgccgcgatcggcgggcgctttggaga Protospacer
***************** ****.* *
742. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gagcatctggcgatcgtcggcggcttcgcggc Protospacer
** . . ******* ************ **
743. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gactacgccgccatcggcgacggcttcgcctt Protospacer
. ****** *******.********** .
744. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cgtcacgccgcgatcggcggtggcttcgatct Protospacer
. * ***************.******* . .
745. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gccgccgccgcgaccggcggcggcatcgttgt Protospacer
* .********.********** ***..*.
746. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcctcgatcgcgatccgcggcagcttcgccgc Protospacer
* .. ..******* *****.**********
747. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctggccgcgatcagcggcggcgtgttcaa Protospacer
**** *********.******** * .*.
748. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcatcgcggcgatcgtcggcggcttcaacca Protospacer
*. **** ******* **********. *
749. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcatcgcggcgatcgtcggcggcttcaacca Protospacer
*. **** ******* **********. *
750. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctggccgcgatcagcggcggcgtgttcaa Protospacer
**** *********.******** * .*.
751. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctcggcgcgctcggcggcggcggaagcgt Protospacer
****** **** *********** . **.
752. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP042824 (Rhizobium sp. WL3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
tccctcgccgcgatcgtcggcgggggaggcta Protospacer
** ************* ****** * *
753. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_AP014811 (Methylorubrum populi strain P-1M plasmid pMPPM02, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
tcgctcgccgggatcagcggcggatcgacatg Protospacer
********** ****.******* *. .*
754. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctcgccgcgaccggcagcggcacgggcct Protospacer
************.****.***** . * * .
755. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP020897 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
756. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcggtcgccgcgaccggcggcggcgcgctggc Protospacer
** *********.********** . . **
757. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_007764 (Rhizobium etli CFN 42 plasmid p42c, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccga Protospacer
*. * .*** ************.******
758. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
759. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
760. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP020908 (Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccga Protospacer
*. * .*** ************.******
761. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013108 (Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcatcgcggcgatcgtcggcggcttcaacca Protospacer
*. **** ******* **********. *
762. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtcatcggcggcggcttcacggg Protospacer
******. ***************.* *
763. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
764. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
atccaatccgcgatgggcggcggcttcacccc Protospacer
. * ******* ************.** *
765. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ccgctcgccgccgtcggcggcggcgccggatg Protospacer
.********** .*********** .**
766. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
767. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
768. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
769. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
770. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
771. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
772. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
773. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
774. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_021907 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccga Protospacer
*. * .*** ************.******
775. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
776. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ccgctcgccgagatcggtggcggcgatgaggg Protospacer
.********* ******.****** .* *
777. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
778. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP047900 (Pseudarthrobacter sp. YJ56 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
accgtcgccgcgatcggcggcgccgtctgcat Protospacer
* ****************** * ** *..
779. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP014690 (Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc- CRISPR spacer
agtatctccgcgatcagcggcggcttc-cagta Protospacer
** ********.*********** * *.
780. spacer 1.12|142601|32|NZ_CP018044|PILER-CR matches to MT639653 (Arthrobacter phage Elezi, complete genome) position: , mismatch: 9, identity: 0.719
aacgttttgtccgtcgcgctcatgggcgccgt CRISPR spacer
accaacccctccgtcgagctcgtgggcgccgt Protospacer
* *. ... ******* ****.**********
781. spacer 1.12|142601|32|NZ_CP018044|PILER-CR matches to MT889366 (Arthrobacter phage London, complete genome) position: , mismatch: 9, identity: 0.719
aacgttttgtccgtcgcgctcatgggcgccgt CRISPR spacer
accaacccctccgtcgagctcgtgggcgccgt Protospacer
* *. ... ******* ****.**********
782. spacer 1.13|142662|32|NZ_CP018044|PILER-CR matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcggtcgtcagcgacggaacggaggtgggtc CRISPR spacer
ggacgtcgtcagcgacgtgacggaggtcatgg Protospacer
** ************* .******** .
783. spacer 1.21|143150|32|NZ_CP018044|PILER-CR matches to NZ_CP022994 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN4, complete sequence) position: , mismatch: 9, identity: 0.719
gagcaggaagcgtcctacatcaccggcaagag CRISPR spacer
agtgatgacgcgtcctacatcaccggccaggc Protospacer
.. * ** ****************** **.
784. spacer 1.23|143272|32|NZ_CP018044|PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccacccggcgggcggtgtcttcgtggttg-- CRISPR spacer
gtcccagccggcgggcggtgtcatc--ggccagc Protospacer
**** *************** ** **...
785. spacer 1.23|143272|32|NZ_CP018044|PILER-CR matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccacccggcgggcggtgtct-----tcgtggttg CRISPR spacer
cgcccgcccggcgggcggtgcctagaccttgc----- Protospacer
*****.**************.** *.*.
786. spacer 1.23|143272|32|NZ_CP018044|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccacccggcgggcggtgtcttcgtggttg CRISPR spacer
tcccggccaggcgggcggtgtcttcttgggca Protospacer
. ** .** **************** *** ..
787. spacer 1.23|143272|32|NZ_CP018044|PILER-CR matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccacccggcgggcggtgtcttcgtggttg CRISPR spacer
tacccacccggcgggcgtagtcttcaaaggcg Protospacer
..*************** ******. .* .*
788. spacer 1.23|143272|32|NZ_CP018044|PILER-CR matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 9, identity: 0.719
cgcccacccggcgggcggtgtcttcgtggttg CRISPR spacer
gaccaacccggcgggcggtatcttccagcgcg Protospacer
.** **************.***** * .*
789. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
accgacagcgaagcgccggcggcgtcgagcag Protospacer
****.**** ************* * *
790. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
accgacagcgaagcgccggcggcgtcgagcag Protospacer
****.**** ************* * *
791. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggcgacggcggggcgccggcggcgatgaactc Protospacer
*********. ************ * *
792. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
793. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
794. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
795. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
796. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP007798 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggcgacggcggggcgccggcggcgatgaactc Protospacer
*********. ************ * *
797. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggcgaccgcggcgcgccggcggcgcagcgcgg Protospacer
***** ***.*************..** .
798. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
799. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
accgacagcgaagcgccggcggcgtcgagcag Protospacer
****.**** ************* * *
800. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
801. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
accgacagcgaagcgccggcggcgtcgagcag Protospacer
****.**** ************* * *
802. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
803. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
804. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
tgcgccggcgccgcgccggcggcggatttcaa Protospacer
.*** ***** ************* . .* *
805. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
806. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
807. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
808. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
809. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
810. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
811. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
812. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
813. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
814. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
815. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
816. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gacatcggcgacgcggcggcggcgcggcggcg Protospacer
.*. ********** ********.*** *
817. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
818. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
819. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
820. spacer 1.31|143760|32|NZ_CP018044|PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacggggagcc CRISPR spacer
ggcgatgatctcgctcaccgccatgcgtgcgg Protospacer
**** *************** **.* * .
821. spacer 1.31|143760|32|NZ_CP018044|PILER-CR matches to NC_018580 (Gordonia sp. KTR9 plasmid pGKT2, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacg----gggagcc CRISPR spacer
tgcgccgatctcgctcacccacacaccacagg---- Protospacer
****.************* ****. .**
822. spacer 1.31|143760|32|NZ_CP018044|PILER-CR matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacggggagcc CRISPR spacer
gccgatgatctcgctcgccgacacgacgctgg Protospacer
* ** ***********.********. *
823. spacer 1.31|143760|32|NZ_CP018044|PILER-CR matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacggggagcc--- CRISPR spacer
tcgcctgatcgcgctcaccgacaccg---gcctgg Protospacer
****** ************* * ***
824. spacer 1.31|143760|32|NZ_CP018044|PILER-CR matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacggggagcc CRISPR spacer
gccgatgatctcgctcgccgacacgacgctgg Protospacer
* ** ***********.********. *
825. spacer 1.31|143760|32|NZ_CP018044|PILER-CR matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacggggagcc CRISPR spacer
gccgatgatctcgctcgccgacacgacgctgg Protospacer
* ** ***********.********. *
826. spacer 1.36|144065|32|NZ_CP018044|PILER-CR matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgtgcgtttgcgggcgggcaggtggagatct CRISPR spacer
gtccgggcttgcggccgggcaggtagagatca Protospacer
. .* *.****** *********.******
827. spacer 1.36|144065|32|NZ_CP018044|PILER-CR matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 9, identity: 0.719
tcgtgcgtttgcgggcgggcaggtggagatct CRISPR spacer
ggatgcgtttgcgggcggcctggtggtcaacg Protospacer
.*************** * ***** * *
828. spacer 1.36|144065|32|NZ_CP018044|PILER-CR matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 9, identity: 0.719
tcgtgcgtttgcgggcgggcaggtggagatct CRISPR spacer
aggcgcgtttgcgggggggcaggcggaatacg Protospacer
*.*********** *******.***. *
829. spacer 1.40|144312|32|NZ_CP018044|PILER-CR matches to MN033618 (Leviviridae sp. isolate H2_Bulk_35_scaffold_360 hypothetical protein (H2Bulk35360_000001), hypothetical protein (H2Bulk35360_000002), and RNA-dependent RNA polymerase (H2Bulk35360_000003) genes, complete cds) position: , mismatch: 9, identity: 0.719
aattttcaaactacagtcgccgtgtccctcaa CRISPR spacer
acggctgtgactacagtagctgtgtccctcaa Protospacer
* .* .******** **.***********
830. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 9, identity: 0.727
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcctctcgctgccgccccgccgcatcctgcg Protospacer
**.************ ******** ** .
831. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP009295 (Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
ctcatcgacgccgaccagaaccgctccgccgt Protospacer
.*..************** ** ***** *
832. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccacattcttcagcgcta Protospacer
***************** **.**.. .*.*
833. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP009439 (Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
cggaccgacgtcgaccagaccctctcccccga Protospacer
.******.********.******* * *
834. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
atcgaagacgccgtccggatcctctccgatac Protospacer
..** ******* **.************.
835. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
cggaccgacgtcgaccagaccctctcccccga Protospacer
.******.********.******* * *
836. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
ctcctctacgccggcaagatcctctccgacag Protospacer
.* .* ******.* ************** .
837. spacer 1.50|144923|32|NZ_CP018044|PILER-CR matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 9, identity: 0.719
agccgcctccgtggcctgtccgacaccgggcg CRISPR spacer
caactcgtccatgtcctgtccgacaccgggat Protospacer
. * * ***.** ****************
838. spacer 1.50|144923|32|NZ_CP018044|PILER-CR matches to MK937603 (Gordonia phage Bakery, complete genome) position: , mismatch: 9, identity: 0.719
agccgcctccgtggcctgtccgacaccgggcg CRISPR spacer
ccaggtccgcgtggcctggacgacaccgggcg Protospacer
*.*. ********* ************
839. spacer 1.54|145166|32|NZ_CP018044|PILER-CR matches to NZ_CP020695 (Sulfitobacter sp. D7 plasmid p1SUD7, complete sequence) position: , mismatch: 9, identity: 0.719
tccgagcaatgccacatcggtcacctaccggc CRISPR spacer
cgcgggcaatgccacatcgatcacccggcgtg Protospacer
. **.**************.*****.. **
840. spacer 1.55|145227|32|NZ_CP018044|PILER-CR matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gtatccggcgtgccgaaaatcgagaagagagt CRISPR spacer
ccaacgaacgtgccgaatatcgagaagacagg Protospacer
.* * ..********* ********** **
841. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcca--tccgggatgtcgagcgtcacctgatt CRISPR spacer
--agcagctccggcatgtcgagcgtcgcctgcgc Protospacer
. ** ***** ************.**** .
842. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcca--tccgggatgtcgagcgtcacctgatt CRISPR spacer
--agcagctccggcatgtcgagcgtcgcctgggc Protospacer
. ** ***** ************.****. .
843. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcca--tccgggatgtcgagcgtcacctgatt CRISPR spacer
--agcagctccggcatgtcgagcgtcgcctggac Protospacer
. ** ***** ************.****. .
844. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
aatcggtgacgctgaccggcacgccgggcgac Protospacer
. .* ******* ** *************
845. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
aaacggtgacgctgaccggcacgccgggcgac Protospacer
. ..* ******* ** *************
846. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
aatcggtgacgctgaccggcacgccgggcgac Protospacer
. .* ******* ** *************
847. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
aatcggtgacgctgaccggcacgccgggcgac Protospacer
. .* ******* ** *************
848. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
aatcggtgacgctgaccggcacgccgggcgac Protospacer
. .* ******* ** *************
849. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
acgtgctgaccctcacgggcaagcgcgatcgg Protospacer
.********* ********** ** *.. *
850. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacg---ccgggcgtg CRISPR spacer
tcgtgctgacgctcaagtgcacgcgtccaacc--- Protospacer
************** * ***** **.. *
851. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
gatccctgacggtcacgggcacgcgggggttc Protospacer
* . ****** ************ *** *
852. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
ccacgggcacgctcagcggcacgccgggcgta Protospacer
*..* ******* **************.
853. spacer 1.62|145654|32|NZ_CP018044|PILER-CR matches to NZ_CP042810 (Acetobacter oryzoeni strain B6 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gagacgatgctttccagagcggtcaggcggtc CRISPR spacer
atacccttgccttcaagagcggtcaggcggtt Protospacer
. . * ***.*** ****************.
854. spacer 1.62|145654|32|NZ_CP018044|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gagacgatgctttccagagcggtcaggcggtc CRISPR spacer
ccgcccatggattccagagcggtcaggcgcga Protospacer
* * *** ******************
855. spacer 1.62|145654|32|NZ_CP018044|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719
gagacgatgctttccagagcggtcaggcggtc CRISPR spacer
ccgcccatggattccagagcggtcaggcgcga Protospacer
* * *** ******************
856. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 9, identity: 0.719
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
gttttcgccgtcgccgagaccgggatcgatgg Protospacer
. ************ ****** **** *
857. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.719
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
ccggcggccgtggcagtgaccggtatcgttgc Protospacer
. *. ***** ** ************** *.
858. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.719
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
ccggcggccgtggcagtgaccggtatcgttgc Protospacer
. *. ***** ** ************** *.
859. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
860. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
861. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
cgggcgccgatgccgatcggcctgatcgggct Protospacer
. * ************* *** ****** .
862. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
863. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ggagcccggatgctgatggacatgatcgtcgg Protospacer
. * * *****.*****.***********
864. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
865. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
866. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
867. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
868. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
869. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
870. spacer 1.73|146326|32|NZ_CP018044|PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
gcatagtcgatgccgttgggcacgatcgtcag Protospacer
*.. *.******** ******.*******.
871. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to NZ_CP029360 (Azospirillum sp. CFH 70021 plasmid unnamed5) position: , mismatch: 9, identity: 0.719
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gacgccgtcaccgacggcctggtgcccgtcac Protospacer
* .* . ************* *****.***
872. spacer 1.75|146448|32|NZ_CP018044|PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
gcgctggtcggcgtcatggtcgccgtggaagc Protospacer
******* *.************** .. *
873. spacer 1.75|146448|32|NZ_CP018044|PILER-CR matches to KU160664 (Arthrobacter phage Salgado, complete genome) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacaccctcatggtcgccattgacac Protospacer
********* * *********** *..*.
874. spacer 1.75|146448|32|NZ_CP018044|PILER-CR matches to MN585972 (Arthrobacter phage Edmundo, complete genome) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacaccctcatggtcgccattgacac Protospacer
********* * *********** *..*.
875. spacer 1.75|146448|32|NZ_CP018044|PILER-CR matches to MF140418 (Arthrobacter phage LiSara, complete genome) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacaccctcatggtcgccattgacac Protospacer
********* * *********** *..*.
876. spacer 1.75|146448|32|NZ_CP018044|PILER-CR matches to MF140427 (Arthrobacter phage Shrooms, complete genome) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacaccctcatggtcgccattgacac Protospacer
********* * *********** *..*.
877. spacer 1.75|146448|32|NZ_CP018044|PILER-CR matches to KU160654 (Arthrobacter phage Laroye, complete genome) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacaccctcatggtcgccattgacac Protospacer
********* * *********** *..*.
878. spacer 1.76|146509|32|NZ_CP018044|PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
acgcggcgaagcgcgcgcgacgccgtgcgtct CRISPR spacer
acgcgacgaagcccgcgcgacgctcgccgaag Protospacer
*****.****** **********. **
879. spacer 1.81|142227|31|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP043940 (Lactobacillus nenjiangensis strain SH-Y15 plasmid pHY011, complete sequence) position: , mismatch: 9, identity: 0.71
ccacgtcgctgcggcccagcgccgtcatcca CRISPR spacer
tagcgtcgctgcggtccagcgccttctagcc Protospacer
. .***********.******** ** *
880. spacer 1.81|142227|31|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP014681 (Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-1, complete sequence) position: , mismatch: 9, identity: 0.71
ccacgtcgctgcggcccagcgccgtcatcca CRISPR spacer
tagcgtcgctgcggtccagcgccttctagcc Protospacer
. .***********.******** ** *
881. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
cgagggtgctggtgtcgcgcgccgtggcggcc Protospacer
***** ***.************* **.
882. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP044550 (Hydrogenophaga sp. BPS33 plasmid pBPS33-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
acacgctgccgatgtcgcgcgcctttccatca Protospacer
* *******.************ ***. .
883. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 9, identity: 0.719
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
agaggctggcggtatcgcgcgcctgcgactgc Protospacer
******* ****.***********. *
884. spacer 1.83|142348|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 9, identity: 0.719
cgaggctgccggtgtcgcgcgcctgtccgagg CRISPR spacer
agaggctggccgtgtcgcgcgcctgcgactgc Protospacer
******* * **************. *
885. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcatcgcggcgatcgtcggcggcttcaacca Protospacer
*. **** ******* **********. *
886. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015746 (Shinella sp. HZN7 plasmid pShin-10, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctcgccgcgttcggcggcggctcgatgct Protospacer
*********** ************. .. .
887. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gatctcgccgcgatcggcgggcgctttggaga Protospacer
***************** ****.* *
888. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gagcatctggcgatcgtcggcggcttcgcggc Protospacer
** . . ******* ************ **
889. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gactacgccgccatcggcgacggcttcgcctt Protospacer
. ****** *******.********** .
890. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cgtcacgccgcgatcggcggtggcttcgatct Protospacer
. * ***************.******* . .
891. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gccgccgccgcgaccggcggcggcatcgttgt Protospacer
* .********.********** ***..*.
892. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcctcgatcgcgatccgcggcagcttcgccgc Protospacer
* .. ..******* *****.**********
893. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctggccgcgatcagcggcggcgtgttcaa Protospacer
**** *********.******** * .*.
894. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcatcgcggcgatcgtcggcggcttcaacca Protospacer
*. **** ******* **********. *
895. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcatcgcggcgatcgtcggcggcttcaacca Protospacer
*. **** ******* **********. *
896. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctggccgcgatcagcggcggcgtgttcaa Protospacer
**** *********.******** * .*.
897. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctcggcgcgctcggcggcggcggaagcgt Protospacer
****** **** *********** . **.
898. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP042824 (Rhizobium sp. WL3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
tccctcgccgcgatcgtcggcgggggaggcta Protospacer
** ************* ****** * *
899. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP014811 (Methylorubrum populi strain P-1M plasmid pMPPM02, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
tcgctcgccgggatcagcggcggatcgacatg Protospacer
********** ****.******* *. .*
900. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctcgccgcgaccggcagcggcacgggcct Protospacer
************.****.***** . * * .
901. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP020897 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
902. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcggtcgccgcgaccggcggcggcgcgctggc Protospacer
** *********.********** . . **
903. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_007764 (Rhizobium etli CFN 42 plasmid p42c, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccga Protospacer
*. * .*** ************.******
904. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
905. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
906. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP020908 (Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccga Protospacer
*. * .*** ************.******
907. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013108 (Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcatcgcggcgatcgtcggcggcttcaacca Protospacer
*. **** ******* **********. *
908. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gacgtcgccgtcatcggcggcggcttcacggg Protospacer
******. ***************.* *
909. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
910. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
atccaatccgcgatgggcggcggcttcacccc Protospacer
. * ******* ************.** *
911. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ccgctcgccgccgtcggcggcggcgccggatg Protospacer
.********** .*********** .**
912. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
913. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
914. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
915. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
916. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
917. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
918. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
919. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
920. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_021907 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccga Protospacer
*. * .*** ************.******
921. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
922. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ccgctcgccgagatcggtggcggcgatgaggg Protospacer
.********* ******.****** .* *
923. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcagtgctcgccatcggcggcggcctcgccgg Protospacer
*. * .*** ************.******
924. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP047900 (Pseudarthrobacter sp. YJ56 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
accgtcgccgcgatcggcggcgccgtctgcat Protospacer
* ****************** * ** *..
925. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP014690 (Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgctcgccgcgatcggcggcggcttcgccgc- CRISPR spacer
agtatctccgcgatcagcggcggcttc-cagta Protospacer
** ********.*********** * *.
926. spacer 1.87|142592|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MT639653 (Arthrobacter phage Elezi, complete genome) position: , mismatch: 9, identity: 0.719
aacgttttgtccgtcgcgctcatgggcgccgt CRISPR spacer
accaacccctccgtcgagctcgtgggcgccgt Protospacer
* *. ... ******* ****.**********
927. spacer 1.87|142592|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MT889366 (Arthrobacter phage London, complete genome) position: , mismatch: 9, identity: 0.719
aacgttttgtccgtcgcgctcatgggcgccgt CRISPR spacer
accaacccctccgtcgagctcgtgggcgccgt Protospacer
* *. ... ******* ****.**********
928. spacer 1.88|142653|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcggtcgtcagcgacggaacggaggtgggtc CRISPR spacer
ggacgtcgtcagcgacgtgacggaggtcatgg Protospacer
** ************* .******** .
929. spacer 1.96|143141|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022994 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN4, complete sequence) position: , mismatch: 9, identity: 0.719
gagcaggaagcgtcctacatcaccggcaagag CRISPR spacer
agtgatgacgcgtcctacatcaccggccaggc Protospacer
.. * ** ****************** **.
930. spacer 1.98|143263|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccacccggcgggcggtgtcttcgtggttg-- CRISPR spacer
gtcccagccggcgggcggtgtcatc--ggccagc Protospacer
**** *************** ** **...
931. spacer 1.98|143263|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccacccggcgggcggtgtct-----tcgtggttg CRISPR spacer
cgcccgcccggcgggcggtgcctagaccttgc----- Protospacer
*****.**************.** *.*.
932. spacer 1.98|143263|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccacccggcgggcggtgtcttcgtggttg CRISPR spacer
tcccggccaggcgggcggtgtcttcttgggca Protospacer
. ** .** **************** *** ..
933. spacer 1.98|143263|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccacccggcgggcggtgtcttcgtggttg CRISPR spacer
tacccacccggcgggcgtagtcttcaaaggcg Protospacer
..*************** ******. .* .*
934. spacer 1.98|143263|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 9, identity: 0.719
cgcccacccggcgggcggtgtcttcgtggttg CRISPR spacer
gaccaacccggcgggcggtatcttccagcgcg Protospacer
.** **************.***** * .*
935. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
accgacagcgaagcgccggcggcgtcgagcag Protospacer
****.**** ************* * *
936. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
accgacagcgaagcgccggcggcgtcgagcag Protospacer
****.**** ************* * *
937. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggcgacggcggggcgccggcggcgatgaactc Protospacer
*********. ************ * *
938. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
939. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
940. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
941. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
942. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP007798 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggcgacggcggggcgccggcggcgatgaactc Protospacer
*********. ************ * *
943. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggcgaccgcggcgcgccggcggcgcagcgcgg Protospacer
***** ***.*************..** .
944. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
945. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
accgacagcgaagcgccggcggcgtcgagcag Protospacer
****.**** ************* * *
946. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
947. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
accgacagcgaagcgccggcggcgtcgagcag Protospacer
****.**** ************* * *
948. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
949. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
950. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
tgcgccggcgccgcgccggcggcggatttcaa Protospacer
.*** ***** ************* . .* *
951. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
952. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
953. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
954. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
955. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
956. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
957. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
958. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
959. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
960. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
961. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
962. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gacatcggcgacgcggcggcggcgcggcggcg Protospacer
.*. ********** ********.*** *
963. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
964. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
965. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
atcgactgcgacgcgccgacggcgtctatcgc Protospacer
**** ***********.****** * .*
966. spacer 1.106|143751|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacggggagcc CRISPR spacer
ggcgatgatctcgctcaccgccatgcgtgcgg Protospacer
**** *************** **.* * .
967. spacer 1.106|143751|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_018580 (Gordonia sp. KTR9 plasmid pGKT2, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacg----gggagcc CRISPR spacer
tgcgccgatctcgctcacccacacaccacagg---- Protospacer
****.************* ****. .**
968. spacer 1.106|143751|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacggggagcc CRISPR spacer
gccgatgatctcgctcgccgacacgacgctgg Protospacer
* ** ***********.********. *
969. spacer 1.106|143751|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacggggagcc--- CRISPR spacer
tcgcctgatcgcgctcaccgacaccg---gcctgg Protospacer
****** ************* * ***
970. spacer 1.106|143751|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacggggagcc CRISPR spacer
gccgatgatctcgctcgccgacacgacgctgg Protospacer
* ** ***********.********. *
971. spacer 1.106|143751|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 9, identity: 0.719
ggcgctgatctcgctcaccgacacggggagcc CRISPR spacer
gccgatgatctcgctcgccgacacgacgctgg Protospacer
* ** ***********.********. *
972. spacer 1.111|144056|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgtgcgtttgcgggcgggcaggtggagatct CRISPR spacer
gtccgggcttgcggccgggcaggtagagatca Protospacer
. .* *.****** *********.******
973. spacer 1.111|144056|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 9, identity: 0.719
tcgtgcgtttgcgggcgggcaggtggagatct CRISPR spacer
ggatgcgtttgcgggcggcctggtggtcaacg Protospacer
.*************** * ***** * *
974. spacer 1.111|144056|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 9, identity: 0.719
tcgtgcgtttgcgggcgggcaggtggagatct CRISPR spacer
aggcgcgtttgcgggggggcaggcggaatacg Protospacer
*.*********** *******.***. *
975. spacer 1.113|144178|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 9, identity: 0.719
acgttgaaccatttatcggatatttttttgtt CRISPR spacer
aagagaaaccatttatcagatatatttttaac Protospacer
* * .***********.***** *****. .
976. spacer 1.115|144300|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MN033618 (Leviviridae sp. isolate H2_Bulk_35_scaffold_360 hypothetical protein (H2Bulk35360_000001), hypothetical protein (H2Bulk35360_000002), and RNA-dependent RNA polymerase (H2Bulk35360_000003) genes, complete cds) position: , mismatch: 9, identity: 0.719
aattttcaaactacagtcgccgtgtccctcaa CRISPR spacer
acggctgtgactacagtagctgtgtccctcaa Protospacer
* .* .******** **.***********
977. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 9, identity: 0.727
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
acgcctctcgctgccgccccgccgcatcctgcg Protospacer
**.************ ******** ** .
978. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP009295 (Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
ctcatcgacgccgaccagaaccgctccgccgt Protospacer
.*..************** ** ***** *
979. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
gccgccgacgccgaccacattcttcagcgcta Protospacer
***************** **.**.. .*.*
980. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP009439 (Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
cggaccgacgtcgaccagaccctctcccccga Protospacer
.******.********.******* * *
981. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
atcgaagacgccgtccggatcctctccgatac Protospacer
..** ******* **.************.
982. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
cggaccgacgtcgaccagaccctctcccccga Protospacer
.******.********.******* * *
983. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 9, identity: 0.719
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
ctcctctacgccggcaagatcctctccgacag Protospacer
.* .* ******.* ************** .
984. spacer 1.125|144911|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 9, identity: 0.719
agccgcctccgtggcctgtccgacaccgggcg CRISPR spacer
caactcgtccatgtcctgtccgacaccgggat Protospacer
. * * ***.** ****************
985. spacer 1.125|144911|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MK937603 (Gordonia phage Bakery, complete genome) position: , mismatch: 9, identity: 0.719
agccgcctccgtggcctgtccgacaccgggcg CRISPR spacer
ccaggtccgcgtggcctggacgacaccgggcg Protospacer
*.*. ********* ************
986. spacer 1.129|145154|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP020695 (Sulfitobacter sp. D7 plasmid p1SUD7, complete sequence) position: , mismatch: 9, identity: 0.719
tccgagcaatgccacatcggtcacctaccggc CRISPR spacer
cgcgggcaatgccacatcgatcacccggcgtg Protospacer
. **.**************.*****.. **
987. spacer 1.130|145215|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gtatccggcgtgccgaaaatcgagaagagagt CRISPR spacer
ccaacgaacgtgccgaatatcgagaagacagg Protospacer
.* * ..********* ********** **
988. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcca--tccgggatgtcgagcgtcacctgatt CRISPR spacer
--agcagctccggcatgtcgagcgtcgcctgcgc Protospacer
. ** ***** ************.**** .
989. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcca--tccgggatgtcgagcgtcacctgatt CRISPR spacer
--agcagctccggcatgtcgagcgtcgcctgggc Protospacer
. ** ***** ************.****. .
990. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcca--tccgggatgtcgagcgtcacctgatt CRISPR spacer
--agcagctccggcatgtcgagcgtcgcctggac Protospacer
. ** ***** ************.****. .
991. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
aatcggtgacgctgaccggcacgccgggcgac Protospacer
. .* ******* ** *************
992. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
aaacggtgacgctgaccggcacgccgggcgac Protospacer
. ..* ******* ** *************
993. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
aatcggtgacgctgaccggcacgccgggcgac Protospacer
. .* ******* ** *************
994. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
aatcggtgacgctgaccggcacgccgggcgac Protospacer
. .* ******* ** *************
995. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
aatcggtgacgctgaccggcacgccgggcgac Protospacer
. .* ******* ** *************
996. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
acgtgctgaccctcacgggcaagcgcgatcgg Protospacer
.********* ********** ** *.. *
997. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacg---ccgggcgtg CRISPR spacer
tcgtgctgacgctcaagtgcacgcgtccaacc--- Protospacer
************** * ***** **.. *
998. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
gatccctgacggtcacgggcacgcgggggttc Protospacer
* . ****** ************ *** *
999. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
ccacgggcacgctcagcggcacgccgggcgta Protospacer
*..* ******* **************.
1000. spacer 1.137|145642|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP042810 (Acetobacter oryzoeni strain B6 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gagacgatgctttccagagcggtcaggcggtc CRISPR spacer
atacccttgccttcaagagcggtcaggcggtt Protospacer
. . * ***.*** ****************.
1001. spacer 1.137|145642|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gagacgatgctttccagagcggtcaggcggtc CRISPR spacer
ccgcccatggattccagagcggtcaggcgcga Protospacer
* * *** ******************
1002. spacer 1.137|145642|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719
gagacgatgctttccagagcggtcaggcggtc CRISPR spacer
ccgcccatggattccagagcggtcaggcgcga Protospacer
* * *** ******************
1003. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 9, identity: 0.719
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
gttttcgccgtcgccgagaccgggatcgatgg Protospacer
. ************ ****** **** *
1004. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.719
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
ccggcggccgtggcagtgaccggtatcgttgc Protospacer
. *. ***** ** ************** *.
1005. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.719
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
ccggcggccgtggcagtgaccggtatcgttgc Protospacer
. *. ***** ** ************** *.
1006. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
1007. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
1008. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
cgggcgccgatgccgatcggcctgatcgggct Protospacer
. * ************* *** ****** .
1009. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
1010. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ggagcccggatgctgatggacatgatcgtcgg Protospacer
. * * *****.*****.***********
1011. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
1012. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
1013. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
1014. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
1015. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
1016. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
ccgacgccgatgccgatgcgcatgccggtgaa Protospacer
.** ************** ***** . ** .
1017. spacer 1.148|146314|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccgccgatgccgatgggcatgatcgtcgc CRISPR spacer
gcatagtcgatgccgttgggcacgatcgtcag Protospacer
*.. *.******** ******.*******.
1018. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP029360 (Azospirillum sp. CFH 70021 plasmid unnamed5) position: , mismatch: 9, identity: 0.719
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
gacgccgtcaccgacggcctggtgcccgtcac Protospacer
* .* . ************* *****.***
1019. spacer 1.150|146436|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
gcgctggtcggcgtcatggtcgccgtggaagc Protospacer
******* *.************** .. *
1020. spacer 1.150|146436|32|NZ_CP018044|CRISPRCasFinder,CRT matches to KU160664 (Arthrobacter phage Salgado, complete genome) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacaccctcatggtcgccattgacac Protospacer
********* * *********** *..*.
1021. spacer 1.150|146436|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MN585972 (Arthrobacter phage Edmundo, complete genome) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacaccctcatggtcgccattgacac Protospacer
********* * *********** *..*.
1022. spacer 1.150|146436|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MF140418 (Arthrobacter phage LiSara, complete genome) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacaccctcatggtcgccattgacac Protospacer
********* * *********** *..*.
1023. spacer 1.150|146436|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MF140427 (Arthrobacter phage Shrooms, complete genome) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacaccctcatggtcgccattgacac Protospacer
********* * *********** *..*.
1024. spacer 1.150|146436|32|NZ_CP018044|CRISPRCasFinder,CRT matches to KU160654 (Arthrobacter phage Laroye, complete genome) position: , mismatch: 9, identity: 0.719
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacaccctcatggtcgccattgacac Protospacer
********* * *********** *..*.
1025. spacer 1.151|146497|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
acgcggcgaagcgcgcgcgacgccgtgcgtct CRISPR spacer
acgcgacgaagcccgcgcgacgctcgccgaag Protospacer
*****.****** **********. **
1026. spacer 9.1|2122718|30|NZ_CP018044|CRISPRCasFinder matches to NZ_CP048419 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
gggcctcttcgcgaccatcgcagacgcatc CRISPR spacer
tcaagtcttcgagaccatcgcagacgaaag Protospacer
. ****** ************** *
1027. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NZ_CP019949 (Methylocystis bryophila strain S285 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
gtatggccccgcgatggtcacgcgcgcgaa Protospacer
.. ********* *** *********
1028. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.7
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
cagatccaccgcgctcgtcccgcgcgcgac Protospacer
...* ***** ***************.
1029. spacer 9.2|2122771|30|NZ_CP018044|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.7
actgctccccgcgatcgtcccgcgcgcgat CRISPR spacer
cagatccaccgcgctcgtcccgcgcgcgac Protospacer
...* ***** ***************.
1030. spacer 1.1|141922|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 10, identity: 0.688
gtcggcaccgatggtgatgaccgcgaccaccc CRISPR spacer
ccacgcaccgagggtgatcaccgcgacggcga Protospacer
. ******* ****** ******** .*
1031. spacer 1.1|141922|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688
gtcggcaccgatggtgatgaccgcgaccaccc CRISPR spacer
gatcagaccgatggtgaagaccgccaccatga Protospacer
* . . *********** ****** ****.
1032. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
gcgcgctgcatacacggccgccgccgcaccgg Protospacer
* .*****.***** ***********..
1033. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 10, identity: 0.688
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
acaggctgcgaccactgccgccgccgccagcg Protospacer
. ****** *************** .*
1034. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 10, identity: 0.688
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
acaggctgcgaccactgccgccgccgccagcg Protospacer
. ****** *************** .*
1035. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
gcgcgctgcatacacggccgccgccgcaccgg Protospacer
* .*****.***** ***********..
1036. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
gcgcgctgcatacacggccgccgccgcaccgg Protospacer
* .*****.***** ***********..
1037. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
gcgcgctgcatacacggccgccgccgcaccgg Protospacer
* .*****.***** ***********..
1038. spacer 1.4|142105|32|NZ_CP018044|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gattgctgcgtacactgccgccgccgcgtact CRISPR spacer
gcgcgctgcatacacggccgccgccgcaccgg Protospacer
* .*****.***** ***********..
1039. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ataccatgcgcgatcggcggcggctgcgtcgg Protospacer
..*. ***************** **.**
1040. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgacgccgcgatcggcggtggtttcgaact Protospacer
*. ***************.**.**** .
1041. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgacgccgcgatcggcggtggtttcgaact Protospacer
*. ***************.**.**** .
1042. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgacgccgcgatcggcggtggtttcgaact Protospacer
*. ***************.**.**** .
1043. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgacgccgcgatcggcggtggtttcgaact Protospacer
*. ***************.**.**** .
1044. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgacgccgcgatcggcggtggtttcgaact Protospacer
*. ***************.**.**** .
1045. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctcggcgcgctcggcggcggcggaagtgt Protospacer
****** **** *********** . .*.
1046. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctcggcgcgctcggcggcggcggaagtgt Protospacer
****** **** *********** . .*.
1047. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP009293 (Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
acgcttgccgcgttcggcggcggctcaatgct Protospacer
****.****** ************. .. .
1048. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
agcctcgccccgatcggcggcgacttcttgct Protospacer
****** ************.**** . .
1049. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP044388 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-3, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gaagctgccgcgctcggcggcggcttggccaa Protospacer
. ..****** ************* ***.
1050. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
acgcccgccccgatcggcggcggcagggagtt Protospacer
***.**** ************** * .
1051. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
acgcccgccccgatcggcggcggcagggagtt Protospacer
***.**** ************** * .
1052. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aacacggccgcgatcggcgccggcctcgcgtc Protospacer
. ************* ****.**** *
1053. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NC_012521 (Rhodococcus opacus B4 plasmid pROB02, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cacaccttcgcgttcggcggcgccttcgccgg Protospacer
. .* .**** ********* ********
1054. spacer 1.15|142784|32|NZ_CP018044|PILER-CR matches to NZ_KM017071 (Sphingomonas sp. JE1 plasmid pJE1, complete sequence) position: , mismatch: 10, identity: 0.688
tacgggtcggtgtggtccgatccgccgtacac CRISPR spacer
ggctggtcggcctggtccgatccgccgcgacg Protospacer
.* ******. ***************..
1055. spacer 1.22|143211|32|NZ_CP018044|PILER-CR matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
accggtgtcggtgatggtgtgccatgcttggg CRISPR spacer
tccggtgtcggtgttggtgttccagccgaacc Protospacer
************ ****** *** * .
1056. spacer 1.22|143211|32|NZ_CP018044|PILER-CR matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
accggtgtcggtgatggtgtgccatgcttggg CRISPR spacer
tccggtgtcggtgttggtgttccagccgaacc Protospacer
************ ****** *** * .
1057. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggcgacggcgacgctccggccgcgcctacccc Protospacer
************* ***** ***. . *
1058. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acatccggcgccgcgccggcggcctggcccaa Protospacer
***** ************ ****. *
1059. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acatccggcgccgcgccggcggcctggcccaa Protospacer
***** ************ ****. *
1060. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acatccggcgccgcgccggcggcctggcccaa Protospacer
***** ************ ****. *
1061. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acatccggcgccgcgccggcggcctggcccaa Protospacer
***** ************ ****. *
1062. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggcgacggcgacccgcaggcggcggaacgcct Protospacer
*********** *** ******* ..* .
1063. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acatccggcgccgcgccggcggcctggcccaa Protospacer
***** ************ ****. *
1064. spacer 1.27|143516|32|NZ_CP018044|PILER-CR matches to NZ_KT950740 (Escherichia coli strain 10-Beta plasmid pJM50, complete sequence) position: , mismatch: 10, identity: 0.688
gtctgtggctatcggcatgtcgttgtcatagg CRISPR spacer
tgctgtggccatcggcatgtcggtgatgacga Protospacer
*******.************ ** .. *.
1065. spacer 1.27|143516|32|NZ_CP018044|PILER-CR matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 10, identity: 0.688
gtctgtggctatcggcatgtcgttgtcatagg CRISPR spacer
tgctgtggccatcggcatgtcggtgatgacga Protospacer
*******.************ ** .. *.
1066. spacer 1.42|144434|32|NZ_CP018044|PILER-CR matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.688
aacgccgacgccattgaatcggaggcgaagaa CRISPR spacer
gacgccgacgccattgaagccgagatcgacgg Protospacer
.***************** * ***.. .* ..
1067. spacer 1.46|144678|33|NZ_CP018044|PILER-CR matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 10, identity: 0.697
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
ggaagttccgctgccgctcctccgcaaggtggt Protospacer
.. *..********* ** ***********
1068. spacer 1.47|144740|32|NZ_CP018044|PILER-CR matches to NC_004934 (Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence) position: , mismatch: 10, identity: 0.688
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
cggaccgacgtcgaccagaccctctcccccgt Protospacer
.******.********.******* *
1069. spacer 1.50|144923|32|NZ_CP018044|PILER-CR matches to MF766045 (Streptomyces phage Daudau, complete genome) position: , mismatch: 10, identity: 0.688
agccgcctccgtggcctgtccgacaccgggcg CRISPR spacer
gtacttgtccttggccggtccgacaccgggtc Protospacer
. * . *** ***** *************.
1070. spacer 1.51|144984|32|NZ_CP018044|PILER-CR matches to MG711460 (Faecalibacterium phage FP_Mushu, complete genome) position: , mismatch: 10, identity: 0.688
atgcgacgcgcgaagcgtgagtacgacggtga CRISPR spacer
aacgaccgcgagaagcgtgagtacgagggcac Protospacer
* . **** *************** **..
1071. spacer 1.56|145288|32|NZ_CP018044|PILER-CR matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ctcgtgacgatctgcttgatgcgaggaccggc CRISPR spacer
gggaggccgatctgcttcacgcgaggaccgag Protospacer
. * ********** *.**********.
1072. spacer 1.56|145288|32|NZ_CP018044|PILER-CR matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ctcgtgacgatctgcttgatgcgaggaccggc CRISPR spacer
gggaggccgatctgcttcacgcgaggaccgag Protospacer
. * ********** *.**********.
1073. spacer 1.56|145288|32|NZ_CP018044|PILER-CR matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 10, identity: 0.688
ctcgtgacgatctgcttgatgcgaggaccggc CRISPR spacer
gggaggccgatctgcttcacgcgaggaccgag Protospacer
. * ********** *.**********.
1074. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1075. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1076. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1077. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1078. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1079. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1080. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1081. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1082. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1083. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1084. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1085. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1086. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1087. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1088. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1089. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1090. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1091. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1092. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1093. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1094. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1095. spacer 1.60|145532|32|NZ_CP018044|PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1096. spacer 1.61|145593|32|NZ_CP018044|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
caaggctggcgctcacgggtacgccggcctga Protospacer
. ****.**********.******* * .
1097. spacer 1.74|146387|32|NZ_CP018044|PILER-CR matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
atcccgaacgccggcggcctgctgccctgtta Protospacer
.. *****.***.************* . *
1098. spacer 1.75|146448|32|NZ_CP018044|PILER-CR matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacagcgtcaaggccgccttcgcgca Protospacer
*************** **.****. .. *
1099. spacer 1.75|146448|32|NZ_CP018044|PILER-CR matches to MG592395 (Vibrio phage 1.009.O._10N.261.51.C9, partial genome) position: , mismatch: 10, identity: 0.688
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
gcgcagcacagcgtcatggtcgcacgcctgct Protospacer
**** * **************** *..
1100. spacer 1.81|142227|31|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 10, identity: 0.677
ccacgtcgctgcggcccagcgccgtcatcca CRISPR spacer
tattcaagctgcggccctgcgccatcatccg Protospacer
. . ********** *****.******.
1101. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ataccatgcgcgatcggcggcggctgcgtcgg Protospacer
..*. ***************** **.**
1102. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgacgccgcgatcggcggtggtttcgaact Protospacer
*. ***************.**.**** .
1103. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgacgccgcgatcggcggtggtttcgaact Protospacer
*. ***************.**.**** .
1104. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgacgccgcgatcggcggtggtttcgaact Protospacer
*. ***************.**.**** .
1105. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgacgccgcgatcggcggtggtttcgaact Protospacer
*. ***************.**.**** .
1106. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ttcgacgccgcgatcggcggtggtttcgaact Protospacer
*. ***************.**.**** .
1107. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctcggcgcgctcggcggcggcggaagtgt Protospacer
****** **** *********** . .*.
1108. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gcgctcggcgcgctcggcggcggcggaagtgt Protospacer
****** **** *********** . .*.
1109. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP009293 (Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
acgcttgccgcgttcggcggcggctcaatgct Protospacer
****.****** ************. .. .
1110. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
agcctcgccccgatcggcggcgacttcttgct Protospacer
****** ************.**** . .
1111. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP044388 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-3, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gaagctgccgcgctcggcggcggcttggccaa Protospacer
. ..****** ************* ***.
1112. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
acgcccgccccgatcggcggcggcagggagtt Protospacer
***.**** ************** * .
1113. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
acgcccgccccgatcggcggcggcagggagtt Protospacer
***.**** ************** * .
1114. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aacacggccgcgatcggcgccggcctcgcgtc Protospacer
. ************* ****.**** *
1115. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_012521 (Rhodococcus opacus B4 plasmid pROB02, complete sequence) position: , mismatch: 10, identity: 0.688
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
cacaccttcgcgttcggcggcgccttcgccgg Protospacer
. .* .**** ********* ********
1116. spacer 1.90|142775|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_KM017071 (Sphingomonas sp. JE1 plasmid pJE1, complete sequence) position: , mismatch: 10, identity: 0.688
tacgggtcggtgtggtccgatccgccgtacac CRISPR spacer
ggctggtcggcctggtccgatccgccgcgacg Protospacer
.* ******. ***************..
1117. spacer 1.97|143202|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
accggtgtcggtgatggtgtgccatgcttggg CRISPR spacer
tccggtgtcggtgttggtgttccagccgaacc Protospacer
************ ****** *** * .
1118. spacer 1.97|143202|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
accggtgtcggtgatggtgtgccatgcttggg CRISPR spacer
tccggtgtcggtgttggtgttccagccgaacc Protospacer
************ ****** *** * .
1119. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggcgacggcgacgctccggccgcgcctacccc Protospacer
************* ***** ***. . *
1120. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acatccggcgccgcgccggcggcctggcccaa Protospacer
***** ************ ****. *
1121. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acatccggcgccgcgccggcggcctggcccaa Protospacer
***** ************ ****. *
1122. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acatccggcgccgcgccggcggcctggcccaa Protospacer
***** ************ ****. *
1123. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acatccggcgccgcgccggcggcctggcccaa Protospacer
***** ************ ****. *
1124. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
ggcgacggcgacccgcaggcggcggaacgcct Protospacer
*********** *** ******* ..* .
1125. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
acatccggcgccgcgccggcggcctggcccaa Protospacer
***** ************ ****. *
1126. spacer 1.102|143507|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_KT950740 (Escherichia coli strain 10-Beta plasmid pJM50, complete sequence) position: , mismatch: 10, identity: 0.688
gtctgtggctatcggcatgtcgttgtcatagg CRISPR spacer
tgctgtggccatcggcatgtcggtgatgacga Protospacer
*******.************ ** .. *.
1127. spacer 1.102|143507|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 10, identity: 0.688
gtctgtggctatcggcatgtcgttgtcatagg CRISPR spacer
tgctgtggccatcggcatgtcggtgatgacga Protospacer
*******.************ ** .. *.
1128. spacer 1.117|144422|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.688
aacgccgacgccattgaatcggaggcgaagaa CRISPR spacer
gacgccgacgccattgaagccgagatcgacgg Protospacer
.***************** * ***.. .* ..
1129. spacer 1.121|144666|33|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 10, identity: 0.697
cagcttctcgctgccgcgccgccgcaaggtgga CRISPR spacer
ggaagttccgctgccgctcctccgcaaggtggt Protospacer
.. *..********* ** ***********
1130. spacer 1.122|144728|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_004934 (Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence) position: , mismatch: 10, identity: 0.688
gccgccgacgccgaccagatcctctccgacca CRISPR spacer
cggaccgacgtcgaccagaccctctcccccgt Protospacer
.******.********.******* *
1131. spacer 1.125|144911|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MF766045 (Streptomyces phage Daudau, complete genome) position: , mismatch: 10, identity: 0.688
agccgcctccgtggcctgtccgacaccgggcg CRISPR spacer
gtacttgtccttggccggtccgacaccgggtc Protospacer
. * . *** ***** *************.
1132. spacer 1.126|144972|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MG711460 (Faecalibacterium phage FP_Mushu, complete genome) position: , mismatch: 10, identity: 0.688
atgcgacgcgcgaagcgtgagtacgacggtga CRISPR spacer
aacgaccgcgagaagcgtgagtacgagggcac Protospacer
* . **** *************** **..
1133. spacer 1.131|145276|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ctcgtgacgatctgcttgatgcgaggaccggc CRISPR spacer
gggaggccgatctgcttcacgcgaggaccgag Protospacer
. * ********** *.**********.
1134. spacer 1.131|145276|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ctcgtgacgatctgcttgatgcgaggaccggc CRISPR spacer
gggaggccgatctgcttcacgcgaggaccgag Protospacer
. * ********** *.**********.
1135. spacer 1.131|145276|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 10, identity: 0.688
ctcgtgacgatctgcttgatgcgaggaccggc CRISPR spacer
gggaggccgatctgcttcacgcgaggaccgag Protospacer
. * ********** *.**********.
1136. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1137. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1138. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1139. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1140. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1141. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1142. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1143. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1144. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1145. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1146. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1147. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1148. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1149. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1150. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1151. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1152. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1153. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1154. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1155. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1156. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1157. spacer 1.135|145520|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.688
tcgccatccgggatgtcgagcgtcacctgatt CRISPR spacer
accacatgcgggatggcgagcgtcaccgcgac Protospacer
* *** ******* *********** . .
1158. spacer 1.136|145581|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688
gcgtgctgacgctcacgggcacgccgggcgtg CRISPR spacer
caaggctggcgctcacgggtacgccggcctga Protospacer
. ****.**********.******* * .
1159. spacer 1.149|146375|32|NZ_CP018044|CRISPRCasFinder,CRT matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gcgacgaacaccgacggcctgctgcccatcaa CRISPR spacer
atcccgaacgccggcggcctgctgccctgtta Protospacer
.. *****.***.************* . *
1160. spacer 1.150|146436|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
ccgctggacagcgtcaaggccgccttcgcgca Protospacer
*************** **.****. .. *
1161. spacer 1.150|146436|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MG592395 (Vibrio phage 1.009.O._10N.261.51.C9, partial genome) position: , mismatch: 10, identity: 0.688
gcgctggacagcgtcatggtcgcccatagcga CRISPR spacer
gcgcagcacagcgtcatggtcgcacgcctgct Protospacer
**** * **************** *..
1162. spacer 6.2|1059737|37|NZ_CP018044|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.73
cgatgaccgcgacgaccgccgtgccgaccgtgactat CRISPR spacer
cgatgcccgcgacgatcgccgtgccgactttcgtcgc Protospacer
***** *********.************. * .....
1163. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 11, identity: 0.656
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gaaggcgccgcgatgggcggcggcctcgaact Protospacer
. ********* *********.*** .
1164. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 11, identity: 0.656
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aatggggccgcggtcggcgggggcttcgcgat Protospacer
******.******* ******** ..
1165. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 11, identity: 0.656
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aacggcgccgcgctcggcggcggcctcgagat Protospacer
******* ***********.*** ..
1166. spacer 1.16|142845|32|NZ_CP018044|PILER-CR matches to MN693946 (Marine virus AFVG_250M886, complete genome) position: , mismatch: 11, identity: 0.656
gtcagcaacatgacgctgcaaactgcaatcag CRISPR spacer
atcaacaccatgacgctgcaaactatcccttt Protospacer
.***.** ****************.. ..
1167. spacer 1.42|144434|32|NZ_CP018044|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
aacgccgacgccattgaatcggaggcgaagaa CRISPR spacer
cggatcgacgcgatcgaatcggaggcgattcc Protospacer
. ..****** **.*************
1168. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 11, identity: 0.656
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
cacgtcgccgtcggcgtcaccggtgaaagcac Protospacer
.************ *** ******. . ..
1169. spacer 1.70|146142|32|NZ_CP018044|PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 11, identity: 0.656
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
cacgtcgccgtcggcgtcaccggtgaaagcac Protospacer
.************ *** ******. . ..
1170. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 11, identity: 0.656
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
gaaggcgccgcgatgggcggcggcctcgaact Protospacer
. ********* *********.*** .
1171. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 11, identity: 0.656
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aatggggccgcggtcggcgggggcttcgcgat Protospacer
******.******* ******** ..
1172. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 11, identity: 0.656
tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
aacggcgccgcgctcggcggcggcctcgagat Protospacer
******* ***********.*** ..
1173. spacer 1.91|142836|32|NZ_CP018044|CRISPRCasFinder,CRT matches to MN693946 (Marine virus AFVG_250M886, complete genome) position: , mismatch: 11, identity: 0.656
gtcagcaacatgacgctgcaaactgcaatcag CRISPR spacer
atcaacaccatgacgctgcaaactatcccttt Protospacer
.***.** ****************.. ..
1174. spacer 1.117|144422|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
aacgccgacgccattgaatcggaggcgaagaa CRISPR spacer
cggatcgacgcgatcgaatcggaggcgattcc Protospacer
. ..****** **.*************
1175. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 11, identity: 0.656
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
cacgtcgccgtcggcgtcaccggtgaaagcac Protospacer
.************ *** ******. . ..
1176. spacer 1.145|146130|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 11, identity: 0.656
tacgtcgccgtcgccgtgaccggtatcgtggt CRISPR spacer
cacgtcgccgtcggcgtcaccggtgaaagcac Protospacer
.************ *** ******. . ..
1177. spacer 6.2|1059737|37|NZ_CP018044|CRT matches to NZ_CP007798 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence) position: , mismatch: 12, identity: 0.676
cgatgaccgcgacgaccgccgtgccgaccgtgactat CRISPR spacer
ggatgtccgtgacgaccgccgtgccgatggccggagc Protospacer
**** ***.*****************. *. . ..
1178. spacer 1.24|143333|32|NZ_CP018044|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 14, identity: 0.562
------cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gcggcgctggccgccggcgcgccgccgacgcg------ Protospacer
* * ** **.******* **.**.*
1179. spacer 1.99|143324|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 14, identity: 0.562
------cgcgacggcgacgcgccggcggcgtggctgac CRISPR spacer
gcggcgctggccgccggcgcgccgccgacgcg------ Protospacer
* * ** **.******* **.**.*
1180. spacer 1.10|142476|32|NZ_CP018044|PILER-CR matches to NZ_CP022192 (Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence) position: , mismatch: 18, identity: 0.438
---------------tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ggccatctgccgccgccgctcgccgcgagcga--------------- Protospacer
.************ **.
1181. spacer 1.85|142470|32|NZ_CP018044|CRISPRCasFinder,CRT matches to NZ_CP022192 (Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence) position: , mismatch: 18, identity: 0.438
---------------tcgctcgccgcgatcggcggcggcttcgccgc CRISPR spacer
ggccatctgccgccgccgctcgccgcgagcga--------------- Protospacer
.************ **.
